| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Clinical Investigations |
Divisions of Radiation Oncology [T. L. D., S. L., R. D., N. D., T. H.], Medical Oncology [H. v. d. P., B. M., M. G., M. A. C., W. G. N., J. W. S.], and Biostatistics [S. P.], The Johns Hopkins Oncology Center, Baltimore, Maryland 21231-1000; Departments of Urology [T. L. D., R. R., M. A. C., W. G. N., J. W. S.], Radiology [U. H., R. D.], and Pathology [A. M. D.], The Johns Hopkins Hospital, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21231-1000, and Calydon, Inc., Sunnyvale, California [D. C. Y., Y. C., D. R. H.]
| ABSTRACT |
|---|
|
|
|---|
50% reduction in PSA were treated with the highest two doses of CV706. This study represents the first clinical translation of a prostate-specific, replication-restricted adenovirus for the treatment of prostate cancer. Taken together, this study documents that intraprostatic delivery of CV706 can be safely administered to patients, even at high doses, and the data also suggest that CV706 possesses enough clinical activity, as reflected by changes in serum PSA, to warrant additional clinical and laboratory investigation. | INTRODUCTION |
|---|
|
|
|---|
1050% of men whose cancer recurs have a local recurrence as the first site of treatment failure, depending on pretreatment risk factors (3)
. Not surprisingly, men who do not suffer local recurrence are less likely to develop subsequent distant metastatic disease (3
, 4)
. Given these facts, the development of novel therapies that can minimize the risk of tumor recurrence and extend disease-free survival is logical and appropriate. Ideally, these novel therapies should have the potential for disease eradication and not be associated with a significant risk of toxicity and long-term complications. One new antineoplastic approach involves exploitation of the cytolytic capacity of adenovirus. It is well known that the adenoviruses can induce cell death by cytolysis as part of their normal life cycle (5) . Importantly, adenoviruses possess several important characteristics that make them attractive agents for PCa gene therapy, including a relatively high transduction efficiency (6 , 7) and the ability to transduce and lyse nonreplicating cells (7) . The latter point is particularly important, as PCa typically possesses a very low S-phase fraction of about 5% or less (8 , 9) . Several investigators have attempted to achieve intratumoral cell killing with oncolytic viruses, including adenoviruses (10 , 11) . In fact, some of the earliest work included treatment of patients with intratumoral injection of wild-type adenovirus into cervical cancer that was locally recurrent after radiation therapy (12) . Antitumor effects were clinically documented and provided a foundation for future studies. More recently, molecular biological techniques have allowed for genetic manipulation of the adenovirus, providing the ability to restrict its replication to unique genetic profiles of the tumor type to be treated (13 , 14) . These techniques include the production of replication-restricted adenoviruses that use heterologous tissue-specific promoters to control viral genes critical to replication (15)
In 1997, Rodriguez et al. (14) , reported on the development of a replication-competent, E3-deleted, cytolytic Ad5 adenovirus called CN706 (subsequently renamed CV706), with replication that was restricted to PSA-producing cells. This restricted replication was achieved by the insertion of a minimal promoter-enhancer construct of the human PSA gene (PSE) 5' of E1A, 3' of the E1A promoter, resulting in PSA-regulated expression of E1A. This E1A regulation, in turn, resulted in the restriction of CV706 replication primarily to cells expressing PSA. Single, intratumoral, injections of CV706 into PSA-producing human PCa xenografts (LNCaP) resulted in rapid regression of those established tumors with a concomitant decrement in serum PSA. These data and others provided a strong rationale for clinical testing of CV706 in a manner analogous to the preclinical models: i.e., by directed, intratumoral injections into the prostates of men with PCa.
