Cancer Research Audrey Hepburn  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeWeese, T. L.
Right arrow Articles by Simons, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeWeese, T. L.
Right arrow Articles by Simons, J. W.
[Cancer Research 61, 7464-7472, October 15, 2001]
© 2001 American Association for Cancer Research


Clinical Investigations

A Phase I Trial of CV706, a Replication-competent, PSA Selective Oncolytic Adenovirus, for the Treatment of Locally Recurrent Prostate Cancer following Radiation Therapy1

Theodore L. DeWeese2, Henk van der Poel, Shidong Li, Bahar Mikhak, Renee Drew, Marti Goemann, Ulrike Hamper, Robert DeJong, Nicholas Detorie, Ronald Rodriguez, Thomas Haulk, Angelo M. DeMarzo, Steven Piantadosi, D. C. Yu, Yu Chen, Daniel R. Henderson, Michael A. Carducci, William G. Nelson and Jonathan W. Simons

Divisions of Radiation Oncology [T. L. D., S. L., R. D., N. D., T. H.], Medical Oncology [H. v. d. P., B. M., M. G., M. A. C., W. G. N., J. W. S.], and Biostatistics [S. P.], The Johns Hopkins Oncology Center, Baltimore, Maryland 21231-1000; Departments of Urology [T. L. D., R. R., M. A. C., W. G. N., J. W. S.], Radiology [U. H., R. D.], and Pathology [A. M. D.], The Johns Hopkins Hospital, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21231-1000, and Calydon, Inc., Sunnyvale, California [D. C. Y., Y. C., D. R. H.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CV706 is a prostate-specific antigen (PSA)-selective, replication-competent adenovirus that has been shown to selectively kill human prostate cancer xenografts in preclinical models. To study the safety and activity of intraprostatic delivery of CV706, a Phase I dose-ranging study for the treatment of patients with locally recurrent prostate cancer after radiation therapy was conducted. Twenty patients in five groups were treated with between 1 x 1011 and 1 x 1013 viral particles delivered by a real-time, transrectal ultrasound-guided transperineal technique using a three-dimensional plan. The primary end point was the determination of treatment-related toxicity. Secondary objectives included evaluation of the antitumor activity of CV706 and monitoring for other correlates of antineoplastic action. In this study, CV706 was found to be safe and was not associated with irreversible grade 3 or any grade 4 toxicity. No grade >1 alterations in liver function tests associated with CV706 administration were observed. Posttreatment prostatic biopsies and detection of a delayed "peak" of circulating copies of virus provided evidence of intraprostatic replication of CV706. The study defined the timing of CV706 shedding into blood and urine as well as the appearance of circulating Ad5 neutralizing antibodies. Finally, this study documents the serum PSA response of treated patients and reveals a dose response showing that all five patients who achieved a >=50% reduction in PSA were treated with the highest two doses of CV706. This study represents the first clinical translation of a prostate-specific, replication-restricted adenovirus for the treatment of prostate cancer. Taken together, this study documents that intraprostatic delivery of CV706 can be safely administered to patients, even at high doses, and the data also suggest that CV706 possesses enough clinical activity, as reflected by changes in serum PSA, to warrant additional clinical and laboratory investigation.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Radiation therapy is frequently used in the definitive management of patients with clinically localized PCa.3 For men with PCa at an early stage, of a low to moderate grade, and associated with a serum PSA <10 ng/ml, a 7-year disease-free survival of 75–85% can be expected (1 , 2) . Men with PCa of a higher stage and/or grade, and/or cancer associated with a serum PSA >10 ng/ml, have a lower disease-free survival regardless of the treatment modality. For patients treated with radiation therapy, ~10–50% of men whose cancer recurs have a local recurrence as the first site of treatment failure, depending on pretreatment risk factors (3) . Not surprisingly, men who do not suffer local recurrence are less likely to develop subsequent distant metastatic disease (3 , 4) . Given these facts, the development of novel therapies that can minimize the risk of tumor recurrence and extend disease-free survival is logical and appropriate. Ideally, these novel therapies should have the potential for disease eradication and not be associated with a significant risk of toxicity and long-term complications.

One new antineoplastic approach involves exploitation of the cytolytic capacity of adenovirus. It is well known that the adenoviruses can induce cell death by cytolysis as part of their normal life cycle (5) . Importantly, adenoviruses possess several important characteristics that make them attractive agents for PCa gene therapy, including a relatively high transduction efficiency (6 , 7) and the ability to transduce and lyse nonreplicating cells (7) . The latter point is particularly important, as PCa typically possesses a very low S-phase fraction of about 5% or less (8 , 9) . Several investigators have attempted to achieve intratumoral cell killing with oncolytic viruses, including adenoviruses (10 , 11) . In fact, some of the earliest work included treatment of patients with intratumoral injection of wild-type adenovirus into cervical cancer that was locally recurrent after radiation therapy (12) . Antitumor effects were clinically documented and provided a foundation for future studies. More recently, molecular biological techniques have allowed for genetic manipulation of the adenovirus, providing the ability to restrict its replication to unique genetic profiles of the tumor type to be treated (13 , 14) . These techniques include the production of replication-restricted adenoviruses that use heterologous tissue-specific promoters to control viral genes critical to replication (15)

In 1997, Rodriguez et al. (14) , reported on the development of a replication-competent, E3-deleted, cytolytic Ad5 adenovirus called CN706 (subsequently renamed CV706), with replication that was restricted to PSA-producing cells. This restricted replication was achieved by the insertion of a minimal promoter-enhancer construct of the human PSA gene (PSE) 5' of E1A, 3' of the E1A promoter, resulting in PSA-regulated expression of E1A. This E1A regulation, in turn, resulted in the restriction of CV706 replication primarily to cells expressing PSA. Single, intratumoral, injections of CV706 into PSA-producing human PCa xenografts (LNCaP) resulted in rapid regression of those established tumors with a concomitant decrement in serum PSA. These data and others provided a strong rationale for clinical testing of CV706 in a manner analogous to the preclinical models: i.e., by directed, intratumoral injections into the prostates of men with PCa.

PCa tends to be a multifocal disease. In fact, even clinically localized PCa typically has, on average, seven separate foci of cancer in the prostate, and these foci are frequently bilobar (16) . Therefore, any intraprostatic delivery of virus would, ideally, need to cover the entirety of the prostate to adequately treat this multifocal disease. Intratumoral injections of virus into the prostate can be performed several ways, including delivery by transrectal and transperineal routes. Intraprostatic delivery of radioactive sources, termed prostate brachytherapy, used in the definitive management of early-stage PCa, is a routine, outpatient procedure performed via the transperineal route (17) . This stereotactically guided approach generally allows for complete coverage of the prostate volume by the radioactive sources. Translation of this technique to in vivo PCa gene therapy is a logical extension of this well-proven technology, particularly when combined with a highly tissue-specific, replication-competent oncolytic adenoviral therapeutic. Together, these considerations formed the preclinical rationale for translation of replication-competent cytolytic viral therapy to the clinic. For men who experience a local recurrence of cancer after radiation therapy, there are no standard salvage therapies available. In addition, the presently available options for salvage (prostatectomy, brachytherapy, and cryotherapy; Refs. 18, 19, 20, 21 ) are associated with high rates of side effects, including impotence, incontinence, and rectal injury. Therefore, we designed a Phase I, dose-escalation study to determine the MTD and DLTs of CV706 when delivered by stereotactically guided intraprostatic injections in this group of patients.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study Design.
The primary objective of this study was to determine the MTD of CV706 when administered by transrectal ultrasound-guided transperineal injections into the prostate of men whose PCa was locally recurrent after radiation therapy, who also had an associated rising serum PSA. This was a single-institution study. All men were treated with CV706 in the NIH General Clinical Research Center of The Johns Hopkins Hospital by one physician (T. L. D. ). Five cohorts of three to six men received treatment with one dose of CV706. Cohorts were treated sequentially with CV706 at dose levels of 1 x 1011, 3 x 1011, 1 x 1012, 3 x 1012, or 1 x 1013 viral particles/patient (Table 1)Citation . All patients completed 3 weeks of observation after treatment before dose escalation to the next cohort. If none of the men experienced any DLT, the study proceeded. The MTD was defined as the dose below the one at which 2 or more of 6 men experienced a DLT. A DLT was defined as any irreversible grade 3 or any grade 4 toxicity (National Cancer Institute-Common Toxicity Criteria) or a prostate symptom score >28, considered potentially related to study treatment. Secondary objectives included the evaluation of antitumor activity of CV706 and monitoring for other molecular correlates of antineoplastic action.


