| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Division of Radiation and Cancer Biology (B. L., J. G., S. D., G. D., D. E. W., V. B.) Department of Radiation Oncology, New England Medical Center, and Department of Biochemistry (V. B.), Tufts University School of Medicine, Boston, Massachusetts 02111, and Johns Hopkins Oncology Center (E. E., S. S.), Baltimore, Maryland 21231-1000
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A number of mechanisms have been reported for inactivation of gene expression during oncogenesis. Rearrangements or deletions within a gene or its regulatory regions could provide one such mechanism (7)
. However, our earlier analyses showed no gross deletions or rearrangements within the NES1 gene in cell lines that failed to express it (2)
. Other mechanisms that could account for the tumor-specific loss of NES1 expression are loss of critical transcriptional factors that are required for its expression or alternatively the silencing of the NES1 gene. A prominent mechanism to silence gene expression during tumorigenesis involves stable DNA methylation. In eukaryotes, DNA methylation occurs at cytosines located 5' to guanosine as CpG dinucleotides. Such CpG dinucleotides are often clustered within control regions of a gene, typically in the promoter regions but often in other parts of a gene (8)
. Recent studies have demonstrated that hypermethylation of CpG islands also represents an important mechanism to inactivate specific gene expression during tumorigenesis (9
, 10)
. For example, the tumor-specific lack of expression of proteins, the cyclin-dependent kinase inhibitor p16 and p14, G2 cell cycle regulator 14–3-3
, retinoic acid receptor-ß2 gene, APC, E-cadherin, retinoblastoma protein, VHL, and cyclin D2, in breast and other cancers, has been directly linked to hypermethylation (9, 10, 11, 12, 13, 14, 15)
. In many cases demethylating agents, such as 5-aza-dC, can induce de novo expression of stably repressed genes, providing a rationale for a therapeutic strategy to counter tumorigenesis (11, 12, 13, 14, 15)
.
In this study, we have examined the mechanisms that underlie the tumor-specific loss of NES1 gene expression. First, we delineated the promoter region of the NES1 gene that can promote the expression of a heterologous reporter in normal MECs. Analyses using the NES1 promoter-luciferase reporter demonstrated that the loss of NES1 expression in many tumor cell lines was unlikely to be a result of lack of required transcription factors. Therefore, we examined the possible role of DNA methylation in the loss of NES1 gene expression. Sequence analysis of the NES1 promoter revealed that it was not CpG-rich. In contrast, exon 3 was found to be CpG-rich. Using sodium bisulfite DNA sequencing and MSP, we demonstrate tumor-specific methylation of the CpG island within exon 3 of the NES1 gene in breast cancer cell lines and primary tumors. Furthermore, we demonstrate that treatment of NES1-nonexpressing cells with 5-aza-dC restored NES1 expression, indicating a causal role of methylation in the loss of NES1 expression. The frequent loss of NES1 gene expression and its hypermethylation in breast cancer cells could provide a novel marker for the diagnosis and/or prognosis of breast cancer.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-MEM supplemented with 10% FCS, as described earlier (20)
. Primary breast tumor tissues were obtained after surgical resection at the Johns Hopkins University Hospital and stored frozen at -80°C. Procurement of samples was done under institutional human subjects’ guidelines and the applicable laws to protect the privacy of patients.
RNA Isolation and Northern Blot Analysis.
Total cellular RNA was isolated from 50–70% confluent cell monolayers using the guanidium-isothiocyanate method and RNeasy Midi kit (Qiagen, Valencia, CA). RNA from breast tissues was extracted from breast tissues using Triazol reagents (Invitrogen, Grand Island, NY). Northern blot hybridization was carried out using a nylon membrane (Hybond-N; Amersham, Arlington Heights, IL) and 32P-labeled NES1 cDNA insert (nucleotide 651-1072) or control probes (36B4 nucleotides), as described previously (2)
.
Treatment of Cells with 5-Aza-dC.
Cells were seeded at a density of 5 x 105/100-mm dishes, cultured for 48 h, and treated with 10, 50, or 100 µM 5-aza-dC (Sigma Chemical Co., St. Louis, MD) or left untreated. Forty-eight h after treatment, cells were washed with PBS, fresh medium was added, and cells were incubated for another 48 h before isolating total cellular RNA and genomic DNA.