PCa tends to be a multifocal disease. In fact, even clinically localized PCa typically has, on average, seven separate foci of cancer in the prostate, and these foci are frequently bilobar (16) . Therefore, any intraprostatic delivery of virus would, ideally, need to cover the entirety of the prostate to adequately treat this multifocal disease. Intratumoral injections of virus into the prostate can be performed several ways, including delivery by transrectal and transperineal routes. Intraprostatic delivery of radioactive sources, termed prostate brachytherapy, used in the definitive management of early-stage PCa, is a routine, outpatient procedure performed via the transperineal route (17) . This stereotactically guided approach generally allows for complete coverage of the prostate volume by the radioactive sources. Translation of this technique to in vivo PCa gene therapy is a logical extension of this well-proven technology, particularly when combined with a highly tissue-specific, replication-competent oncolytic adenoviral therapeutic. Together, these considerations formed the preclinical rationale for translation of replication-competent cytolytic viral therapy to the clinic. For men who experience a local recurrence of cancer after radiation therapy, there are no standard salvage therapies available. In addition, the presently available options for salvage (prostatectomy, brachytherapy, and cryotherapy; Refs. 18, 19, 20, 21 ) are associated with high rates of side effects, including impotence, incontinence, and rectal injury. Therefore, we designed a Phase I, dose-escalation study to determine the MTD and DLTs of CV706 when delivered by stereotactically guided intraprostatic injections in this group of patients.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
|
Preclinical data suggested that a single, intratumoral injection of CV706 would result in
1 ml of tumor killing in an LNCaP xenograft model (14)
. Using this information, a "viral dosimetric" algorithm was devised and entered into the MMS Therapac treatment planning system.4
This viral dosimetry was used to determine the most optimal sites for CV706 injection so as to effect the most homogenous coverage of the prostate within the confines of the protocol restrictions. Table 1
outlines the number of needles and viral depositions allowed in each portion of the protocol. On the day of treatment, a Foley catheter was placed into the patients bladder, and was maintained for 14 days. In the operating room, under spinal anesthesia, the patient was repositioned in the extended dorsal lithotomy position. The real-time, transrectal ultrasound was used to guide each 18-gauge Zebra needle (Mick Radio-Nuclear Instruments, New York, NY) through the perineum, into the prostate via a template to the predetermined positions for delivery of each 0.1-ml injection.
Patient Monitoring.
Patients were hospitalized for observation for 24 h after CV706 administration. Vital signs were monitored closely and blood and urine samples were obtained at predetermined intervals. Laboratory studies included: hematology, liver and renal functions, coagulation profiles, serum PSA and acid phosphatase, analysis for circulating CV706 in the blood and excreted in the urine, as well as neutralizing antibody titers. Physical exams were performed on subsequent days in the outpatient clinic, and patients completed a Functional Assessment of Cancer TreatmentProstate (FACT-P) quality-of-life assessment. On days 4 and 22 and at month 3 posttreatment, transrectal prostate biopsies were obtained.
Manufacturing and Preparation of CV706.
CV706 was supplied by Calydon, Inc., as a sterile, clear, frozen liquid in vials containing 0.5 ml of virus at a concentration of 1 x 1012 viral particles/ml. CV706 was formulated in PBS with 10% glycerol and 1 mM MgCl2 and stored at -80°C until needed. On the day of the procedure, the CV706 was thawed and resuspended in sterile 0.9% saline immediately before administration. In the operating room, CV706 was drawn into a sterile syringe, and the air was expelled to insure accurate delivery.
Neutralizing Antibody Titers in Blood.
The neutralization assay used in this study was performed as described previously (23)
. Briefly, serial dilutions of heat-inactivated patient serum (56°C for 30 min) was mixed for 1 h with adenovirus (1 PFU/cell). The virus-antibody mixture was then plated onto 293 cells (10,000 cells/well; 96-well plates) for 1 h. After incubation, the mixture was removed, RPMI 1640 was added, and the 293 cells were cultured for 57 days at 37°C. Cytopathic effect was then monitored at the time when control samples revealed 100% cytopathic effect after incubation.
Quantitative PCR for CV706 in Plasma.
Plasma samples (24 ml) were analyzed from all available samples obtained before treatment, as well as at 30 min, 1 h, 4 h, 8 h, 12 h, 18 h, and 24 h and at days 3, 8, 14, and 28 after treatment. Samples were frozen at -20°C or below immediately after plasma separation. One-ml aliquots of plasma were centrifuged and guanidinium thiocyanate solution was added to the pellet. DNA was extracted from samples with phenol/chloroform/isoamyl alcohol and precipitated in isopropyl alcohol. DNA was washed, dried, and resuspended in Tris-EDTA buffer. A PCR master mix containing the following HPLC-purified primers and fluorescent probe were added:
Forward: 5' CCCCAGCCCCAAGCTT 3'
Reverse: 5' GCGGCCATTTCTTCGGTAATA 3'
Probe: 5' FAMCCGGTGACTGAAAATGAGACATATTATCTGCCATAMRA 3'
PCR with real-time detection was performed in a Perkin-Elmer/ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) with the following cycling profile: 95°C for 10 min then 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 1 min. Assay performance was monitored by spiking eight control plasma samples with known amounts of CV706 (either 2,500 or 75,000 CV706 particles/ml of plasma), interspersed with patient samples as "unknowns." Insufficient plasma or insufficiently separated plasma could not be analyzed.