View this table:
[in this window]
[in a new window]

 
Table 1 Number of viral particles administered, maximum number of needles, and maximum number of intraprostatic viral deposits used for each dose level of CV706

 
Patient Selection.
All men were required to have biopsy-proven, locally recurrent PCa, to have been previously treated with definitive external beam radiation therapy, and to provide informed consent (Joint Committee on Clinical Investigation-approved). Initially, men were required to have a serum PSA >10 ng/ml and rising. Approximately halfway through the protocol, this criteria was amended to conform to the American Society for Therapeutic Radiology and Oncology (ASTRO) criteria of biochemical failure after definitive radiation therapy, which is defined as three consecutive increases in PSA after the postradiotherapy nadir (22) . Patients were free of detectable metastatic disease as determined by routine whole-body bone scan as well as computed tomography scan of the abdomen and pelvis at study entry. Additional eligibility criteria included: The Eastern Cooperative Oncology Group (ECOG) performance status of 0–1; normal liver and renal function; a normal serum testosterone level (>200 ng/dl); normal hematological and coagulation profiles; and absence of immunosuppression or concomitant systemic immunosuppressive agents. Table 2Citation outlines the demographic features of each study subject, including age, race, preradiation prognostic factors, dose of radiation received, and interval between radiation and treatment with CV706.


View this table:
[in this window]
[in a new window]

 
Table 2 Demographics of all 20 men treated with intraprostatic CV706

 
Three-Dimensional Treatment Planning and Delivery of CV706.
Planning and delivery of CV706 was performed by a modified, transperineal prostate brachytherapy technique. Transrectal ultrasound was performed with the men in the extended dorsal lithotomy position. Transverse images of the prostate were obtained at 5-mm intervals from the base to the apex. Sagittal images of the prostate were also obtained. Three-dimensional reconstruction of the prostate was performed using a MMS Therapac Plus 6.6 prostate brachytherapy planning system (Varian Medical Systems, Palo Alto, CA).

Preclinical data suggested that a single, intratumoral injection of CV706 would result in ~1 ml of tumor killing in an LNCaP xenograft model (14) . Using this information, a "viral dosimetric" algorithm was devised and entered into the MMS Therapac treatment planning system.4 This viral dosimetry was used to determine the most optimal sites for CV706 injection so as to effect the most homogenous coverage of the prostate within the confines of the protocol restrictions. Table 1Citation outlines the number of needles and viral depositions allowed in each portion of the protocol. On the day of treatment, a Foley catheter was placed into the patient’s bladder, and was maintained for 14 days. In the operating room, under spinal anesthesia, the patient was repositioned in the extended dorsal lithotomy position. The real-time, transrectal ultrasound was used to guide each 18-gauge Zebra needle (Mick Radio-Nuclear Instruments, New York, NY) through the perineum, into the prostate via a template to the predetermined positions for delivery of each 0.1-ml injection.

Patient Monitoring.
Patients were hospitalized for observation for 24 h after CV706 administration. Vital signs were monitored closely and blood and urine samples were obtained at predetermined intervals. Laboratory studies included: hematology, liver and renal functions, coagulation profiles, serum PSA and acid phosphatase, analysis for circulating CV706 in the blood and excreted in the urine, as well as neutralizing antibody titers. Physical exams were performed on subsequent days in the outpatient clinic, and patients completed a Functional Assessment of Cancer Treatment—Prostate (FACT-P) quality-of-life assessment. On days 4 and 22 and at month 3 posttreatment, transrectal prostate biopsies were obtained.

Manufacturing and Preparation of CV706.
CV706 was supplied by Calydon, Inc., as a sterile, clear, frozen liquid in vials containing 0.5 ml of virus at a concentration of 1 x 1012 viral particles/ml. CV706 was formulated in PBS with 10% glycerol and 1 mM MgCl2 and stored at -80°C until needed. On the day of the procedure, the CV706 was thawed and resuspended in sterile 0.9% saline immediately before administration. In the operating room, CV706 was drawn into a sterile syringe, and the air was expelled to insure accurate delivery.

Neutralizing Antibody Titers in Blood.
The neutralization assay used in this study was performed as described previously (23) . Briefly, serial dilutions of heat-inactivated patient serum (56°C for 30 min) was mixed for 1 h with adenovirus (1 PFU/cell). The virus-antibody mixture was then plated onto 293 cells (10,000 cells/well; 96-well plates) for 1 h. After incubation, the mixture was removed, RPMI 1640 was added, and the 293 cells were cultured for 5–7 days at 37°C. Cytopathic effect was then monitored at the time when control samples revealed 100% cytopathic effect after incubation.

Quantitative PCR for CV706 in Plasma.
Plasma samples (2–4 ml) were analyzed from all available samples obtained before treatment, as well as at 30 min, 1 h, 4 h, 8 h, 12 h, 18 h, and 24 h and at days 3, 8, 14, and 28 after treatment. Samples were frozen at -20°C or below immediately after plasma separation. One-ml aliquots of plasma were centrifuged and guanidinium thiocyanate solution was added to the pellet. DNA was extracted from samples with phenol/chloroform/isoamyl alcohol and precipitated in isopropyl alcohol. DNA was washed, dried, and resuspended in Tris-EDTA buffer. A PCR master mix containing the following HPLC-purified primers and fluorescent probe were added:

Forward: 5' CCCCAGCCCCAAGCTT 3'

Reverse: 5' GCGGCCATTTCTTCGGTAATA 3'

Probe: 5' FAMCCGGTGACTGAAAATGAGACATATTATCTGCCATAMRA 3'

PCR with real-time detection was performed in a Perkin-Elmer/ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) with the following cycling profile: 95°C for 10 min then 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 1 min. Assay performance was monitored by spiking eight control plasma samples with known amounts of CV706 (either 2,500 or 75,000 CV706 particles/ml of plasma), interspersed with patient samples as "unknowns." Insufficient plasma or insufficiently separated plasma could not be analyzed.

Determination of CV706 Viral Shedding in Urine.
Sterile urine samples from postinjection days 1, 8, 15, and 29 were collected, immediately centrifuged, and stored at -20°C until assayed. A plaque assay procedure on HEK-293 cell monolayers was used to screen and quantitate infectious CV706 viral particles. The urine samples were diluted 100-fold with DMEM (BioWhittaker, Walkersville, MD) supplemented with 5% fetal bovine serum (HyClone Laboratories, Logan, UT) to overcome the cytotoxicity of urine and run in duplicate or six-replicate wells. Plaques were counted on days 12, 13, and 14 after infection. In addition, where significant cytopathic effect was observed, the samples were repeatedly assayed with a 10-fold serial dilution in duplicate to accurately quantify PFU. Repeat assays were performed on both HEK-293 and nonpermissive HBL-100 cells to test for tissue selectivity of the isolated virus.