RT-PCR.
RNA was treated with RNase-free DNase I (Invitrogen; 0.5–1 µg/µl) for 1 h at 37°C, and then with RNeasy Midi Protocol for RNA Cleanup (Qiagen). Reverse transcriptase reactions were performed in 2 µg of DNase-treated RNA, 1 µl of oligo(dT)12–18 using SUPERSCRIPT II RNase H- Reverse Transcriptase Kit protocol (Invitrogen). PCR was then performed using the NES1-specific primers 5'-CTCGAGTAGGGGATGATCACCT-3' (sense) and 5'-GCTTCAGTACAGGCAGAGAA-3' (antisense) and the Advantage cDNA PCR kit (Clontech, Palo Alto, CA). The PCR conditions were as follows: 1 cycle of 94°C for 2 min and 35 cycles of 94°C for 45 s, 62°C for 1 min, and 72°C for 1 min 30 s. The GAPDH gene and a housekeeping ribosomal protein gene, 36B4, were coamplified as internal controls, Primers for GAPDH were 5'-TGAAGGTCGGAGTCAACGGATTTGGT-3' (sense) and 5'-CATGTGGGCCATGAGGTCCACCAC-3' (antisense); primers for 36B4 were 5'-GATTGGCTACCCAACTGTTGCA-3' (sense) and 5'-CAGGGGCAGCAGCCACAAAGGC-3' (antisense). The PCR products were resolved by electrophoresis on 1% agarose gels.
Cloning and Sequence Analysis of the Promoter Region of the NES1 Gene.
NES1 cDNA was used as a probe for the isolation of a 140-kb human genomic DNA from a BAC library (Research Genetics, Huntsville, AL). BAC DNA was isolated by Qiagen BAC DNA protocol (Qiagen), digested with various restriction enzymes, and hybridized with human NES1 cDNA. These analyses allowed the isolation of a 6.5-kb HindIII fragment that included the first exon and additional 5' sequences of the NES1 gene. The plasmid containing this fragment was purified, sequenced, and cloned into pBluescript (SK) vector (Stratagene, La Jolla, CA). A 354-bp HindIII-PstI fragment corresponding to nucleotides -62 to +292 of the NES1 transcript was used as a probe to identify a single fragment of 3.1 kb. This NES1 promoter-containing fragment corresponded to sequences -2875 to +247 with respect to transcription start site and included the 73-bp exon 1 as well as part of the first intron.
Generation of NES1 Promoter Deletion Luciferase Reporter Constructs.
The 3.1-kb BamHI fragment including bases -2875 to +247 with respect to transcription initiation was cloned upstream of the luciferase gene in pGL3 basic luciferase expression plasmid. This construct is referred to as the BamHI fragment promoter. The NES1 promoter deletions were generated by PCR using the following primers. The nucleotides underlined are for cloning these fragments into pGL3 basic: from -2875 to -1, sense, 5' GGTACC GGATCCAGGAGACGATGAAGAACAATT 3' and antisense, 5'AGATCT ATCCTCTGCCCCAGGGACCCCTGGCGGG 3'; from -1366 to -1, sense, 5' GGTACC TATAAAACATCACTGCAGAAAGTTCAG 3' and antisense, 5' AGATCT ATCCTCTGCCCCAGGGACCCCTGGCGGG 3'; from -1354 to -1, sense, 5' GGTACC CTGCAGAAAGTTCAGCTGAGCAGCACT 3' and antisense 5' AGATCT ATCCTCTGCCCCAGGGACCCCTGGCGGG 3'); from -800 to -1, sense, 5' GGTACC GTTGGCTGAGGTGATGCCGATGCCCCT 3' and antisense 5' AGATCT ATCCTCTGCCCCAGGGACCCCTGGCGGG 3'; and from -282 to -1, sense, 5' GGTACC CGCCTGGGAAGCCTTCTTGGCACCGGG 3' and antisense 5' AGATCT ATCCTCTGCCCCAGGGACCCCTGGCGGG 3'. The primers used for all deletion mutants included KpnI (5') and BglII (3') restriction enzyme sites for cloning. PCR was performed according to protocol (denaturation I, 3 min at 94°C; denaturation II, 45 s at 94°C; annealing, 2 min at 68°C; extension, 1 min at 72°C for 35 cycles; and final extension, 10 min at 72°C). All constructs were sequenced to confirm the expected deletions.