Determination of CV706 Viral Shedding in Urine.
Sterile urine samples from postinjection days 1, 8, 15, and 29 were collected, immediately centrifuged, and stored at -20°C until assayed. A plaque assay procedure on HEK-293 cell monolayers was used to screen and quantitate infectious CV706 viral particles. The urine samples were diluted 100-fold with DMEM (BioWhittaker, Walkersville, MD) supplemented with 5% fetal bovine serum (HyClone Laboratories, Logan, UT) to overcome the cytotoxicity of urine and run in duplicate or six-replicate wells. Plaques were counted on days 12, 13, and 14 after infection. In addition, where significant cytopathic effect was observed, the samples were repeatedly assayed with a 10-fold serial dilution in duplicate to accurately quantify PFU. Repeat assays were performed on both HEK-293 and nonpermissive HBL-100 cells to test for tissue selectivity of the isolated virus.
Electron Microscopy of Prostatic Biopsy Material.
Electron microscopy was performed on prostatic tissue obtained from transrectal needle biopsies of the prostate 4 days after CV706 treatment. Tissue samples were prepared as described previously (24)
. Briefly, prostate biopsy material was fixed in 2.5% glutaraldehyde and cut into thin sections. Sections were exposed to 1% osmium tetroxide and then dehydrated in ethanol. Next, a propylene oxide/embedding medium mixture was applied and, subsequently, a 100% embedding medium for 24 h. Sections were then polymerized and stained. Transmission electron microscopic images were analyzed for evidence of intranuclear viral particles.
Immunohistochemistry.
After paraffin removal and hydration, slides were immersed in 0.1% Tween 20, preheated in Protease Type VIII (Sigma Chemical Co., St. Louis, MO), and then treated with 3% hydrogen peroxide to quench endogenous peroxidases. Protein Blocker (Ventana Medical Systems, Tucson, AZ) was then applied, slides were washed, and the primary antibody, Adenovirus (Chemicon, Temecula, CA), was applied at 1:20,000 dilution in PBS for 45 min. The secondary biotin-labeled antibody was applied for 30 min (goat antimouse; 1:50), and localization was accomplished by exposure to an avidin-biotin complex horseradish peroxidase solution for 30 min. A diaminobenzidine substrate was used according to the manufacturers instructions (ChemMate; Ventana Medical Systems, Tucson, AZ), and the slides were counterstained with hematoxylin. Hexon staining was evaluated by a pathologist using an Olympus BX-40 light microscope without knowledge of the timing of the biopsy specimen, dose level, or patient identification.
Statistical Considerations.
The PSA velocity was evaluated by the method of Piantadosi, et al.5
to quantify the CV706 treatment effect. Using this method, the log of the pre- and posttreatment serum PSA values were calculated. The slope of the log PSA versus time trends was calculated before and after treatment using linear regression. If the mean change in log serum PSA (comparing pre- and posttreatment PSA slopes) is positive or zero, then the treatment had no effect. If the mean change is negative, then the treatment had an antitumor effect, as evidenced by reducing PSA velocity.
| RESULTS |
|---|
|
|
|---|
CV706 Treatment-Related Toxicity
Patient Reported AEs.
Table 3
summarizes all AEs reported in two or more men. The majority (74%) of the AEs noted were mild in severity and/or grade 1 toxicity. Only 24% of the AEs were considered to be moderate in severity and/or grade 2 toxicity. The majority of men (15 of 20) experienced a grade
2 fever approximately 38 h after injection that was either self-limited or responded to treatment with acetaminophen. Half of the men with fever had associated shaking chills and received acetaminophen (7 of 20). The majority of men (15 of 20) also experienced local pain at the injection site (perineum) and/or pelvic pain in the immediate postoperative period, 10 of whom were treated with acetaminophen and/or oxycodone. Approximately one-half of these men (9 of 20) had local pain with associated inflammation noted by examination. Hematuria was noted in all men, with 20 of 20 patients experiencing microscopic hematuria. Urinary irritative symptoms were frequently documented, including urethral pain, urinary urgency, and frequency. Patients consistently noted that the indwelling Foley catheter they were required to maintain for 14 days after CV706 administration was, in large part, related to these irritative urinary symptoms. Postprocedure nausea and vomiting was occasionally seen and was thought to be related to use of oxycodone in the immediate postprocedure setting. Two men each were noted to develop transient hypertension and hypotension, respectively. These episodes occurred in the immediate postprocedure setting and were most likely related to the anesthesia. One of the patients with hypertension was treated with hydralazine and the other with atenolol. No specific treatment was required for the patients with mild hypotension. Postprocedure amnesia was also thought to be related to the anesthesia. Several men complained of skin rashes (torso and arms) with or without pruritis, three of which were thought to be possibly related to the study drug.
|
Laboratory Data.