Electron Microscopy of Prostatic Biopsy Material.
Electron microscopy was performed on prostatic tissue obtained from transrectal needle biopsies of the prostate 4 days after CV706 treatment. Tissue samples were prepared as described previously (24) . Briefly, prostate biopsy material was fixed in 2.5% glutaraldehyde and cut into thin sections. Sections were exposed to 1% osmium tetroxide and then dehydrated in ethanol. Next, a propylene oxide/embedding medium mixture was applied and, subsequently, a 100% embedding medium for 24 h. Sections were then polymerized and stained. Transmission electron microscopic images were analyzed for evidence of intranuclear viral particles.

Immunohistochemistry.
After paraffin removal and hydration, slides were immersed in 0.1% Tween 20, preheated in Protease Type VIII (Sigma Chemical Co., St. Louis, MO), and then treated with 3% hydrogen peroxide to quench endogenous peroxidases. Protein Blocker (Ventana Medical Systems, Tucson, AZ) was then applied, slides were washed, and the primary antibody, Adenovirus (Chemicon, Temecula, CA), was applied at 1:20,000 dilution in PBS for 45 min. The secondary biotin-labeled antibody was applied for 30 min (goat antimouse; 1:50), and localization was accomplished by exposure to an avidin-biotin complex horseradish peroxidase solution for 30 min. A diaminobenzidine substrate was used according to the manufacturer’s instructions (ChemMate; Ventana Medical Systems, Tucson, AZ), and the slides were counterstained with hematoxylin. Hexon staining was evaluated by a pathologist using an Olympus BX-40 light microscope without knowledge of the timing of the biopsy specimen, dose level, or patient identification.

Statistical Considerations.
The PSA velocity was evaluated by the method of Piantadosi, et al.5 to quantify the CV706 treatment effect. Using this method, the log of the pre- and posttreatment serum PSA values were calculated. The slope of the log PSA versus time trends was calculated before and after treatment using linear regression. If the mean change in log serum PSA (comparing pre- and posttreatment PSA slopes) is positive or zero, then the treatment had no effect. If the mean change is negative, then the treatment had an antitumor effect, as evidenced by reducing PSA velocity.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patient Characteristics
A total of 24 men were enrolled, and 20 men were treated with CV706 between September 1998 and May 2000. The reasons for no treatment in four patients included: (a) an inability to tolerate the transrectal ultrasound (three patients); and (b) no evidence of recurrent cancer on biopsy of the prostate (one patient). The demographics for the treatment cohorts are listed in Table 2Citation . The median age of treated men was 70 years, with a range of 60–83 years. The preradiation clinical T stages (1992, American Joint Committee on Cancer) ranged from T1C-T3C. The median preradiation Gleason score was 6 (range, 4–8). The median time from the end of radiation to treatment with CV706 was 41 months (range, 24–92 months). The median dose of radiation used in the initial management of these men was 68.4 Gy. Four of the 20 treated men were initially managed with neoadjuvant and/or concomitant androgen suppression and radiation therapy, but they had normal serum testosterone levels at time of treatment. The median pre-CV706 serum PSA was 12.1 ng/ml (range, 1.4–59.7 ng/ml). The Eastern Cooperative Oncology Group performance status of 20 of 20 patients was "0." The median follow-up time in the 20 treated men is 17 months.

CV706 Treatment-Related Toxicity
Patient Reported AEs.
Table 3Citation summarizes all AEs reported in two or more men. The majority (74%) of the AEs noted were mild in severity and/or grade 1 toxicity. Only 24% of the AEs were considered to be moderate in severity and/or grade 2 toxicity. The majority of men (15 of 20) experienced a grade <=2 fever approximately 3–8 h after injection that was either self-limited or responded to treatment with acetaminophen. Half of the men with fever had associated shaking chills and received acetaminophen (7 of 20). The majority of men (15 of 20) also experienced local pain at the injection site (perineum) and/or pelvic pain in the immediate postoperative period, 10 of whom were treated with acetaminophen and/or oxycodone. Approximately one-half of these men (9 of 20) had local pain with associated inflammation noted by examination. Hematuria was noted in all men, with 20 of 20 patients experiencing microscopic hematuria. Urinary irritative symptoms were frequently documented, including urethral pain, urinary urgency, and frequency. Patients consistently noted that the indwelling Foley catheter they were required to maintain for 14 days after CV706 administration was, in large part, related to these irritative urinary symptoms. Postprocedure nausea and vomiting was occasionally seen and was thought to be related to use of oxycodone in the immediate postprocedure setting. Two men each were noted to develop transient hypertension and hypotension, respectively. These episodes occurred in the immediate postprocedure setting and were most likely related to the anesthesia. One of the patients with hypertension was treated with hydralazine and the other with atenolol. No specific treatment was required for the patients with mild hypotension. Postprocedure amnesia was also thought to be related to the anesthesia. Several men complained of skin rashes (torso and arms) with or without pruritis, three of which were thought to be possibly related to the study drug.


View this table:
[in this window]
[in a new window]

 
Table 3 Patient-reported toxicity noted in two or more men treated with intraprostatic CV706

 
There were no serious AEs. However, there were five reports of severe AEs and/or grade 3 toxicity occurring in five men. All of these were considered to be reversible grade 3 toxicities and were not considered related to the study drug. One event was a short episode of hypertension (in a patient noted above), which occurred immediately postoperatively in a man with underlying hypertension. Another event was a short episode of psychosis, which occurred immediately postoperatively, in a patient with a history of postanesthesia psychosis. No specific intervention was required for either patient. The remaining events were hematuria with clots thought most likely to be secondary to the extended prophylactic indwelling Foley catheter. One man who reported grade 3 hematuria also reported the onset of erectile dysfunction, occurring at least 9 days after CV706 administration, that has persisted and was thought probably related to treatment. A second man experienced severe myalgias the day of treatment with CV706 that resolved with conservative management within 24 h. There have been no long-term toxicities in any of the patients.

Laboratory Data.
Clinical laboratory safety data were assessed for 1 month after treatment. Posttreatment liver transaminase levels have been generally normal. Minor transient elevations in AST to just above the upper limit of normal (grade 1) were seen in three men in cohort 4 1 week after treatment. In all cases, AST returned to normal at the next time point, 1 week later. Three men showed comparable minor elevations of alanine aminotransferase at the same time point that resolved spontaneously within 1–2 weeks. Two patients in the highest dose level experienced mild increases in AST to just above the upper limit of normal (grade 1), one of whom also had a very slight, transient elevation in alanine aminotransferase to just above normal values. These values returned to baseline levels within 30 days. Thus, there were no National Cancer Institute grade 2 toxicities for hepatotoxicity.

Hematological studies disclosed a transient, small and clinically nonsignificant decrease in platelets (average decrement of 22%), seen consistently two days following treatment, with levels returning to baseline by one week after treatment. Even smaller changes were seen in RBCs in most patients, also transient, returning to normal by day fourteen. These decrements in RBC were not associated with fibrin split products, D-dimer levels or clinical signs of disseminated intravascular coagulopathy (DIC) and were reversible without intervention. A transient, clinically nonsignificant decrease in absolute lymphocyte levels was observed in 90% of patients and was found to be maximal one or two days posttreatment, with an average drop of 66%. Lymphocyte levels returned to within 25% of baseline in the majority of patients by day 7 posttreatment. No specific subset analysis of lymphocytes was performed. These hematological findings are consistent with an acute phase response, not marrow suppression and were asymptomatic.

PSA
There were statistically significant differences between cohorts in mean pretreatment PSA levels (P = 0.04): dose level 1, 45.3 ng/ml; dose level 2, 14.5 ng/ml; dose level 3, 27.5 ng/ml; dose level 4, 14.5 ng/ml; and dose level 5, 7.1 ng/ml The variance in pretreatment PSA between groups was significantly greater than the variance within groups. These differences were, in part, related to modification of the PSA entry criteria instituted approximately halfway through the trial.