Transfection and Luciferase Assay.
About 5 x 105 76NTERT cells were plated per 100-mm diameter dish for 48 h and cotransfected with 4 µg of NES1 promoter/luciferase reporter plasmid together with 1 µg of CMV-ß-Gal (Clontech; as an internal control for transfection efficiency) using the FUGENE reagent (Roche, Indianapolis, IN), according to the supplier’s protocol. Forty-eight h after transfection, the cells were washed with PBS and harvested by scraping directly into 1 ml of lysis buffer (Promega, Madison, WI). The ß-Gal activity was determined using a chemiluminescence assay according to the supplier’s protocol (Clontech). The luciferase activity in 20-µl aliquots of cell lysates was measured by luminometry, using commercially obtained reagents (Promega) and luminometer.
To assess the relative activity of the minimal promoter (-1366 to -1), in various cell lines, cells were transfected using either FUGENE or Trans IT-LT1 (Panvera, Madison, WI), as specified by manufacturer. In these experiments, the cells received 4.9 µg of NES1 promoter (-1366 to -1)/luciferase or the pGL3-basic vector (as a negative control) with 0.1 µg of renilla luciferase reporter PRL-SV40 (control for transfection efficiency). Cell lysates were prepared 48 h posttransfection, and firefly and renilla luciferase activities were quantified according to the manufacturer’s instructions (Dual-Luciferase Reporter Assay System; Promega).
Analysis of DNA Methylation by Sequencing of Sodium Bisulfite-treated DNA.
Genomic DNA was isolated and subjected to sodium bisulfite treatment to modify unmethylated cytosine to uracil, as described previously (21)
. Bisulfite-treated DNA was subjected to PCR using the following primers: 5'-GAATGTAGTTTAGTGTTATAGTTTAG-3' (sense primer with start at NES1 nucleotide +2366) and 5'-CACACCTCCAACTATAAAAATTCC (antisense primer with start at NES1 nucleotide +2713). The 373-bp PCR product includes the NES1 exon 3 sequences (nucleotides +2455 to +2635). The conditions for the PCR were as follows: 1 cycle of 94°C for 2 min; 35 cycles of 94°C for 45 s, 60°C for 60 s, and 72°C for 90 s; and 1 cycle of 72°C for 10 min. The product was purified using a Qiagen DNA extraction kit and ligated to a TA cloning vector (Invitrogen, Grand Island, NY). Five positive clones were sequenced for each cell line using T7 and BGH primers (Invitrogen) and an Applied Biosystems automated fluorescent sequencer, according to the manufacturer’s instructions.
MSP.
One µg of sodium bisulfite-treated genomic DNA was subjected to PCR amplification using the following primer combinations: the methylation-specific primers included in which nucleotides corresponding to potentially methylated Cs were retained: a 5' primer that covered the CG dinucleotides 7, 8, and 9 (5'-TTCGAAGTTTATGGCGTTTC-3') and a 3' primer that covered CG dinucleotides 21, 22, and 23 (5'-TTATTTCCGCAATACGCGAC) of the NES1 exon 3; the primer combination to amplify unmethylated DNA included in which the nucleotides corresponding to C nucleotides were changed to T (sense primer) or A (antisense primer), a 5' primer that correspond to CG dinucleotides 1, 2, and 3 (5'-TTGTAGAGGTGGTGTTGTTT-3') and a 3' primer that covered CG dinucleotides 16, 17, 18, and 19 (5'-CACACAATAAAACAAAAAACCA-3') for specific unmethylated DNA. The methylation-specific and nonmethylated DNA-specific primers yielded 137-bp and 128-bp PCR products, respectively. The PCR conditions were as follows: 1 cycle of 95°C for 5 min; 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 45 sec; and 1 cycle of 72°C for 4 min.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Together, these cell lines provided a panel of NES1-positive and -negative cells for additional analyses to define the mechanism of tumor-specific loss of NES1 expression.
|
; Ref. 22
; and data not shown). The cloned NES1 promoter lacks a consensus TATA box and contains potential AP1-binding (ATGATTCA -756 to -749), SP1-binding (GGGCGTG -600 to -594), and cyclic AMP responsive element (TGAGGTGA -809 to -802) sequences, consistent with the clustering of such sequences within the promoter region.
|
, cloned them into upstream of the firefly luciferase gene in promoterless pGL3 basic plasmid, and analyzed them by transfection in a NES1-expressing breast cell line, 76NTERT. CMV-ß-Gal, encoding ß-Gal, under a constitutive CMV promoter was used as an internal control of transfection efficiency. As shown in Fig. 2B
, the initial BamHI fragment, which included exon 1 and part of first intron exhibited relatively poor (<10-fold) promoter activity. Removal of exon 1 and intron 1 sequences but retaining the -2875 to -1 sequence resulted in a marked increase in activity (
40–50-fold). Progressive 5' truncations revealed that a fragment incorporating sequences -1354 to -1 was essentially as potent as -2875 to -1. Additional truncations led to the progressive loss of reporter activity with substantial (20-fold) activity even in the shortest fragment (-282 to -1). These results indicate that -1366 to -1 fragment contains elements that are required for maximal promoter activity.
Analysis of NES1 Promoter-Luciferase Activity in NES1- Expressing and NES1-negative Cells.
To assess whether the lack of NES1 expression in tumor cells may be a result of the lack of appropriate transcription factors, we examined the activity of the NES1 (-1366 to -1) luciferase reporter in a group of NES1-expressing (76NTERT, 70E6, 21PT, and Caski) and NES1-negative (MDA-MB-231, MDA-MB-435, MDA-MB-453, MCF-7, HeLa, and Siha) cell lines. As expected, high NES1 promoter activity was seen in NES1-expressing 70E6 and 76NTERT cells. Unexpectedly, most NES1-negative cell lines supported a significant promoter activity. Although the activity in two NES1-negative cell lines MCF-7 and MDA-MB-453 was relatively low, a much higher activity was observed in three other tumor cell lines (MDA-MB-231, MDA-MB-435, and HeLa; Figs. 1
and 3
). Furthermore, the promoter activity in the Siha cell line, which completely lacks NES1 expression, was comparable with that in NES1-expressing cells (Fig. 3)
. Interestingly, the levels of NES1 promoter activity in 21PT cells, which express significant levels of NES1 mRNA (Fig. 1)
, was substantially lower than in the NES1-negative Siha cell line (Fig. 3)
. Thus, although there is a possibility that lower levels of transactivating factors may occur in certain NES1-negative cell lines, the activity of most of the NES1-negative cells to support a certain degree of NES1 promoter activity implied that a defect in transacting factors was unlikely solely to account for lack of NES1 mRNA expression in most cases.
|
Tumor-specific Hypermethylation of NES1 Exon 3.
To examine whether the lack of NES1 expression in tumor cell lines is associated with hypermethylation of the CpG island in exon 3 of the NES1 gene, we used MSP, a method used in previous studies to demonstrate hypermethylation of 14-3-3 and cyclin D2 in breast cancer cells (12
, 14)
. This method relies on selective conversion of unmethylated, but not methylated, cytosines to uracil when DNA is treated with sodium bisulfite (21)
. Uracil is subsequently recognized as thymidine by the Taq polymerase. Two pairs of PCR primers were designed to selectively yield PCR products depending on whether the target DNA was methylated or unmethylated. Amplification with the two sets of primers was carried out on sodium bisulfite-treated DNA from a number of NES1-nonexpressing and NES1-expressing cell lines.
A PCR product was only observed with primers designed to amplify unmethylated DNA in NES1-positive finite life span MECs 76N and 81N (Fig. 4A)
. In contrast, a PCR product was specifically amplified by the methylation-specific primers in three breast (MDA-MB-231, MDA-MB-453, and MDA-MB-175) and three cervical carcinoma cell lines (HeLa, Siha, and Caski). A PCR product was essentially undetectable with primers designed to amplify unmethylated sequences in these cell lines (Fig. 4A)
, and a PCR product was amplified both by the methylation-specific and unmethylated primers in three breast cancer cell lines (MDA-MB-435, BT-474, and ZR-75-1; Fig. 4A
), indicating partial hypermethylation.
|
. Notably, the distal CpG dinucleotides, 21–23, were fully unmethylated in NES1-expressing cells, whereas these were invariably methylated in NES1-nonexpressing cells. These results suggest exon 3 as an important site for methylation in the NES1 gene.
Reversal of DNA Methylation with 5-Aza-dC Induces NES1 Expression in NES1-Nonexpressing Tumor Cells.
One test that has been used to causally implicate hypermethylation of DNA in tumor cell-specific lack of gene expression is treatment with demethylating agents such as 5-aza-dC (11, 12, 13, 14, 15)
. To assess whether 5-aza-dC treatment induces de novo expression of NES1 in nonexpressing cells, we treated representative NES1-expressing (76N, 81N, 70E6, and 81E6), -nonexpressing (MDA-MB-231, MDA-MB-453, MDA-MB-435, BT-474, ZR-75-1, and Siha) and -low-expressing (MCF-7 and Caski) cell lines with different concentrations of 5-aza-dC for 48 h and performed RT-PCR to detect NES1 expression. Treatment of NES1-expressing cell lines (81N and 70E6) did not alter the level of NES1 expression, as assessed by RT-PCR (Fig. 5A)
. In contrast, 5-aza-dC treatment of NES1-nonexpressing tumor cell lines resulted in a dose-dependent induction (MDA-MB-231, MDA-MB-435, and Siha) or increase (Caski and MCF-7) in NES1 expression. In each case, the control GAPDH messages were equivalent in samples obtained from cells treated with different concentrations of 5-aza-dC treatment. In addition to the cells in Fig. 5A
, we also observed similar results in two NES1-expressing (76N and 81E6) and NES1-nonexpressing (MDA-MB-453, BT-474, and ZR-75-1) cells (data not shown). To correlate further the induction/enhancement of NES1 expression with 5-aza-dC-induced change in DNA methylation, we carried out PCR analysis of exon 3 methylation using primers specific for unmethylated and hypermethylated DNA in MDA-MB-231 cells (Fig. 5B)
. Whereas DNA from untreated MDA-MB-231 cells yielded a PCR product only with methylation-specific primers, treatment with increasing concentrations of 5-aza-dC led to the appearance of increasing levels of the PCR product corresponding to unmethylated exon 3 (Fig. 5B)
. These results strongly implicate methylation of exon 3 in the loss of NES1 expression in breast and cervical cancer cells.
|
. In contrast, 4 of 11 primary breast carcinomas (3
, 6
, 7
, 9)
showed no PCR product, whereas a product was detectable in the remaining 7 samples.
|
. One specimen (specimen 2) showed NES1 expression by RT-PCR (Fig. 6A)
and yielded PCR products corresponding to both unmethylated and methylated NES1 exon 3 (Fig. 6B)
. It is likely that the presence of a RT-PCR product in this sample reflects the high sensitivity of the RT-PCR method, which may allow detection of extremely low levels of NES1 expression.
Sodium bisulfite-treated DNA from all 11 tumor samples described above was also subjected to PCR amplification of exon 3 to identify the pattern of CpG methylation. As seen in Fig. 6C
, all of the tumor samples with no expression of NES1 (3, 6, 7, and 9) showed higher levels of methylation, particularly in the distal CpG islands. In contrast, those samples with detectable NES1, there was no methylation of exon 3 (1, 4, 5, 8, 10, and 11; Fig. 6C
). Interestingly, specimen 2, which expressed NES1 and showed both methylated and unmethylated PCR product, showed complete methylation of CpG islands 1, 14, and 21 (Fig. 6, A–C)
.
In addition to tumor specimens described above, we also carried out MSP analysis of DNA isolated from four other specimens where samples of tumor as well as adjacent pathologically normal tissue were available. This analysis showed methylation of exon 3 in three of four tumor samples, but only unmethylated NES1 was seen in the normal tissues (Fig. 6D)
. These results strongly implicate methylation of exon 3 in the loss of NES1 expression in breast cancer cells.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In this study, we provide extensive evidence that hypermethylation of NES1 is one such mechanism. On the basis of these findings, we have designed strategies to examine the methylation of the NES1 gene in primary breast tumor cell lines and tissues and provide supporting evidence for the lack of NES1 expression and hypermethylation in tumor but not in normal mammary tissue.
In an effort to elucidate the mechanism of tumor-specific loss of NES1 expression, we first focused on its promoter region. Although several NES1-nonexpressing cells supported the transcription of a NES1 promoter-linked reporter to a lower degree than NES1-expressing cells, most of the NES1-nonexpressing cells supported a substantial promoter activity. Thus, although additional studies will be required to explore the possible loss of transacting factors as a mechanism for the loss of NES1 expression in a subset of tumor cells, there was clear evidence that another cis-acting mechanism was operational in many instances.
Given recent developments that have identified the hypermethylation of promoter or other regions as a causal mechanism to inactivate gene expression during oncogenesis (9
, 10)
, we considered the possibility that NES1 down-regulation might be caused by hypermethylation of its gene. Recent examples of such a mechanism include the p16, 14-3-3, RAR-ß, and cyclin D2 (11, 12, 13, 14)
. Physiological DNA methylation, a prominent mechanism of developmental regulation of gene expression, as well as oncogenesis-associated DNA methylation takes place on regions of DNA that are rich in CpG dinucleotides, the CpG islands (8, 9, 10)
. Analysis of the NES1 promoter revealed it to be CpG-poor, indicating that this region was unlikely to be a target of hypermethylation. In contrast, the CpG content and the frequency of CpG dinucleotides was substantially more than expected within exons 2, 3, and 4, with a particularly high density on exon 3. Our additional studies, therefore, focused on exon 3.
Two approaches were designed to assess the status of NES1 exon 3 methylation and its association with NES1 expression status, the PCR-based MSP assay, and sequencing of the CpG island of the sodium bisulfite-treated DNA. This analysis revealed that exon 3 was unmethylated in cells that express NES1 mRNA, especially within the 3' region. In contrast, most of these CpG dinucleotides were partially or completely methylated in breast and cervical cancer cell lines that lacked NES1 mRNA expression. This approach was extended additionally to a small set of primary breast tumors in which NES1 mRNA expression was concurrently analyzed using a RT-PCR assay. Four of 11 samples lacked NES1 mRNA expression, and these samples showed a high level of exon 3 methylation. In contrast, very low levels of methylation were seen in tumor samples that expressed NES1 mRNA.
On the basis of the overall pattern of exon 3 methylation, we designed MSP primers that could detect the presence of methylation within exon 3, including the 3' region, which was invariably unmethylated in NES1-expressing cells. This approach substantiated the above findings by demonstrating that methylation-specific primers did not amplify a PCR product in NES1-expressing cells, whereas a product was observed in essentially every instance where NES1 expression was very low or absent. Importantly, methylation-specific primers allowed the detection of exon 3 methylation in primary tumor samples and revealed a strong correlation between the presence of methylation and the lack of NES1 expression. Furthermore, in a limited number of samples, methylation was observed in the tumor tissue but not in the adjacent normal tissue. Taken together, the analyses of in vitro cultured breast and cervical cancer cells and of primary breast tumor samples, indicates that analysis of NES1 expression and its methylation may provide an important tumor marker in breast cancer.
At present, the basis for a strong correlation of a downstream CpG island hypermethylation with the lack of NES1 expression remains unknown. Although, we focused on exon 3 hypermethylation for the present study, we noted that exons 2, 3, and 4 were all CpG-rich. It is conceivable that exon 3 methylation is reflective of hypermethylation of this entire region. Notably, exon 2 is within the limits of regulatory CpG islands (-500 to +1500 bp of transcriptional start site; Ref. 23 ). Future studies examining methylation of all of the CpG-rich exons (exons 2–4) together with analyses of the rare CpG sequences in the promoter region should help elucidate the precise role of NES1 hypermethylation and tumor-specific loss of expression.
Given that loss of NES1 expression and methylation were also observed in cell lines obtained from prostate and cervical cancers, studies to assess NES1 expression and its methylation as a tumor marker in these cancers will also be of substantial significance. The assays developed here, using in vitro cultured cell lines and evaluated on a limited panel of tumor samples, should facilitate such analyses.
Studies reported here demonstrated that treatment of NES1-nonexpressing cells with a demethylating agent, 5-aza-dC, leads to both demethylation of NES1 and its expression, as assessed by RT-PCR. Thus, methylation may play a causal role in NES1 inactivation, perhaps together with other repressive mechanisms such as histone deacetylation. Recent studies have indicated that transcriptional repression by DNA methylation can be mediated through a sequence-independent process involving changes in chromatin structure and histone-acetylation levels (9 , 10) . Future studies will be required to directly address these issues.
Studies from our laboratory have suggested that NES1 functions as a tumor suppressor when introduced into NES1-nonexpressing breast cancer cells (4) . Given the lack of any mutations or deletions, a characteristic of the bona-fide tumor suppressors such as p53 or retinoblastoma, we have indicated that NES1 is likely to function as a class II tumor suppressor, which are inactivated through loss of expression (24) . Our current studies further support this idea and raise a strong possibility that, similar to other class II tumor suppressors, NES1 expression may be lost as a result of hypermethylation.
At present, it is not clear how NES1 might function as a tumor suppressor. The primary sequence of NES1 predicted it to be a serine protease; however, we have not detected such an activity using a variety of biochemical approaches.5 Although additional studies are mandated to define the biological function of NES1, our present studies support the notion that NES1 expression and its methylation status can be used as a molecular marker in breast and other cancers. Future studies using tumor samples representing different stages of oncogenesis should provide an indication of whether NES1 expression and/or methylation correlate with early diagnosis and/or prognosis, either by itself or with other tumor markers.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by a grant from the Department of Defense Breast Cancer Program (to V. B.). J. G. and S. D. are recipients of postdoctoral fellowships from the Massachusetts Department of Public Health Breast Cancer Program. B. L. is a recipient of a postdoctoral fellowship from the Department of Defense Breast Cancer Program. 
2 To whom requests for reprints should be addressed, at Department of Radiation Oncology, Box No. 824, New England Medical Center, 750 Washington Street, Boston, MA 02111.
3 The abbreviations used are: NES1, normal epithelial cell-specific-1; MEC, mammary epithelial cell; 5-aza-dC, 5-aza-2'deoxycytidine; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BAC, bacterial artificial chromosome; ß-Gal, ß-galactosidase; MSP, methylation-specific PCR; CMV, cytomegalovirus; TERT, telomerase reverse transcriptase.
Received 5/16/01. Accepted 8/24/01.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
locus leads to gene silencing in breast cancer. Pro. Natl. Acad. Sci. USA, 97: 6049-6054, 2000.This article has been cited by other articles:
|
|
 |
|
  M. J. Fackler, M. McVeigh, J. Mehrotra, M. A. Blum, J. Lange, A. Lapides, E. Garrett, P. Argani, and S. Sukumar Quantitative Multiplex Methylation-Specific PCR Assay for the Detection of Promoter Hypermethylation in Multiple Genes in Breast Cancer Cancer Res., July 1, 2004; 64(13): 4442 - 4452. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Borgono, I. P. Michael, and E. P. Diamandis Human Tissue Kallikreins: Physiologic Roles and Applications in Cancer Mol. Cancer Res., May 1, 2004; 2(5): 257 - 280. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kishi, A. Soosaipillai, L. Grass, S. P. Little, E. M. Johnstone, and E. P. Diamandis Development of an Immunofluorometric Assay and Quantification of Human Kallikrein 7 in Tissue Extracts and Biological Fluids Clin. Chem., April 1, 2004; 50(4): 709 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sato, N. Fukushima, A. Maitra, H. Matsubayashi, C. J. Yeo, J. L. Cameron, R. H. Hruban, and M. Goggins Discovery of Novel Targets for Aberrant Methylation in Pancreatic Carcinoma Using High-Throughput Microarrays Cancer Res., July 1, 2003; 63(13): 3735 - 3742. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dhar, R. Bhargava, M. Yunes, B. Li, J. Goyal, S. P. Naber, D. E. Wazer, and V. Band Analysis of Normal Epithelial Cell Specific-1 (NES1)/Kallikrein 10 mRNA Expression by in Situ Hybridization, a Novel Marker for Breast Cancer Clin. Cancer Res., November 1, 2001; 7(11): 3393 - 3398. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
, unmethylated; 
, complete hypermethylation; 
, partial methylation.