Clinical laboratory safety data were assessed for 1 month after treatment. Posttreatment liver transaminase levels have been generally normal. Minor transient elevations in AST to just above the upper limit of normal (grade 1) were seen in three men in cohort 4 1 week after treatment. In all cases, AST returned to normal at the next time point, 1 week later. Three men showed comparable minor elevations of alanine aminotransferase at the same time point that resolved spontaneously within 12 weeks. Two patients in the highest dose level experienced mild increases in AST to just above the upper limit of normal (grade 1), one of whom also had a very slight, transient elevation in alanine aminotransferase to just above normal values. These values returned to baseline levels within 30 days. Thus, there were no National Cancer Institute grade 2 toxicities for hepatotoxicity.
Hematological studies disclosed a transient, small and clinically nonsignificant decrease in platelets (average decrement of 22%), seen consistently two days following treatment, with levels returning to baseline by one week after treatment. Even smaller changes were seen in RBCs in most patients, also transient, returning to normal by day fourteen. These decrements in RBC were not associated with fibrin split products, D-dimer levels or clinical signs of disseminated intravascular coagulopathy (DIC) and were reversible without intervention. A transient, clinically nonsignificant decrease in absolute lymphocyte levels was observed in 90% of patients and was found to be maximal one or two days posttreatment, with an average drop of 66%. Lymphocyte levels returned to within 25% of baseline in the majority of patients by day 7 posttreatment. No specific subset analysis of lymphocytes was performed. These hematological findings are consistent with an acute phase response, not marrow suppression and were asymptomatic.
PSA
There were statistically significant differences between cohorts in mean pretreatment PSA levels (P = 0.04): dose level 1, 45.3 ng/ml; dose level 2, 14.5 ng/ml; dose level 3, 27.5 ng/ml; dose level 4, 14.5 ng/ml; and dose level 5, 7.1 ng/ml The variance in pretreatment PSA between groups was significantly greater than the variance within groups. These differences were, in part, related to modification of the PSA entry criteria instituted approximately halfway through the trial.
There were immediate alterations in serum PSA levels in all patients after treatment. These alterations were an expected consequence of the frequent, invasive, prostatic manipulations performed within the first month, including the intraprostatic delivery of CV706 and the transrectal biopsies performed at days 4 and 22 posttreatment. Table 4
outlines the PSA changes seen in the 20 treated patients. Thirteen of 20 patients (65%) experienced a reduction in serum PSA of
30% from pretreatment levels. Five of 20 patients (25%) experienced a reduction in serum PSA of
50%. All five patients with a reduction in serum PSA of
50% were in dose levels 4 and 5 (5 of 11). Of these patients, four patients achieved a PR, defined as a reduction in serum PSA by
50% from pretreatment levels, sustained for at least 4 weeks. The maximum duration of this PSA response was 11.3 months.
|
|
|
|
A single productive infectious cycle of adenovirus takes
2436 h before the release of newly formed virus from infected cells occurs (25)
. Interestingly, a second peak of detectable CV706 genome found in the circulation in all patients tested except three (one patient each from dose levels 3, 4A, and 4B) between 2 and 8 days after treatment. The viral load associated with this secondary peak varied between patients, and in at least four patients, it exceeded the load detected in circulation shortly after treatment. This secondary peak had a longer duration in most patients (median of 5 days) and, therefore, the total amount of systemic virus was substantially larger than that from the initial treatment in at least 10 of 16 tested patients. An example of this time course, from one patient treated in dose level 5A (1 x 1013 viral particles), is provided in Fig. 3
. For all patients tested, circulating CV706 levels returned to values indistinguishable from baseline (
1300 copies/ml) by day 15 after treatment.
|
Excreted CV706.