There were immediate alterations in serum PSA levels in all patients after treatment. These alterations were an expected consequence of the frequent, invasive, prostatic manipulations performed within the first month, including the intraprostatic delivery of CV706 and the transrectal biopsies performed at days 4 and 22 posttreatment. Table 4Citation outlines the PSA changes seen in the 20 treated patients. Thirteen of 20 patients (65%) experienced a reduction in serum PSA of >=30% from pretreatment levels. Five of 20 patients (25%) experienced a reduction in serum PSA of >=50%. All five patients with a reduction in serum PSA of >=50% were in dose levels 4 and 5 (5 of 11). Of these patients, four patients achieved a PR, defined as a reduction in serum PSA by >=50% from pretreatment levels, sustained for at least 4 weeks. The maximum duration of this PSA response was 11.3 months.


View this table:
[in this window]
[in a new window]

 
Table 4 Change in serum PSA after intraprostatic delivery of CV706

 
When PSA data from this trial were subjected to analysis to determine the change in velocity (Fig. 1)Citation , it seems that treatment with CV706 at the two highest dose levels resulted in the largest net negative posttreatment log PSA slope (i.e., greatest treatment effect). In fact, 14 of 20 men exhibited a net negative change in log PSA slope, with 10 of 14 occurring in dose levels 4 and 5.



View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Mean change in the slope of log serum PSA for each treated patient. This parameter provides information as to change in PSA velocity. The change in the log PSA slope (pretreatment versus posttreatment slopes) was determined for each patient and is presented here (some symbols overlap). The mean change in the log PSA within each dose group was also determined and is represented by the horizontal bar. The mean change in log PSA slope and SD, respectively, for each dose group: dose level 1, -0.0002 and 0.0078; dose level 2, 0.00007 and 0.0052; dose level 3, -0.0008 and 0.0041; dose level 4, -0.0080 and 0.0117; dose level 5, -0.0184 and 0.0071. Dose levels 4 and 5 had greatest negative change in log serum PSA slope. Larger negative values indicate greater treatment effect using reduction in PSA velocity as an end point. F-test of overall heterogeneity among the dose group means reveals them to be statistically different at P <0.004.

 
Post-CV706 Treatment Prostate Biopsies
After CV706 administration, patients underwent repeat sextant biopsy of their prostate on posttreatment days 4 and 22 and at month 3. Adenoviral infection was demonstrable in the higher dose levels as documented by routine light microscopy. This analysis revealed morphologically identifiable intranuclear inclusions characteristic of adenovirus (data not shown). This finding was confirmed by immunohistochemistry for adenoviral hexon protein (Fig. 2C)Citation . Positive hexon staining was confined to prostatic epithelial cells only and was most striking in samples from patients treated in dose level 5. Positive and negative staining controls for immunohistochemistry against hexon protein were performed (Fig. 2, A and BCitation , respectively). Day 4 biopsy material from several patients was fixed in gluteraldehyde and analyzed by transmission electron microscopy. Fig. 2DCitation represents one of these analyses and reveals obvious virion within the nucleus of a prostatic epithelial cell, consistent with Ad5 replication.



View larger version (147K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Day 4 posttreatment prostatic needle biopsies for detection of adenovirus. A, positive control for immunohistochemistry against hexon protein. Lung tissue from an autopsy case of a patient with disseminated adenoviral infection (patient was not part of this study). Arrow, infected alveolar cell. B, negative control for immunohistochemistry against hexon protein. Adjacent section lung tissue from autopsy case of patient with disseminated adenoviral infection. C, immunohistochemistry against hexon protein from patient treated with CV706. Arrow, prostatic epithelial cells staining positive. Arrowhead, mononuclear inflammatory infiltrate involving the edge of a prostatic acinus. st, stromal tissue; lu, luminal tissue. D, transmission electron microscopy. Arrow, example of mature adenovirus within nucleus of prostatic epithelial cell.

 
Neutralizing Antibodies
A determination of anti-CV706 antibody titers was performed on blood samples from patients before and after treatment. The results of this analysis are shown in Table 5Citation . This analysis demonstrates that anti-CV706 antibody levels increased after treatment in all patients. There was no evident correlation between baseline antibody titer and subsequent PSA response.


View this table:
[in this window]
[in a new window]

 
Table 5 Neutralizing antibody titers to CV706 before and after intraprostatic administration

 
Circulating and Excreted CV706
Circulating CV706.
A quantitative PCR technique was used to determine the amount of CV706 in circulation after viral instillation. This technique detects viral DNA only, likely from intact virus particles, but does not necessarily correlate with infectious virus titer. At baseline (pretreatment), the average number of CV706 copies/ml was 168 ± 385, representing background in the assay. The cutoff for a potentially significant number above background was set at 1300 copies/ml (approximately the average baseline value + 3 SDs). Copies of CV706 were detected in the earliest plasma sample taken after virus administration (i.e., 30 min posttreatment) in all but 2 of 16 tested patients (both patients from dose level 5A). Plasma from these two patients contained no CV706 at this time point, although virus was identified in plasma at subsequent time points. The amount of CV706 viral genome in circulation 30 min after treatment varied significantly between patients, with between 0.007% and 0.129% of the total dose of virus administered being detected. This initial peak in circulating virus subsided to near-baseline levels in all patients tested within 12–24 h after treatment. Elimination of the virus appeared biphasic, with a sharp decline between 30 and 60 min after treatment and then a slower elimination over the next 12 h by first-order kinetics. On the basis of the 30- and 60-min time points, the average initial half-life of virus in circulation was 23 min (range, 11–170 min).

A single productive infectious cycle of adenovirus takes ~24–36 h before the release of newly formed virus from infected cells occurs (25) . Interestingly, a second peak of detectable CV706 genome found in the circulation in all patients tested except three (one patient each from dose levels 3, 4A, and 4B) between 2 and 8 days after treatment. The viral load associated with this secondary peak varied between patients, and in at least four patients, it exceeded the load detected in circulation shortly after treatment. This secondary peak had a longer duration in most patients (median of 5 days) and, therefore, the total amount of systemic virus was substantially larger than that from the initial treatment in at least 10 of 16 tested patients. An example of this time course, from one patient treated in dose level 5A (1 x 1013 viral particles), is provided in Fig. 3Citation . For all patients tested, circulating CV706 levels returned to values indistinguishable from baseline (<=1300 copies/ml) by day 15 after treatment.



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. CV706 viral load/ml of plasma from day of treatment to month 1 in a patient treated with 1 x 1013 viral particles. The peak height 30 min after treatment in this patient is equivalent to 0.014% of the injected dose, assuming 3 liters of plasma.

 
Ad5-neutralizing antibody titers were measured in patients as described above. All patients that had a significant secondary virus peak also had low levels or undetectable anti-Ad5 antibodies at baseline. However, one patient with no anti-Ad5 antibodies at baseline did not produce a significant secondary peak of circulating CV706 genome. There seemed to be an inverse relationship between neutralizing antibody titer at baseline and the amount of viral genome seen in the secondary peak. Levels of anti-Ad5 antibodies at baseline did not seem to correlate with systemic levels of CV706 immediately after treatment.