Urine was collected from all patients at specified times before and after treatment with CV706. Standard plaque assays were performed to determine the amount of virus shedding in the urine. At baseline (pretreatment), urine from all tested patients failed to induce plaque formation. By day 2 posttreatment, urine from 11 of 19 treated patients was positive for viral shedding as determined by plaque formation at >50 plaque-forming units/ml. Urine from only two patients continued to induce plaque formation at day 8, and by days 15 and 29, urine from all tested patients failed to induce plaques. No plaques were observed from urine samples in the tissue selectivity assay using HBL-100 cells, which are permissive for wild-type virus but nonpermissive for CV706 replication. A control assay using an equivalent Ad5 vector containing a wild-type E1A region was able to infect HBL-100 cells efficiently, suggesting that the virus in the urine of treated patients was not likely a wild-type recombinant.
| DISCUSSION |
|---|
|
|
|---|
A transient lymphopenia, which was not clinically significant, was noted in a majority of patients within 48 h of viral instillation with recovery of counts to within 25% of baseline in the majority of patients by 7 days posttreatment. The timing of this decrement combined with the quick recovery is most suggestive of an acute-phase reaction with associated leukocyte margination, and not bone marrow suppression (31) . Importantly, treatment with CV706 was not associated with significant hepatic or coagulation abnormalities. Specifically, no patient experienced greater than grade 1 elevation of liver transaminases, and no patient had evidence of alteration in prothrombin time or partial thromboplastin time or a decrement in fibrinogen. This safety was evident even at the highest dose level of 1 x 1013 viral particles and with evidence of viral shedding into the blood. Although the quantitative PCR for CV706 is likely detecting intact virus but not necessarily only viable virus, it is consistent with in vivo viral replication. The MTD of intraprostatic CV706 was not reached in this study, even at the highest administered dose of 1 x 1013. Significantly higher doses could not be delivered given manufacturing limitations in concentrating the virus further. Taken together, these data reveal the safety of CV706 when administered by intraprostatic injection and are critical to the future development of similar tissue-specific replication-competent adenoviruses.
The analysis of secondary study end points provides compelling evidence of CV706 activity. Serum PSA is well known to be a marker of both disease activity as well as disease burden (32, 33, 34, 35, 36)
. In this study, all patients achieving a PSA reduction
50% and/or who achieved a PR occurred in the highest two dose levels, suggesting a dose response for CV706. Moreover, there was a statistically significant reduction in the PSA velocity after treatment with CV706, again most pronounced for patients in dose levels 4 and 5, also suggestive of a dose-response relationship. The mean and median duration of PR was just over 6 months (6.6 months), suggesting the potential for disease stabilization by CV706 treatment. Biopsy of the prostate results in significant elevations in serum PSA for >2 weeks (37)
. Although the design of this study, with frequent posttreatment biopsies, aided in the documentation of viral replication, these same invasive procedures prevented a full analysis of the PSA-response to therapy with CV706. Thus, it is possible that substantial reductions in serum PSA could have been obscured by these frequent prostatic manipulations. Despite this possibility, the evidence gathered on PSA levels subsequent to treatment with CV706 are encouraging and suggest that at the higher dose levels, a clinically meaningful treatment effect may be achievable.
This treatment effect at higher doses is associated with clear histological and molecular evidence of viral replication. The viral inclusions seen on electron microscopy and the positive staining for hexon protein seen on immunohistochemistry from day 4 biopsy materials was confined to prostatic epithelial cells. Of note, hexon staining was most prominent in the highest dose levels and, like the electron microscopy, highly suggestive of intraprostatic replication of CV706 in these patients. At the highest dose level, Phase II trials estimating efficacy seem fully warranted.
Importantly, we were able to rigorously document CV706 shedding in the blood after intraprostatic delivery without significant associated clinical sequelae. The quantitative PCR assay is very specific for CV706 and is capable of detecting 1300 copies/ml of plasma. These results confirm that a small but significant amount of the intraprostatically administered virus reached the circulation. These experiments were not, however, designed to quantitatively assess the proportion of detectable genome derived from only viable CV706. The amount of virus released in the first "peak" varied between patients, did not seem to be related to the dose level or neutralizing antibody titer, and may represent leakage of virus during the administration procedure. The highest total amount of virus detected was in two patients (patients 12 and 14), with an estimate of <2% of the dose being detected. A significant secondary peak of circulating CV706 genome was observed in most patients
3 days after treatment, suggestive of viral replication. The appearance and size of the secondary peak seemed to depend on a low anti-Ad5 antibody titer at the time of treatment. These data are consistent with those derived from electron microscopy and immunohistochemistry and support the in vivo observations of CV706 replication in the human prostate.