Excreted CV706.
Urine was collected from all patients at specified times before and after treatment with CV706. Standard plaque assays were performed to determine the amount of virus shedding in the urine. At baseline (pretreatment), urine from all tested patients failed to induce plaque formation. By day 2 posttreatment, urine from 11 of 19 treated patients was positive for viral shedding as determined by plaque formation at >50 plaque-forming units/ml. Urine from only two patients continued to induce plaque formation at day 8, and by days 15 and 29, urine from all tested patients failed to induce plaques. No plaques were observed from urine samples in the tissue selectivity assay using HBL-100 cells, which are permissive for wild-type virus but nonpermissive for CV706 replication. A control assay using an equivalent Ad5 vector containing a wild-type E1A region was able to infect HBL-100 cells efficiently, suggesting that the virus in the urine of treated patients was not likely a wild-type recombinant.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study represents the first clinical translation of a prostate-specific, replication-restricted adenovirus for the treatment of PCa. In addition, it is one of the first studies to document therapeutic viral replication in specific cells of the target organ in the human. More importantly, the data presented in this manuscript showed intraprostatic CV706 to be safe and not associated with irreversible grade 3 or any grade 4 toxicity. The most common side effects noted were genitourinary symptoms, likely worsened by the prophylactic insertion of an indwelling Foley catheter that the patients were required under the protocol to maintain for 14 days. Systemic toxicity was minimal, with the majority of these side effects limited to a brief grade 1 or 2 fever with or with out an associated shaking chill. These episodes were self-limited and responded to routine antipyretics, and no patient required antibiotics. This phenomenon is consistent with previously reported series using intratumoral injections of replication-competent adenovirus (Onyx-015; Refs. 10 , 26 , 27 ) and may represent a cytokine release in response to the adenovirus (28, 29, 30) .

A transient lymphopenia, which was not clinically significant, was noted in a majority of patients within 48 h of viral instillation with recovery of counts to within 25% of baseline in the majority of patients by 7 days posttreatment. The timing of this decrement combined with the quick recovery is most suggestive of an acute-phase reaction with associated leukocyte margination, and not bone marrow suppression (31) . Importantly, treatment with CV706 was not associated with significant hepatic or coagulation abnormalities. Specifically, no patient experienced greater than grade 1 elevation of liver transaminases, and no patient had evidence of alteration in prothrombin time or partial thromboplastin time or a decrement in fibrinogen. This safety was evident even at the highest dose level of 1 x 1013 viral particles and with evidence of viral shedding into the blood. Although the quantitative PCR for CV706 is likely detecting intact virus but not necessarily only viable virus, it is consistent with in vivo viral replication. The MTD of intraprostatic CV706 was not reached in this study, even at the highest administered dose of 1 x 1013. Significantly higher doses could not be delivered given manufacturing limitations in concentrating the virus further. Taken together, these data reveal the safety of CV706 when administered by intraprostatic injection and are critical to the future development of similar tissue-specific replication-competent adenoviruses.

The analysis of secondary study end points provides compelling evidence of CV706 activity. Serum PSA is well known to be a marker of both disease activity as well as disease burden (32, 33, 34, 35, 36) . In this study, all patients achieving a PSA reduction >=50% and/or who achieved a PR occurred in the highest two dose levels, suggesting a dose response for CV706. Moreover, there was a statistically significant reduction in the PSA velocity after treatment with CV706, again most pronounced for patients in dose levels 4 and 5, also suggestive of a dose-response relationship. The mean and median duration of PR was just over 6 months (6.6 months), suggesting the potential for disease stabilization by CV706 treatment. Biopsy of the prostate results in significant elevations in serum PSA for >2 weeks (37) . Although the design of this study, with frequent posttreatment biopsies, aided in the documentation of viral replication, these same invasive procedures prevented a full analysis of the PSA-response to therapy with CV706. Thus, it is possible that substantial reductions in serum PSA could have been obscured by these frequent prostatic manipulations. Despite this possibility, the evidence gathered on PSA levels subsequent to treatment with CV706 are encouraging and suggest that at the higher dose levels, a clinically meaningful treatment effect may be achievable.

This treatment effect at higher doses is associated with clear histological and molecular evidence of viral replication. The viral inclusions seen on electron microscopy and the positive staining for hexon protein seen on immunohistochemistry from day 4 biopsy materials was confined to prostatic epithelial cells. Of note, hexon staining was most prominent in the highest dose levels and, like the electron microscopy, highly suggestive of intraprostatic replication of CV706 in these patients. At the highest dose level, Phase II trials estimating efficacy seem fully warranted.

Importantly, we were able to rigorously document CV706 shedding in the blood after intraprostatic delivery without significant associated clinical sequelae. The quantitative PCR assay is very specific for CV706 and is capable of detecting 1300 copies/ml of plasma. These results confirm that a small but significant amount of the intraprostatically administered virus reached the circulation. These experiments were not, however, designed to quantitatively assess the proportion of detectable genome derived from only viable CV706. The amount of virus released in the first "peak" varied between patients, did not seem to be related to the dose level or neutralizing antibody titer, and may represent leakage of virus during the administration procedure. The highest total amount of virus detected was in two patients (patients 12 and 14), with an estimate of <2% of the dose being detected. A significant secondary peak of circulating CV706 genome was observed in most patients ~3 days after treatment, suggestive of viral replication. The appearance and size of the secondary peak seemed to depend on a low anti-Ad5 antibody titer at the time of treatment. These data are consistent with those derived from electron microscopy and immunohistochemistry and support the in vivo observations of CV706 replication in the human prostate.

Response to CV706 was not correlated with the presence of preexisting Ad5 neutralizing antibodies. After administration, most patients developed Ad5 neutralizing antibodies. These new antibodies did not block clinical response to treatment. Moreover, our data also reveal that the presence of preexisting anti-Ad5 antibodies is not obviously correlated with treatment-related toxicity. These data extend the previously reported work on intratumoral delivery of replication-competent adenovirus by revealing a lack of association between neutralizing antibody levels and treatment toxicity (10) . Whereas circulating anti-Ad5 antibody may significantly impact on the efficacy and toxicity of systemically administered adenovirus (38) , it is not clear that these antibodies have the same access to the tumor-bearing prostate, and thus they may have a limited impact on direct intratumoral injections (39) .

In summary, CV706 seems safe when delivered by intraprostatic injection using a planned, stereotactic approach. This trial also suggests that CV706 replicates selectively in prostatic epithelial cells, i.e., those prostate cells that make PSA, and does so in a time frame consistent with an adenoviral replicative cycle. To our knowledge, this is the first report of oncolytic viral vectors showing molecular and clinical activity in humans with PCa. Finally, these data suggest that CV706 possess biological activity, as evidenced by significant decreases in serum PSA, which seem to be dose-related. This was evident despite the frequent prostatic manipulations experienced by patients in this study, which could have significantly obscured full interpretation of these results. Thus, continued development of prostate-specific adenoviral vectors is compelling. In fact, concomitant treatment of carcinoma cells with oncolytic adenoviruses and DNA-damaging agents like radiation or certain chemotherapeutic agents can result in supra-additive cell killing (40, 41, 42, 43) . Thus, when considering the safety and activity of CV706, a strong rationale exists for additional laboratory and clinical investigation of CV706 in conjunction with radiation therapy for the treatment of human PCa.


    ACKNOWLEDGMENTS
 
We thank Drs. Donald Coffey, Martin Abeloff, Albert Owens, and David Karpf for their thoughtful review of this manuscript and Jurg Sömmer for performing assays for circulating CV706.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported, in part, by the Johns Hopkins General Clinical Research Center (NIH/National Center for Research Resources M01RR00052), CaPCURE, and NIH/National Cancer Institute Grant CA58236 Back

2 To whom requests for reprints should be addressed, at Radiation Biology Program, The Johns Hopkins Oncology Center, 1650 Orleans Street, Room 1-144, Baltimore, MD 21231-1000. Back

3 The abbreviations used are: PCa, adenocarcinoma of the prostate; PSA, prostate-specific antigen; MTD, maximal tolerated dose; DLT, dose-limiting toxicity; AE, adverse event; PR, partial response; PFU, plaque-forming units; AST, aspartate aminotransferase. Back

4 T. L. DeWeese, J. W. Simons, R. Rodriquez, and A. Baccala, unpublished data. Back

5 S. P., B. M., and J. W. S., unpublished data. Back

Received 5/15/01. Accepted 8/16/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Shipley W. U., Thames H. D., Sandler H. M., Hanks G. E., Zietman A. L., Perez C. A., Kuban D. A., Hancock S. L., Smith C. D. Radiation therapy for clinically localized prostate cancer: a multi-institutional pooled analysis. JAMA, 281: 1598-1604, 1999.[Abstract/Free Full Text]
  2. Hanlon A. L., Hanks G. E. Scrutiny of the ASTRO consensus definition of biochemical failure in irradiated prostate cancer patients demonstrates its usefulness and robustness. Int. J. Radiat. Oncol. Biol. Phys., 46: 559-566, 2000.[Medline]
  3. Kuban D. A., el-Mahdi A. M., Schellhammer P. The significance of post-irradiation prostate biopsy with long-term follow-up. Int. J. Radiat. Oncol. Biol. Phys., 24: 409-414, 1992.[Medline]
  4. Fuks Z., Leibel S. A., Wallner K. E., Begg C. B., Fair W. R., Anderson L. L., Hilaris B. S., Whitmore W. F. The effect of local control on metastatic dissemination in carcinoma of the prostate: long-term results in patients treated with 125I implantation. Int. J. Radiat. Oncol. Biol. Phys., 21: 537-547, 1991.[Medline]
  5. Webb H. E., Smith C. E. Viruses in the treatment of cancer. Lancet, 1: 1206-1208, 1970.[Medline]
  6. Ilan Y., Droguett G., Chowdhury N. R., Li Y., Sengupta K., Thummala N. R., Davidson A., Chowdhury J. R., Horwitz M. S. Insertion of the adenoviral E3 region into a recombinant viral vector prevents antiviral humoral and cellular immune responses and permits long-term gene expression. Proc. Natl. Acad. Sci. USA, 94: 2587-2592, 1997.[Abstract/Free Full Text]
  7. Ali M., Lemoine N. R., Ring C. J. The use of DNA viruses as vectors for gene therapy. Gene Ther., 1: 367-384, 1994.[Medline]
  8. Visakorpi T., Kallioniemi O. P., Paronen I. Y., Isola J. J., Heikkinen A. I., Koivula T. A. Flow cytometric analysis of DNA ploidy and S-phase fraction from prostatic carcinomas: implications for prognosis and response to endocrine therapy. Br. J. Cancer, 64: 578-782, 1991.[Medline]
  9. Kallioniemi O. P., Visakorpi T., Holli K., Heikkinen A., Isola J., Koivula T. Improved prognostic impact of S-phase values from paraffin-embedded breast and prostate carcinomas after correcting for nuclear slicing. Cytometry, 12: 413-421, 1991.[Medline]
  10. Ganly I., Eckhardt S. G., Rodriguez G. I., Soutar D. S., Otto R., Robertson A. G., Park O., Gulley M. L., Heise C., Von Hoff D. D., Kaye S. B. A Phase I study of Onyx-015, an E1B attenuated adenovirus, administered intratumorally to patients with recurrent head and neck cancer. Clin. Cancer Res., 6: 798-806, 2000.[Abstract/Free Full Text]
  11. Nemunaitis J., Ganly I., Khuri F., Arseneau J., Kuhn J., McCarty T., Landers S., Maples P., Romel L., Randlev B., Reid T., Kaye S., Kirn D. Selective replication and oncolysis in p53 mutant tumors with ONYX-015, an E1B–55kD gene-deleted adenovirus, in patients with advanced head and neck cancer: a Phase II trial. Cancer Res., 60: 6359-6366, 2000.[Abstract/Free Full Text]
  12. Smith R. R., Huebner R. J., Rowe W. P., Schatten W., Thomas L. Studies on the use of viruses in the treatment of carcinoma of the cervix. Cancer (Phila.), 9: 1211-1218, 1956.[Medline]
  13. Bischoff J. R., Kirn D. H., Williams A., Heise C., Horn S., Muna M., Ng L., Nye J. A., Sampson-Johannes A., Fattaey A., McCormick F. An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science (Wash. DC), 274: 373-376, 1996.[Abstract/Free Full Text]
  14. Rodriguez R., Schuur E. R., Lim H. Y., Henderson G. A., Simons J. W., Henderson D. R. Prostate attenuated replication competent adenovirus (ARCA) CN706: a selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res., 57: 2559-2563, 1997.[Abstract/Free Full Text]
  15. Curiel D. T. The development of conditionally replicative adenoviruses for cancer therapy. Clin. Cancer Res., 6: 3395-3399, 2000.[Abstract/Free Full Text]
  16. Bastacky S. I., Wojno K. J., Walsh P. C., Carmichael M. J., Epstein J. I. Pathological features of hereditary prostate cancer. J. Urol., 153: 987-992, 1995.[Medline]
  17. Ragde H., Blasko J. C., Grimm P. D., Kenny G. M., Sylvester J. E., Hoak D. C., Landin K., Cavanagh W. Interstitial iodine-125 radiation without adjuvant therapy in the treatment of clinically localized prostate carcinoma. Cancer (Phila.), 80: 442-453, 1997.[Medline]
  18. de la Taille A., Hayek O., Benson M. C., Bagiella E., Olsson C. A., Fatal M., Katz A. E. Salvage cryotherapy for recurrent prostate cancer after radiation therapy: the Columbia experience. Urology, 55: 79-84, 2000.[Medline]
  19. Rogers E., Ohori M., Kassabian V. S., Wheeler T. M., Scardino P. T. Salvage radical prostatectomy: outcome measured by serum prostate specific antigen levels. J. Urol., 153: 104-110, 1995.[Medline]
  20. Beyer D. C. Permanent brachytherapy as salvage treatment for recurrent prostate cancer. Urology, 54: 880-883, 1999.[Medline]
  21. Grado G. L., Collins J. M., Kriegshauser J. S., Balch C. S., Grado M. M., Swanson G. P., Larson T. R., Wilkes M. M., Navickis R. J. Salvage brachytherapy for localized prostate cancer after radiotherapy failure. Urology, 53: 2-10, 1999.[Medline]
  22. Consensus statement: guidelines for PSA following radiation therapy. American Society for Therapeutic Radiology and Oncology Consensus Panel. Int. J. Radiat. Oncol. Biol. Phys., 37: 1035-1041, 1997.[Medline]
  23. Mastrangeli A., Harvey B. G., Yao J., Wolff G., Kovesdi I., Crystal R. G., Falck-Pedersen E. "Sero-switch" adenovirus-mediated in vivo gene transfer: circumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther., 7: 79-87, 1996.[Medline]
  24. Doane F. W., Anderson N. Electron Microscopy in Diagnostic Virology, a Practical Guide and Atlas Cambridge University Press Cambridge 1987.
  25. Fields B., Knipe D. M., Howley P. M. Fields Virology Lippincott-Raven Philadelphia 1996.
  26. Khuri F. R., Nemunaitis J., Ganly I., Arseneau J., Tannock I. F., Romel L., Gore M., Ironside J., MacDougall R. H., Heise C., Randlev B., Gillenwater A. M., Bruso P., Kaye S. B., Hong W. K., Kirn D. H. A controlled trial of intratumoral ONYX-015, a selectively-replicating adenovirus, in combination with cisplatin and 5-fluorouracil in patients with recurrent head and neck cancer. Nat. Med., 6: 879-885, 2000.[Medline]
  27. Kirn D., Nemunaitis J., Gainley I., Posner M., Vokes E., Kuhn J., Heise C., Maack C., Kaye S. A Phase II trial of intratumoral injection with an E1B-deleted adenovirus, onyx-015, in patients with recurrent, refractory head and neck cancer. Proc. of Am. Soc. Clin. Oncol., 17: 391A 1998.
  28. Benihoud K., Salone B., Esselin S., Opolon P., Poli V., DiGiovine M., Perricaudet M., Saggio I. The role of IL-6 in the inflammatory and humoral response to adenoviral vectors. J. Gene Med., 2: 194-203, 2000.[Medline]
  29. Cartmell T., Southgate T., Rees G. S., Castro M. G., Lowenstein P. R., Luheshi G. N. Interleukin-1 mediates a rapid inflammatory response after injection of adenoviral vectors into the brain. J. Neurosci., 19: 1517-1523, 1999.[Abstract/Free Full Text]
  30. Mistchenko A. S., Diez R. A., Mariani A. L., Robaldo J., Maffey A. F., Bayley-Bustamante G., Grinstein S. Cytokines in adenoviral disease in children: association of interleukin-6, interleukin-8, and tumor necrosis factor {alpha} levels with clinical outcome. J. Pediatr., 124: 714-720, 1994.[Medline]
  31. Lee G. R., Foerster J., Lukens J. Wintrobe’s Clinical Hematology1836-1861, Williams & Wilkins Baltimore, MD 1999.
  32. Polascik T. J., Oesterling J. E., Partin A. W. Prostate specific antigen: a decade of discovery—what we have learned and where we are going. J. Urol., 162: 293-306, 1999.[Medline]
  33. Kelly W. K., Scher H. I., Mazumdar M., Vlamis V., Schwartz M., Fossa S. D. Prostate-specific antigen as a measure of disease outcome in metastatic hormone-refractory prostate cancer. J. Clin. Oncol., 11: 607-615, 1993.[Abstract]
  34. Smith D. C., Dunn R. L., Strawderman M. S., Pienta K. J. Change in serum prostate-specific antigen as a marker of response to cytotoxic therapy for hormone-refractory prostate cancer. J. Clin. Oncol., 16: 1835-1843, 1998.[Abstract]
  35. Zagars G. K., Pollack A. Kinetics of serum prostate-specific antigen after external beam radiation for clinically localized prostate cancer. Radiother. Oncol., 44: 213-221, 1997.[Medline]
  36. Pound C. R., Partin A. W., Eisenberger M. A., Chan D. W., Pearson J. D., Walsh P. C. Natural history of progression after PSA elevation following radical prostatectomy. JAMA, 281: 1591-1597, 1999.[Abstract/Free Full Text]
  37. Yuan J. J., Coplen D. E., Petros J. A., Figenshau R. S., Ratliff T. L., Smith D. S., Catalona W. J. Effects of rectal examination, prostatic massage, ultrasonography and needle biopsy on serum prostate specific antigen levels. J. Urol., 147: 810-814, 1992.[Medline]
  38. Chen Y., Yu D. C., Charlton D., Henderson D. R. Pre-existent adenovirus antibody inhibits systemic toxicity and antitumor activity of CN706 in the nude mouse LNCaP xenograft model: implications and proposals for human therapy. Hum. Gene Ther., 11: 1553-1567, 2000.[Medline]
  39. Baxter L. T., Zhu H., Mackensen D. G., Butler W. F., Jain R. K. Biodistribution of monoclonal antibodies: scale-up from mouse to human using a physiologically based pharmacokinetic model. Cancer Res., 55: 4611-4622, 1995.[Abstract/Free Full Text]
  40. Sanchez-Prieto R., Quintanilla M., Cano A., Leonart M. L., Martin P., Anaya A., Ramon y Cajal S. Carcinoma cell lines become sensitive to DNA-damaging agents by the expression of the adenovirus E1A gene. Oncogene, 13: 1083-1092, 1996.[Medline]
  41. Rogulski K. R., Freytag S. O., Zhang K., Gilbert J. D., Paielli D. L., Kim J. H., Heise C. C., Kirn D. H. In vivo antitumor activity of ONYX-015 is influenced by p53 status and is augmented by radiotherapy. Cancer Res., 60: 1193-1196, 2000.[Abstract/Free Full Text]
  42. Yu D-C., Chen Y., Dilley J., Li Y., Embry M., Zhang H., Nguygen N., Amin P., Oh J., Henderson D. R. Antitumor synergy of CV787, a prostate cancer-specific adenovirus, and paclitaxel and docetaxel. Cancer Res., 61: 517-525, 2001.[Abstract/Free Full Text]
  43. Chen Y., DeWeese T. L., Dilley J., Zhang Y., Li Y., Ramesh N., Lee J., Pennathur-Das R., Radzyminski J., Wypych J., Brignetti D., Scott S., Stephens J., Karpf D. B., Henderson D. R., Yu D-C. CV706, a prostate cancer-specific adenovirus variant, in combination with radiotherapy produces synergistic antitumor efficacy without increasing toxicity. Cancer Res., 61: 5453-5460, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
T. Hakkarainen, M. Rajecki, M. Sarparanta, M. Tenhunen, A. J. Airaksinen, R. A. Desmond, K. Kairemo, and A. Hemminki
Targeted Radiotherapy for Prostate Cancer with an Oncolytic Adenovirus Coding for Human Sodium Iodide Symporter
Clin. Cancer Res., September 1, 2009; 15(17): 5396 - 5403.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Leitner, K. Sweeney, D. Oberg, D. Davies, E. Miranda, N. R. Lemoine, and G. Hallden
Oncolytic Adenoviral Mutants with E1B19K Gene Deletions Enhance Gemcitabine-induced Apoptosis in Pancreatic Carcinoma Cells and Anti-Tumor Efficacy In vivo
Clin. Cancer Res., March 1, 2009; 15(5): 1730 - 1740.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Peled, A. Shaish, A. Katav, S. Greenberger, I. Barshack, R. Tal, L. Bangio, E. Breitbart, and D. Harats
Systemic Administration of a Conditionally Replicating Adenovirus, Targeted to Angiogenesis, Reduced Lung Metastases Burden in Cotton Rats
Clin. Cancer Res., March 1, 2009; 15(5): 1664 - 1673.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
C. Su, H. Cao, S. Tan, Y. Huang, X. Jia, L. Jiang, K. Wang, Y. Chen, J. Long, X. Liu, et al.
Toxicology Profiles of a Novel p53-Armed Replication-Competent Oncolytic Adenovirus in Rodents, Felids, and Nonhuman Primates
Toxicol. Sci., November 1, 2008; 106(1): 242 - 250.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Ungerechts, C. Springfeld, M. E. Frenzke, J. Lampe, P. B. Johnston, W. B. Parker, E. J. Sorscher, and R. Cattaneo
Lymphoma Chemovirotherapy: CD20-Targeted and Convertase-Armed Measles Virus Can Synergize with Fludarabine
Cancer Res., November 15, 2007; 67(22): 10939 - 10947.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Sarkar, I. V. Lebedeva, Z.-z. Su, E.-S. Park, L. Chatman, N. Vozhilla, P. Dent, D. T. Curiel, and P. B. Fisher
Eradication of Therapy-Resistant Human Prostate Tumors Using a Cancer Terminator Virus
Cancer Res., June 1, 2007; 67(11): 5434 - 5442.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. He, L. Li, D. Kim, B. Wen, X. Deng, P. H. Gutin, C. C. Ling, and G. C. Li
Adenovirus-Mediated Expression of a Dominant Negative Ku70 Fragment Radiosensitizes Human Tumor Cells under Aerobic and Hypoxic Conditions
Cancer Res., January 15, 2007; 67(2): 634 - 642.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
L. P. Le, H. N. Le, I. P. Dmitriev, J. G. Davydova, T. Gavrikova, S. Yamamoto, D. T. Curiel, and M. Yamamoto
Dynamic Monitoring of Oncolytic Adenovirus In Vivo by Genetic Capsid Labeling
J Natl Cancer Inst, February 1, 2006; 98(3): 203 - 214.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Fukuhara, R. L. Martuza, S. D. Rabkin, Y. Ito, and T. Todo
Oncolytic Herpes Simplex Virus Vector G47{Delta} in Combination with Androgen Ablation for the Treatment of Human Prostate Adenocarcinoma
Clin. Cancer Res., November 1, 2005; 11(21): 7886 - 7890.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Sato, M. Johnson, L. Zhang, S. S. Gambhir, M. Carey, and L. Wu
Functionality of Androgen Receptor-Based Gene Expression Imaging in Hormone Refractory Prostate Cancer
Clin. Cancer Res., May 15, 2005; 11(10): 3743 - 3749.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Li, Y.-P. Zhang, H.-S. Kim, K.-H. Bae, K. M. Stantz, S.-J. Lee, C. Jung, J. A. Jimenez, T. A. Gardner, M.-H. Jeng, et al.
Gene Therapy for Prostate Cancer by Controlling Adenovirus E1a and E4 Gene Expression with PSES Enhancer
Cancer Res., March 1, 2005; 65(5): 1941 - 1951.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. E. Suter, M. B. Chein, V. von Messling, B. Yip, R. Cattaneo, W. Vernau, B. R. Madewell, and C. A. London
In vitro Canine Distemper Virus Infection of Canine Lymphoid Cells: A Prelude to Oncolytic Therapy for Lymphoma
Clin. Cancer Res., February 15, 2005; 11(4): 1579 - 1587.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Wang, S. Thorne, J. Hannock, J. Francis, T. Au, T. Reid, N. Lemoine, D. Kirn, and G. Hallden
A Novel Assay to Assess Primary Human Cancer Infectibility by Replication-Selective Oncolytic Adenoviruses
Clin. Cancer Res., January 1, 2005; 11(1): 351 - 360.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. Tsai, D. E. Johnson, A. Rahman, S. F. Wen, D. LaFace, J. Philopena, J. Nery, M. Zepeda, D. C. Maneval, G. W. Demers, et al.
Impact of Human Neutralizing Antibodies on Antitumor Efficacy of an Oncolytic Adenovirus in a Murine Model
Clin. Cancer Res., November 1, 2004; 10(21): 7199 - 7206.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. Mitrofanova, R. Unfer, N. Vahanian, W. Daniels, E. Roberson, T. Seregina, P. Seth, and C. Link Jr.
Rat Sodium Iodide Symporter for Radioiodide Therapy of Cancer
Clin. Cancer Res., October 15, 2004; 10(20): 6969 - 6976.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Maemondo, Y. Saijo, K. Narumi, T. Kikuchi, K. Usui, R. Tazawa, K. Matsumoto, T. Nakamura, K. Sasaki, M. Takahashi, et al.
Gene Therapy with Secretory Leukoprotease Inhibitor Promoter-Controlled Replication-Competent Adenovirus for Non-Small Cell Lung Cancer
Cancer Res., July 1, 2004; 64(13): 4611 - 4620.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Davydova, L. P. Le, T. Gavrikova, M. Wang, V. Krasnykh, and M. Yamamoto
Infectivity-Enhanced Cyclooxygenase-2-Based Conditionally Replicative Adenoviruses for Esophageal Adenocarcinoma Treatment
Cancer Res., June 15, 2004; 64(12): 4319 - 4327.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. E. Carette, R. M. Overmeer, F. H. E. Schagen, R. Alemany, O. A. Barski, W. R. Gerritsen, and V. W. van Beusechem
Conditionally Replicating Adenoviruses Expressing Short Hairpin RNAs Silence the Expression of a Target Gene in Cancer Cells
Cancer Res., April 15, 2004; 64(8): 2663 - 2667.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Q. Huang, X. Zhang, H. Wang, B. Yan, J. Kirkpatrick, M. W. Dewhrist, and C.-Y. Li
A Novel Conditionally Replicative Adenovirus Vector Targeting Telomerase-Positive Tumor Cells
Clin. Cancer Res., February 15, 2004; 10(4): 1439 - 1445.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
L. Barzon, M. Boscaro, and G. Palu
Endocrine Aspects of Cancer Gene Therapy
Endocr. Rev., February 1, 2004; 25(1): 1 - 44.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. A. Lanson Jr., P. L. Friedlander, P. Schwarzenberger, J. K. Kolls, and G. Wang
Replication of an Adenoviral Vector Controlled by the Human Telomerase Reverse Transcriptase Promoter Causes Tumor-Selective Tumor Lysis
Cancer Res., November 15, 2003; 63(22): 7936 - 7941.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. Li, Y. Chen, J. Dilley, T. Arroyo, D. Ko, P. Working, and D.-C. Yu
Carcinoembryonic antigen-producing cell-specific oncolytic adenovirus, OV798, for colorectal cancer therapy
Mol. Cancer Ther., October 1, 2003; 2(10): 1003 - 1009.
[Abstract] [Full Text]


Home page
RadiologyHome page
R. C. Susil, A. Krieger, J. A. Derbyshire, A. Tanacs, L. L. Whitcomb, G. Fichtinger, and E. Atalar
System for MR Image-guided Prostate Interventions: Canine Study
Radiology, September 1, 2003; 228(3): 886 - 894.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Noya, C. Balague, N. S. Banerjee, D. T. Curiel, T. R. Broker, and L. T. Chow
Activation of Adenovirus Early Promoters and Lytic Phase in Differentiated Strata of Organotypic Cultures of Human Keratinocytes
J. Virol., June 1, 2003; 77(11): 6533 - 6540.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Hamada, S. Kohno, M. Iwamoto, H. Yokota, M. Okada, M. Tagawa, S. Hirose, K. Yamasaki, Y. Shirakata, K. Hashimoto, et al.
Identification of the Human IAI.3B Promoter Element and Its Use in the Construction of a Replication-selective Adenovirus for Ovarian Cancer Therapy
Cancer Res., May 15, 2003; 63(10): 2506 - 2512.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Kawakami, H. Li, J. T. Lam, V. Krasnykh, D. T. Curiel, and J. L. Blackwell
Substitution of the Adenovirus Serotype 5 Knob with a Serotype 3 Knob Enhances Multiple Steps in Virus Replication
Cancer Res., March 15, 2003; 63(6): 1262 - 1269.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. W. van Beusechem, P. B. van den Doel, J. Grill, H. M. Pinedo, and W. R. Gerritsen
Conditionally Replicative Adenovirus Expressing p53 Exhibits Enhanced Oncolytic Potency
Cancer Res., November 1, 2002; 62(21): 6165 - 6171.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Suzuki, R. Alemany, M. Yamamoto, and D. T. Curiel
The Presence of the Adenovirus E3 Region Improves the Oncolytic Potency of Conditionally Replicative Adenoviruses
Clin. Cancer Res., November 1, 2002; 8(11): 3348 - 3359.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. L. M. Lamfers, J. Grill, C. M. F. Dirven, V. W. van Beusechem, B. Geoerger, J. van den Berg, R. Alemany, J. Fueyo, D. T. Curiel, G. Vassal, et al.
Potential of the Conditionally Replicative Adenovirus Ad5-{Delta}24RGD in the Treatment of Malignant Gliomas and Its Enhanced Effect with Radiotherapy
Cancer Res., October 15, 2002; 62(20): 5736 - 5742.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. O. Freytag, M. Khil, H. Stricker, J. Peabody, M. Menon, M. DePeralta-Venturina, D. Nafziger, J. Pegg, D. Paielli, S. Brown, et al.
Phase I Study of Replication-competent Adenovirus-mediated Double Suicide Gene Therapy for the Treatment of Locally Recurrent Prostate Cancer
Cancer Res., September 1, 2002; 62(17): 4968 - 4976.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Zhang, N. Ramesh, Y. Chen, Y. Li, J. Dilley, P. Working, and D.-C. Yu
Identification of Human Uroplakin II Promoter and Its Use in the Construction of CG8840, a Urothelium-specific Adenovirus Variant That Eliminates Established Bladder Tumors in Combination with Docetaxel
Cancer Res., July 1, 2002; 62(13): 3743 - 3750.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeWeese, T. L.
Right arrow Articles by Simons, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeWeese, T. L.
Right arrow Articles by Simons, J. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online