Response to CV706 was not correlated with the presence of preexisting Ad5 neutralizing antibodies. After administration, most patients developed Ad5 neutralizing antibodies. These new antibodies did not block clinical response to treatment. Moreover, our data also reveal that the presence of preexisting anti-Ad5 antibodies is not obviously correlated with treatment-related toxicity. These data extend the previously reported work on intratumoral delivery of replication-competent adenovirus by revealing a lack of association between neutralizing antibody levels and treatment toxicity (10) . Whereas circulating anti-Ad5 antibody may significantly impact on the efficacy and toxicity of systemically administered adenovirus (38) , it is not clear that these antibodies have the same access to the tumor-bearing prostate, and thus they may have a limited impact on direct intratumoral injections (39) .
In summary, CV706 seems safe when delivered by intraprostatic injection using a planned, stereotactic approach. This trial also suggests that CV706 replicates selectively in prostatic epithelial cells, i.e., those prostate cells that make PSA, and does so in a time frame consistent with an adenoviral replicative cycle. To our knowledge, this is the first report of oncolytic viral vectors showing molecular and clinical activity in humans with PCa. Finally, these data suggest that CV706 possess biological activity, as evidenced by significant decreases in serum PSA, which seem to be dose-related. This was evident despite the frequent prostatic manipulations experienced by patients in this study, which could have significantly obscured full interpretation of these results. Thus, continued development of prostate-specific adenoviral vectors is compelling. In fact, concomitant treatment of carcinoma cells with oncolytic adenoviruses and DNA-damaging agents like radiation or certain chemotherapeutic agents can result in supra-additive cell killing (40, 41, 42, 43) . Thus, when considering the safety and activity of CV706, a strong rationale exists for additional laboratory and clinical investigation of CV706 in conjunction with radiation therapy for the treatment of human PCa.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported, in part, by the Johns Hopkins General Clinical Research Center (NIH/National Center for Research Resources M01RR00052), CaPCURE, and NIH/National Cancer Institute Grant CA58236 ![]()
2 To whom requests for reprints should be addressed, at Radiation Biology Program, The Johns Hopkins Oncology Center, 1650 Orleans Street, Room 1-144, Baltimore, MD 21231-1000. ![]()
3 The abbreviations used are: PCa, adenocarcinoma of the prostate; PSA, prostate-specific antigen; MTD, maximal tolerated dose; DLT, dose-limiting toxicity; AE, adverse event; PR, partial response; PFU, plaque-forming units; AST, aspartate aminotransferase. ![]()
4 T. L. DeWeese, J. W. Simons, R. Rodriquez, and A. Baccala, unpublished data. ![]()
5 S. P., B. M., and J. W. S., unpublished data. ![]()
Received 5/15/01. Accepted 8/16/01.
| REFERENCES |
|---|
|
|
|---|
levels with clinical outcome. J. Pediatr., 124: 714-720, 1994.[Medline]
This article has been cited by other articles:
![]() |
S. Leitner, K. Sweeney, D. Oberg, D. Davies, E. Miranda, N. R. Lemoine, and G. Hallden Oncolytic Adenoviral Mutants with E1B19K Gene Deletions Enhance Gemcitabine-induced Apoptosis in Pancreatic Carcinoma Cells and Anti-Tumor Efficacy In vivo Clin. Cancer Res., March 1, 2009; 15(5): 1730 - 1740. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Peled, A. Shaish, A. Katav, S. Greenberger, I. Barshack, R. Tal, L. Bangio, E. Breitbart, and D. Harats Systemic Administration of a Conditionally Replicating Adenovirus, Targeted to Angiogenesis, Reduced Lung Metastases Burden in Cotton Rats Clin. Cancer Res., March 1, 2009; 15(5): 1664 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Su, H. Cao, S. Tan, Y. Huang, X. Jia, L. Jiang, K. Wang, Y. Chen, J. Long, X. Liu, et al. Toxicology Profiles of a Novel p53-Armed Replication-Competent Oncolytic Adenovirus in Rodents, Felids, and Nonhuman Primates Toxicol. Sci., November 1, 2008; 106(1): 242 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ungerechts, C. Springfeld, M. E. Frenzke, J. Lampe, P. B. Johnston, W. B. Parker, E. J. Sorscher, and R. Cattaneo Lymphoma Chemovirotherapy: CD20-Targeted and Convertase-Armed Measles Virus Can Synergize with Fludarabine Cancer Res., November 15, 2007; 67(22): 10939 - 10947. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sarkar, I. V. Lebedeva, Z.-z. Su, E.-S. Park, L. Chatman, N. Vozhilla, P. Dent, D. T. Curiel, and P. B. Fisher Eradication of Therapy-Resistant Human Prostate Tumors Using a Cancer Terminator Virus Cancer Res., June 1, 2007; 67(11): 5434 - 5442. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. He, L. Li, D. Kim, B. Wen, X. Deng, P. H. Gutin, C. C. Ling, and G. C. Li Adenovirus-Mediated Expression of a Dominant Negative Ku70 Fragment Radiosensitizes Human Tumor Cells under Aerobic and Hypoxic Conditions Cancer Res., January 15, 2007; 67(2): 634 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. P. Le, H. N. Le, I. P. Dmitriev, J. G. Davydova, T. Gavrikova, S. Yamamoto, D. T. Curiel, and M. Yamamoto Dynamic Monitoring of Oncolytic Adenovirus In Vivo by Genetic Capsid Labeling J Natl Cancer Inst, February 1, 2006; 98(3): 203 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fukuhara, R. L. Martuza, S. D. Rabkin, Y. Ito, and T. Todo Oncolytic Herpes Simplex Virus Vector G47{Delta} in Combination with Androgen Ablation for the Treatment of Human Prostate Adenocarcinoma Clin. Cancer Res., November 1, 2005; 11(21): 7886 - 7890. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sato, M. Johnson, L. Zhang, S. S. Gambhir, M. Carey, and L. Wu Functionality of Androgen Receptor-Based Gene Expression Imaging in Hormone Refractory Prostate Cancer Clin. Cancer Res., May 15, 2005; 11(10): 3743 - 3749. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, Y.-P. Zhang, H.-S. Kim, K.-H. Bae, K. M. Stantz, S.-J. Lee, C. Jung, J. A. Jimenez, T. A. Gardner, M.-H. Jeng, et al. Gene Therapy for Prostate Cancer by Controlling Adenovirus E1a and E4 Gene Expression with PSES Enhancer Cancer Res., March 1, 2005; 65(5): 1941 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Suter, M. B. Chein, V. von Messling, B. Yip, R. Cattaneo, W. Vernau, B. R. Madewell, and C. A. London In vitro Canine Distemper Virus Infection of Canine Lymphoid Cells: A Prelude to Oncolytic Therapy for Lymphoma Clin. Cancer Res., February 15, 2005; 11(4): 1579 - 1587. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, S. Thorne, J. Hannock, J. Francis, T. Au, T. Reid, N. Lemoine, D. Kirn, and G. Hallden A Novel Assay to Assess Primary Human Cancer Infectibility by Replication-Selective Oncolytic Adenoviruses Clin. Cancer Res., January 1, 2005; 11(1): 351 - 360. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Tsai, D. E. Johnson, A. Rahman, S. F. Wen, D. LaFace, J. Philopena, J. Nery, M. Zepeda, D. C. Maneval, G. W. Demers, et al. Impact of Human Neutralizing Antibodies on Antitumor Efficacy of an Oncolytic Adenovirus in a Murine Model Clin. Cancer Res., November 1, 2004; 10(21): 7199 - 7206. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mitrofanova, R. Unfer, N. Vahanian, W. Daniels, E. Roberson, T. Seregina, P. Seth, and C. Link Jr. Rat Sodium Iodide Symporter for Radioiodide Therapy of Cancer Clin. Cancer Res., October 15, 2004; 10(20): 6969 - 6976. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maemondo, Y. Saijo, K. Narumi, T. Kikuchi, K. Usui, R. Tazawa, K. Matsumoto, T. Nakamura, K. Sasaki, M. Takahashi, et al. Gene Therapy with Secretory Leukoprotease Inhibitor Promoter-Controlled Replication-Competent Adenovirus for Non-Small Cell Lung Cancer Cancer Res., July 1, 2004; 64(13): 4611 - 4620. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Davydova, L. P. Le, T. Gavrikova, M. Wang, V. Krasnykh, and M. Yamamoto Infectivity-Enhanced Cyclooxygenase-2-Based Conditionally Replicative Adenoviruses for Esophageal Adenocarcinoma Treatment Cancer Res., June 15, 2004; 64(12): 4319 - 4327. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Carette, R. M. Overmeer, F. H. E. Schagen, R. Alemany, O. A. Barski, W. R. Gerritsen, and V. W. van Beusechem Conditionally Replicating Adenoviruses Expressing Short Hairpin RNAs Silence the Expression of a Target Gene in Cancer Cells Cancer Res., April 15, 2004; 64(8): 2663 - 2667. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Huang, X. Zhang, H. Wang, B. Yan, J. Kirkpatrick, M. W. Dewhrist, and C.-Y. Li A Novel Conditionally Replicative Adenovirus Vector Targeting Telomerase-Positive Tumor Cells Clin. Cancer Res., February 15, 2004; 10(4): 1439 - 1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Barzon, M. Boscaro, and G. Palu Endocrine Aspects of Cancer Gene Therapy Endocr. Rev., February 1, 2004; 25(1): 1 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Lanson Jr., P. L. Friedlander, P. Schwarzenberger, J. K. Kolls, and G. Wang Replication of an Adenoviral Vector Controlled by the Human Telomerase Reverse Transcriptase Promoter Causes Tumor-Selective Tumor Lysis Cancer Res., November 15, 2003; 63(22): 7936 - 7941. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, Y. Chen, J. Dilley, T. Arroyo, D. Ko, P. Working, and D.-C. Yu Carcinoembryonic antigen-producing cell-specific oncolytic adenovirus, OV798, for colorectal cancer therapy Mol. Cancer Ther., October 1, 2003; 2(10): 1003 - 1009. [Abstract] [Full Text] |
||||
![]() |
R. C. Susil, A. Krieger, J. A. Derbyshire, A. Tanacs, L. L. Whitcomb, G. Fichtinger, and E. Atalar System for MR Image-guided Prostate Interventions: Canine Study Radiology, September 1, 2003; 228(3): 886 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Noya, C. Balague, N. S. Banerjee, D. T. Curiel, T. R. Broker, and L. T. Chow Activation of Adenovirus Early Promoters and Lytic Phase in Differentiated Strata of Organotypic Cultures of Human Keratinocytes J. Virol., June 1, 2003; 77(11): 6533 - 6540. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hamada, S. Kohno, M. Iwamoto, H. Yokota, M. Okada, M. Tagawa, S. Hirose, K. Yamasaki, Y. Shirakata, K. Hashimoto, et al. Identification of the Human IAI.3B Promoter Element and Its Use in the Construction of a Replication-selective Adenovirus for Ovarian Cancer Therapy Cancer Res., May 15, 2003; 63(10): 2506 - 2512. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kawakami, H. Li, J. T. Lam, V. Krasnykh, D. T. Curiel, and J. L. Blackwell Substitution of the Adenovirus Serotype 5 Knob with a Serotype 3 Knob Enhances Multiple Steps in Virus Replication Cancer Res., March 15, 2003; 63(6): 1262 - 1269. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. W. van Beusechem, P. B. van den Doel, J. Grill, H. M. Pinedo, and W. R. Gerritsen Conditionally Replicative Adenovirus Expressing p53 Exhibits Enhanced Oncolytic Potency Cancer Res., November 1, 2002; 62(21): 6165 - 6171. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suzuki, R. Alemany, M. Yamamoto, and D. T. Curiel The Presence of the Adenovirus E3 Region Improves the Oncolytic Potency of Conditionally Replicative Adenoviruses Clin. Cancer Res., November 1, 2002; 8(11): 3348 - 3359. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. M. Lamfers, J. Grill, C. M. F. Dirven, V. W. van Beusechem, B. Geoerger, J. van den Berg, R. Alemany, J. Fueyo, D. T. Curiel, G. Vassal, et al. Potential of the Conditionally Replicative Adenovirus Ad5-{Delta}24RGD in the Treatment of Malignant Gliomas and Its Enhanced Effect with Radiotherapy Cancer Res., October 15, 2002; 62(20): 5736 - 5742. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Freytag, M. Khil, H. Stricker, J. Peabody, M. Menon, M. DePeralta-Venturina, D. Nafziger, J. Pegg, D. Paielli, S. Brown, et al. Phase I Study of Replication-competent Adenovirus-mediated Double Suicide Gene Therapy for the Treatment of Locally Recurrent Prostate Cancer Cancer Res., September 1, 2002; 62(17): 4968 - 4976. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, N. Ramesh, Y. Chen, Y. Li, J. Dilley, P. Working, and D.-C. Yu Identification of Human Uroplakin II Promoter and Its Use in the Construction of CG8840, a Urothelium-specific Adenovirus Variant That Eliminates Established Bladder Tumors in Combination with Docetaxel Cancer Res., July 1, 2002; 62(13): 3743 - 3750. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |