Cancer Research Donn Young Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Slattery, M. L.
Right arrow Articles by Potter, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slattery, M. L.
Right arrow Articles by Potter, J. D.
[Cancer Research 61, 1000-1004, February 1, 2001]
© 2001 American Association for Cancer Research

Epidemiology and Prevention

A Molecular Variant of the APC Gene at Codon 1822: Its Association with Diet, Lifestyle, and Risk of Colon Cancer1

Martha L. Slattery, Wade Samowitz, Linda Ballard, Donna Schaffer, Mark Leppert and John D. Potter2

Departments of Family and Preventive Medicine [M. L. S.], Pathology [W. S.], and Genetics [M. L.] and Genomics Core Facility [L. B.], University of Utah, Salt Lake City, Utah 84112; Kaiser Permanente Medical Care Program, Oakland, California 94611 [D. S.]; and Fred Hutchinson Cancer Research Center, Seattle, Washington 98109-1024 [J. D. P.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The adenomatous polyposis coli (APC) gene is important in the etiology of colon cancer. Although germ-line mutations of this gene rarely occur in the population, less penetrant variants of the gene have been reported. One variant, producing an aspartate to valine change at codon 1822 (B1822V) has been previously reported as having an allele frequency of 10%. The purpose of this study was to determine whether this B1822V variant of the APC gene is associated with colon cancer and whether its association is influenced by other genetic or environmental factors. We used data collected as part of a multicenter study of 1585 incident cases of colon cancer and 1945 age- and sex-matched population-based controls to evaluate genetic, dietary, and environmental associations with the B1822V variant of the APC gene. The frequency of the valine/valine allele at codon 1822 was 22.8% in this population. In the control population, 61.5% were homozygote wild type, 33.3% were heterozygotes, and 5.2% were homozygote variant. Cases were slightly less likely to have the homozygous variant APC genotype than were controls [odds ratio (OR), 0.8; 95% confidence interval (CI), 0.6–1.1]; for those diagnosed after age 65, the homozygous APC variant was associated with reduced risk of colon cancer (OR, 0.6; 95% CI, 0.4–1.0). Assessment of the homozygous APC variant with dietary, genetic, and environmental factors showed that individuals with this genotype were at lower risk if they consumed a low-fat diet (OR, 0.2; 95% CI, 0.1–0.5) relative to those who were homozygous wild type and ate a high-fat diet. This finding was specific to a low-fat diet and was unrelated to other dietary variables. These results suggest that the codon 1822 variant of the APC gene may have functional significance. Individuals who have the valine/valine variant of this gene may be at reduced risk of colon cancer if they eat a low-fat diet.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The APC3 gene is part of the wnt signaling pathway and important in the etiology of colon cancer (1 , 2) . Acquired mutations in this gene are important early steps in the carcinogenesis process, with ~80% of sporadic colon tumors showing such a mutation (3) . Although acquired mutations occur throughout the gene, there is a mutation cluster region at codons 1286 through 1513 in sporadic cancers.

Germ-line variants of the APC gene exist (4) . The best known of these are the relatively uncommon inherited knockout mutations which are responsible for the syndrome of Familial Adenomatous Polyposis. It is estimated that fewer than 1% of colon cancers can be attributed to these highly penetrant inherited APC mutations (5) . There are, however, other germ-line variants that are not associated with the polyposis phenotype and are of uncertain biological significance (3) . At least eight molecular variants of the APC gene have been identified. With the exception of one variant, the allele frequencies of these variants are estimated at no more than 1% (3 , 6 , 7) . Three of these variants have been associated with amino acid changes (3) . The most common variant has been reported at an allele frequency of 10%; it results in an aspartate to valine change at codon 1822 (3) . The other two variants causing amino acid changes have been reported with allele frequencies of around 1% (3) .

It is possible that APC variants associated with amino acid changes may alter risk of colon cancer in the presence of environmental exposures, or that they may independently alter colon cancer risk in subsets of the population. In one study by Powell et al. (3) , significant associations between colon cancer and the three APC variants that cause amino acid changes were not detected in 45 cases of cancer and 100 healthy controls; that study had limited power.

In this study, we used data from a large population-based case-control study of colon cancer to examine the association between the codon 1822 variant of the APC gene and risk of colon cancer. We also determined whether dietary and life-style exposures influenced colon cancer risk in conjunction with this APC variant. Because of its relatively high allele frequency (3) , we projected that we would have sufficient power to detect an approximate 2-fold difference in risk associated with diet and life-style factors that might interact with the B1822V variant.


   PATIENTS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Study Population.
Study participants were Caucasian (91.3%), African-American (4.2%), or Hispanic (4.4%) and from the Kaiser Permanente Medical Care Program of Northern California (KPMCP), an eight county area in Utah (Davis, Salt Lake, Utah, Weber, Wasatch, Tooele, Morgan, and Summit counties) and the metropolitan Twin Cities area (Anoka, Carver, Dakota, Hennepin, Ramsey, Scott, and Washington counties) of Minnesota. A rapid-reporting system was used to identify cases, with the majority of cases being interviewed within 4 months of diagnosis. Eligibility criteria for cases included diagnosis with first-primary incident colon cancer (ICD-O 2nd edition (8) codes 18.0 and 18.2 to 18.9) between October 1, 1991 and September 30, 1994; ages between 30 and 79 years at time of diagnosis; and mental competence to complete the interview. Patients with cancers of the rectosigmoid junction or rectum (defined as the first 15 cm from the anal opening), with known familial adenomatous polyposis, ulcerative colitis, or Crohn’s disease were not eligible. Of those cases invited to participate in the study, ~76% cooperated. Methods used to ascertain controls have been reported and included people randomly selected from Kaiser membership lists, from random-digit dialing, from driver’s license lists, and from social security lists (9) . Of all controls asked to participate, ~64% cooperated. Reasons for nonparticipation have been described (10) . A total of 1993 cases and 2410 controls had complete data considered of high quality. Of these, 1585 cases and 1945 controls had DNA extracted from white blood cells and genotyping completed for B1822V APC variant. We did not observe differences in physical activity, body size, or dietary intake between those from whom DNA was able to be extracted and those not having had blood drawn or DNA extracted. However, those whom we were able to genotype were significantly more likely to report drinking alcohol than those without genotype data.

Data Collection.
Data were collected from study participants by trained and certified interviewers using laptop computers. The referent period that study participants were asked to recall was the calendar year 2 years prior to the date of selection (the date of diagnosis for cases or date of selection for controls). The interview took ~2 h to complete. Quality-control methods used in the study have been described (11 , 12) .

Dietary intake data were ascertained using an adaptation of the validated Coronary Artery Risk Development in Young Adults (CARDIA) diet history questionnaire (12) . Participants were asked to determine which foods were eaten (using brand names of food items such as fast foods, cookies, crackers, cereals, when possible), the frequency with which foods were eaten, and fat used in preparation of other foods. Three-dimensional food models were used to help participants estimate their usual serving size. Cue cards were used to help the consistent identification of foods within broad categories. For certain items, when it was possible that many types of food within a category would be eaten (such as breakfast cereal), participants were asked to report the three mostly commonly eaten items. As part of the diet history, detailed information was obtained on foods eaten as additions to other foods (such as sugar added to cereal); standard amounts of additions were assigned per unit of the food item they accompanied. Nutrient values for specific foods were calculated using the Minnesota Nutrition Coordinating Center’s (NCC) nutrient database version 19.

Specific questions on the preparation of red meat, poultry, and fish were used including those on the preferred degree of cooking ("doneness") of red meat and poultry: rare, medium rare, medium well done, and well done; the frequency of cooking by frying, broiling, baking, or barbecuing of red meat, poultry, and fish; and the frequency of the use of drippings of red meat, poultry, and fish, either on other foods or in gravy. Because microwaving produces much lower concentrations of mutagens than pan frying and broiling, the frequency of use of microwaving to thaw or partially precook meat before preparation by frying, broiling, baking, or barbecuing was assessed. We estimated potential exposure to mutagens via a Mutagen Index. The index is calculated as [[the frequency of red meat, poultry, and fish consumption prepared by frying, broiling, baking, or barbecuing] plus [the use of drippings from red meat, poultry or fish]] x [the preferred doneness of the red meat, poultry, and fish (1 = rare, 2 = medium rare, 3 = medium well done, 4 = well done)] x [the microwave factor (1 = never used for thawing, 0.75 = sometimes used, 0.5 = often used, 0.25 = always used)]. A high index reflects higher intake of potentially mutagenic compounds.

Measures of eating patterns were derived using factor analysis, as described elsewhere (13) via the SAS principal-components program. After a varimax rotation, factor scores were saved for each individual. The food pattern that we arbitrarily labeled as "Western Diet" was used for the analyses presented here. This food pattern loaded heavily (factors with loadings of over 0.30) on processed meats, red meat, fast-food meat, eggs, butter, margarine, potatoes, high fat dairy foods, legumes, refined grains, added sugar, sugar drinks, and sugar desserts (13) .

Other data obtained and used in these analyses were: age at the time of diagnosis or selection; BMI (weight/height2) for men; weight/height1,5) for women) self-reported for the referent year; usual number of cigarettes smoked, long-term vigorous leisure-time activity, ever having used aspirin or nonsteroidial anti-inflammatory drugs on a regular basis, and family history of cancer in first-degree relatives. Physical activity, performed at home and at leisure, was ascertained using an adaptation of the validated CARDIA physical activity history (14) . Tumor site within the colon was classified as proximal (cecum through transverse colon) or distal (splenic flexure, descending, and sigmoid colon). Tumor stage was defined using the NCI’s Surveillance Epidemiology and End Results (SEER) Program summary stage codes of local, regional or distant. Vital status was obtained from local tumor registries and included all deaths through December of 1998.

Genotype Data.
The GAC/GTC polymorphism at codon 1822 of the APC gene (6) was determined for 1590 cases and 1945 controls by single-strand conformational polymorphism. This was done as described previously (15) except that primers were fluorescently tagged, and PCR products were run on a PE Biosystems 373A sequencer. A segment of DNA that contained codon 1822 was PCR amplified using a forward primer fluorescently tagged with TET (GTTTCTGAGAGAGTTTTCTCAGACAAC), and one of six reverse primers (GTTTCTTCTATCTTCATTATTTGGGAGC, GTTTCTTCTATCTTCATTATTTGGGAGC, GTTTCTACTTCCTCTGACTCTATCTTC, GTTTCTGAATCAAAAGCAAAACTTCCTC, GTTTCTATGATGAGGTGAATCAAAAGCA, GTTTCTTAGGCGTGTAATGATGAGGTG, or GTTTCTTCCTTCAATAGGCGTGTAATG). The six reverse primers were used to generate PCR products of different lengths so that these products could be multiplexed on the 373A sequencer. An identical forward primer tagged with HEX was used to amplify a known normal to provide an internal control in each lane (Fig. 1)Citation .



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. In each lane, there is a wild-type control (black waveform) amplified with a HEX-labeled forward primer. Sample DNA (gray waveform) was amplified with a TET-labeled forward primer. Top waveform, the control and the known homozygous wild-type sample at identical mobilities. Bottom waveform, the known homozygous variant at a distinctly different mobility. The known heterozygous sample in the middle shows a broad peak encompassing the areas of both the wild-type and variant mobilities. The reverse strand is unlabeled and therefore not visualized on these electropherograms.

 
Samples were amplified in a 20-µl reaction consisting of 10 mM Tris-HCl, 40 mM NaCl, 1.5 mM MgCl2, 200 µM each dNTP, 0.5 µM each primer, and 0.25U Taq polymerase. The thermal cycling profile was 5-min initial denaturing at 95°C, 8 cycles of (20 s at 95°C, 20 s at 62°C, 40 s at 72°C, decreasing the annealing temperature 1° per cycle), 20 cycles of (20 s at 95°C, 20 s at 54°C, 40 s at 72°C), and a final 10 min extension at 72°C. Samples were prepared with loading buffer, denatured, and loaded on a 12-cm wtr Mutation Detection Enhancement gel (from FMC) as described in the PE Biosystems GeneScan Reference Guide section 7. The gel was run on a PE Biosystems 373 genotyper at 10 W for 9 h and analyzed with GeneScan and Genotyper software.

Statistical Methods.
APC B1822V genotype was classified as the homozygous wild type, heterozygote, or the homozygous variant. The APC genotypes were assessed in conjunction with demographic factors such as age at time of diagnosis, disease stage, tumor site within the colon, and survival status. Multiple logistic regression models were used to estimate associations using ORs and corresponding 95% CIs. Continuous diet and life-style factors were categorized into three groups of low, intermediate, and high, based on the sex-specific distributions in the control population. Nutrients were assessed as intake per 1000 kcal. Cigarette smoking was categorized as never having smoked cigarettes, smoking fewer than 20 cigarettes per day, and smoking 20 cigarettes per day or more. Regular use of aspirin and/or NSAIDs (combined and referred to as NSAIDs) and having a first-degree relative with colorectal cancer were categorized as either yes or no. Risk was assessed by examining the combined effects of B1822V genotype, diet, and life-style exposures, using as the referent category, those at greatest risk, e.g., high dietary fat and homozygote wild-type APC.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The B1822V allele frequency was 22.8% in the control population; the genotypes were in Hardy-Weinberg equilibrium. Homozygous-variant APC 1822 (valine/valine) individuals accounted for ~5.2% of the control population (Table 1)Citation . There were no statistically significant differences in the proportion of cases and controls with this genotype by sex or race, stage of tumor at diagnosis, tumor site within the colon, or the likelihood of dying up to 9 years after diagnosis (data not shown). The homozygous APC variant genotype did appear to have an association with age; cases diagnosed at an older age were statistically significantly less likely to have this genotype than age-matched controls.


View this table:
[in this window]
[in a new window]

  		Table 1 APC 1822 genotypes and study population characteristics

 
Assessment of dietary factors and APC 1822 genotypes, showed a consistent pattern of association with dietary fat variables (Table 2)Citation ; adjustment of each of the specific subtypes of fat for total fat did not alter these associations. Relative to homozygous wild-type individuals and a high-fat diet, those who were homozygous variant with a low-fat diet had a markedly lower colon cancer risk. This reduction in risk was not observed for low-fat diet among homozygous wild type or heterozygotes. Ways of assessing diet (categorized or continuous) or grouping genotypes (collapsing across wild type and heterozygotes or including all three genotypes) resulted in somewhat different Ps for interaction but did not alter any of the conclusions regarding total fat, saturated fat, unsaturated fat, polyunsaturated fat, or the mutagen index. Other dietary factors assessed, including total energy intake, protein, fiber, sucrose, calcium, carotenoids, folate, vitamin C, vitamin D, fruits, vegetables, and sugar, did not show similar differences in association by APC genotype (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 2 Associations between dietary intake and APC 1822 genotypes and risk of colon cancer

 
Assessment of other life-style factors in conjunction with APC 1822 genotype showed that engaging in vigorous physical activity and using NSAIDs were inversely associated with risk for all genotypes (Table 3)Citation . Similarly, for all APC genotypes, those with a low BMI were at lower risk of colon cancer than were those with a high BMI. However, those with a family history of colorectal cancer in a first-degree relative may have been at a slightly less elevated risk of colon cancer if they also carried the homozygous variant APC genotype.


View this table:
[in this window]
[in a new window]

  		Table 3 Associations between lifestyle factors and APC 1822 genotypes and risk of colon cancer

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Although acquired mutations in the APC gene are commonly observed in colon tumors, inherited mutations causing familial adenomatous polyposis are rare. However, it is possible that germ-line variants of the APC gene that result in amino acid changes may have functional significance, especially in the presence of diet, life-style, or other environmental exposures. In this study, we have characterized the most prevalent APC variant that has been reported to date (3) . The B1822V variant had an allele frequency of 22.8% in the predominately Caucasian control population of 1945 people. This compares to an allele frequency of 10% previously reported from a sample of 45 cases, race not reported (3) We observed that homozygous variant individuals were at slightly lower risk of developing colon cancer. We also found that individuals with the valine/valine substitution at codon 1822 were at statistically significantly lowered risk of colon cancer if they also ate a low-fat diet, a pattern not observed among homozygous wild-type or heterozygous individuals. These data support the hypothesis that dietary intake can interact with a nontruncating APC polymorphism to alter risk of cancer. Dietary fat has not been consistently associated with decreased risk of colon cancer in epidemiological studies; however, from these data, dietary fat appears to be important for a subset of the population.

In this study, we evaluated a variety of diet and life-style factors that have been reported as being associated with colon cancer. Consistent associations with the specific genotype were observed only for indicators of dietary fat intake. Given the consistency and specificity of this interaction, we believe that the homozygous variant may have functional significance. This interaction is not universal across other risk factors: many of the dietary variables are unassociated with risk in any genotypically defined subset, and some of the inverse associations (e.g., with NSAIDs and physical activity) are inversely associated with risk, irrespective of genotype.

At this point, we can only hypothesize as to how fat might work in conjunction with molecular variants of the APC gene. Several mechanisms have been proposed whereby dietary fat and its components are associated with cancer. Saturated fatty acids, such as butyric acid, have been shown to influence apoptosis (16) ; eicosanoids, which are hormone-like polyunsaturated fatty acids, have been shown to regulate cell proliferation and immune response (17) ; linoleic acid, a precursor to arachidonic acid, has been hypothesized to influence the neoplastic process through its role in the synthesis of prostaglandins and thromboxanes via cyclooxygenases (18) . Linoleic acid has been shown also to act synergistically with growth factors, such as epidermal growth factor, to stimulate tumor growth (19) . A role for DAG, produced by bacterial breakdown of fat, has been proposed: DAG is an intermediate in a variety of signaling pathways; and, plausibly, such pathways could be shortcircuited by DAG, generated in the lumen, and diffusing across cell membranes (20) .

The APC gene is thought to be multifunctional and has been referred to as a large housekeeping gene (2 , 21 , 22) . The protein is important in cell adhesion as well as in the Wg/wnt signaling pathway. It is involved in control of proliferation via ß catenin/Tcf and of mobility via interaction with the cytoskeleton. Although the functional significance of the 1822 substitution is uncertain at this time, the substitution changes the amino acid residue from a hydrophilic asparate to a hydrophobic valine residue. Codon 1822 is located between the fourth and fifth of the seven 20-amino-acid repeats involved in the binding and down-regulation of ß-catenin (22) . Specifically, it is 180 amino acids downstream of the fourth repeat and 26 amino acids upstream of the fifth (1) . Therefore, although this amino acid change is not conservative, there is no known consequence of an amino acid substitution at this location on ß-catenin regulation or any other known function of APC. However, it is certainly possible that future functional and/or structural analyses of APC may suggest such consequences.

Modifier genes, genes that may modify the phenotypic manifestation of a mutated gene without necessarily having an effect on the wild type, have been identified for APC. One such gene, Mom1 (modifier of min; min is the mouse APC homologue), in the mouse (or the human homologue) encodes for the secretory type II phospholipase A2 (Pla2s) gene (23, 24, 25) . Mom1 in the mouse modifies the phenotype associated with a mutated APC gene, resulting in fewer intestinal tumors (23) . Pla2s is a phospholipase involved in generating arachidonic acid, which, in turn, is necessary for the synthesis of prostaglandins (24) . These observations may lend some support to our finding that dietary fat interacts with this APC 1822 variant. If this particular gene-gene interaction is relevant to our findings, then it may be worth asking whether there is a protective phenotype associated with Mom1, even in the absence of a truncating polymorphism of APC.

There are several strengths of this study. Because of the large sample size, we have been able to assess interactions between diet and life-style factors in conjunction with a variant APC genotype. The dietary questionnaire used was comprehensive and, because of its link to the Nutrition Coordinating Center (NCC) nutrient database, has extensive information on dietary fat. On the other hand, we are limited by the fact that both cases and controls were asked to recall their diets from the past, and thus differential recall is possible. Finally, it is appropriate to note that the findings reported here may be the result of chance and have no biological significance. They, therefore, need to be replicated in other populations with adequate sample sizes to evaluate the association.

Although associations between dietary fat and colon cancer are generally lacking at the population level, this study provides evidence of a small subset of the population who are at decreased risk of colon cancer as a result of consuming a low-fat diet. These findings, if replicated, may provide additional important clues to the etiology of colon cancer and to the functional role of the APC gene.


   ACKNOWLEDGMENTS
 
We thank Sandra Edwards, Karen Curtin, KheNi Ma, and Melanie Nichols for the data collection and analyses and Drs. Bette Caan and Kristin Anderson for their contribution to data collection.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grant CA48998 (to M. L. S.) and Grant CA59045 (to J. D. P.). Case identification and verification were supported by the Utah Cancer Registry, the Northern California Cancer Registry, and the Sacramento Tumor Registry. Back

2 To whom requests for reprints should be addressed, at Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue, North, MP 900, Seattle, WA 98109-1024. Back

3 The abbreviations used are: APC, adenomatous polyposis coli; OR, odds ratio; CI, confidence interval; NSAID, nonsteroidal anti-inflammatory drug; BMI, body mass index; DAG, diacylglycerol. Back

Received 6/15/00. Accepted 11/29/00.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Groden J., Thliveris A., Samowitz W., Carlson M., Gelbert L., Albertsen H., Joslyn G., Stevens J., Spirio L., Robertson M., Sargeant L., Krapcho K., Wolff E., Burt R., Hughes J. P., Warrington J., McPherson J., Wasmuth J., LePaslier D., Abderrahim H., Cohen D., Leppert M., White R. Identification and characterization of the familial adenomatous polyposis coli gene.. Cell, 66: 589-600, 1991.
  2. Gryfe R., Swallow C., Bapat B., Redston M., Gallinger S., Couture J. Molecular biology of colorectal cancer.. Curr. Probl. Cancer, 21: 238-299, 1997.
  3. Powell S. M., Zilz N., Beazer-Barclay Y., Bryan T. M., Hamilton S. R., Thibodeau S. N., Vogelstein B., Kinzler K. APC mutations occur early during colorectal tumorigenesis.. Nature (Lond.), 359: 235-237, 1992.
  4. Olshwang S., Laurent-Puig L., Groden J., White R., Thomas G. Germ-line mutations in the first 14 exons of the adenomatous polyposis coli (APC) gene.. Am. J. Hum. Genet., 52: 273-279, 1993.
  5. Bussey, H. J. Familial Polyposis Coli. Baltimore: John Hopkins University Press, 1975.
  6. Groden J., Gelbert L., Thliveris A., Nelson L., Robertson M., Joslyn G., Samowitz W., Maruyama M., Utsunomiya J., Baba S., Nakamura Y. Mutational analysis of patients with adenomatous polyposis: identical inactivating mutations in unrelated individuals.. Am. J. Hum. Genet., 52: 263-272, 1993.
  7. Nagase H., Miyoshi Y., Horii A., Aoki T., Petersen G. M., Vogelstein B., Maher E., Ogawa M., Maruyama M., Spirio L., Carlson M., Burt R., Leppert M., White R. Screening for germ-line mutations in familial adenomatous polyposis patients: 61 new patients and a summary of 150 unrelated patients.. Hum. Mutat., 1: 467-473, 1992.
  8. Percy, C., Van Holten, V., and Muir, C. International Classification of Diseases for Oncology, 2nd Ed. Geneva: WHO, 1990.
  9. Slattery M. L., Edwards S. L., Caan B. J., Kerber R. A., Potter J. D. Response rates among control subjects in case-control studies.. Ann. Epidemiol., 5: 245-249, 1995.
  10. Slattery M. L., Potter J. D., Caan B. J., Coates A., Edwards S., Ma K. N., Berry T. D. Energy balance and colon cancer—beyond physical activity.. Cancer Res., 57: 75-80, 1997.
  11. Edwards S., Slattery M. L., Mori M., Berry T. D., Caan B. J., Palmer P., Potter J. D. Objective system for interviewer performance evaluation for use in epidemiologic studies.. Am. J. Epidemiol., 140: 1020-1028, 1994.
  12. Slattery M. L., Caan B. J., Duncan D., Berry T. D., Coates A., Kerber R. A computerized diet history questionnaire for epidemiologic studies.. J. Am. Diet. Assoc., 94: 761-766, 1994.
  13. Slattery M. L., Boucher K. M., Caan B. J., Potter J. D., Ma K. N. Eating patterns and colon cancer.. Am. J. Epidemiol., 148: 4-16, 1998.
  14. Slattery M. L., Jacobs D. R., Jr. Assessment of ability to recall physical activity of several years ago.. Ann. Epidemiol., 5: 292-296, 1995.
  15. Orita M., Suzuki Y., Sekiya T., Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction.. Genomics, 5: 874-879, 1989.
  16. Hague A., Elder D. J. E., Hicks D. J., Paraskeva C. Apoptosis in colorectal tumor cells: induction by the short chain fatty acids butyrate, proprionate, and acetate and by the bile salt deoxycholate.. Int. J. Cancer, 60: 400-406, 1995.
  17. Sears B. Essential fatty acids, eicosanoids, and cancer. Quillin P. Williams R. M. eds. . Adjuvant Nutrition in Cancer Treatment, : 267-282, Cancer Treatment and Research Foundation Arlington Heights, IL 1993.
  18. Hunt S. M., Groff J. L. Advanced Nutrition in Human Metabolism.St West Publishing Co., pp. 97–128 Paul 1990.
  19. Hsiao W. L. W., Pai H. L. H., Matsui M. S., Weinstein I. B. Effects of specific fatty acids on cell transformation induced by an activated c-H-ras oncogene.. Oncogene, 5: 417-421, 1994.
  20. Morotomi M., Guillem J. G., LoGerfo P., Weinstein I. B. Production of diacylglycerol, an activator of protein kinase C, by human intestinal microflora.. Cancer Res., 50: 3595-3599, 1990.
  21. Polakis P. Mutations in the APC gene and their implications for protein structure and function.. Curr. Opin. Genet. Dev., 5: 66-71, 1995.
  22. Polakis P. The adenomatous polyposis coli (APC) tumor suppressor.. Biochim. Biophys. Acta, 1332: F127-F147, 1997.
  23. Dietrich W. F., Lander E. S., Smith J. S., Moser A. R., Gould K. A., Luongo C., Borenstein N., Dove W. Genetic identification of Mom-1, a major modifier locus affecting Min-induced intestinal neoplasia in the mouse.. Cell, 75: 631-639, 1993.
  24. MacPhee M., Chepenik K. P., Liddell R. A., Nelson K. K., Siracusa L. D., Buchberg A. M. The secretory phospholipase A2 gene is a candidate for the Mom-1 locus, a major modifier of ApcMin-induced intestinal neoplasia.. Cell, 81: 957-966, 1995.
  25. Dragani T. A., Manenti G. Mom-1 leads the pack.. Nat. Genet., 17: 7-8, 1997.



This article has been cited by other articles:


Home page
 J Med MicrobiolHome page
K.-H. Hung, J.-J. Wu, H.-B. Yang, L.-J. Su, and B.-S. Sheu
Host Wnt/{beta}-catenin pathway triggered by Helicobacter pylori correlates with regression of gastric intestinal metaplasia after H. pylori eradication
J. Med. Microbiol., May 1, 2009; 58(5): 567 - 576.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
E. Theodoratou, H. Campbell, A. Tenesa, G. McNeill, R. Cetnarskyj, R. A. Barnetson, M. E. Porteous, M. G. Dunlop, and S. M. Farrington
Modification of the associations between lifestyle, dietary factors and colorectal cancer risk by APC variants
Carcinogenesis, September 1, 2008; 29(9): 1774 - 1780.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. B. Egan, E. T. Jacobs, M. E. Martinez, E. W. Gerner, P. W. Jurutka, and P. A. Thompson
Presence of a TA Haplotype in the APC Gene Containing the Common 1822 Polymorphism and Colorectal Adenoma
Cancer Res., July 15, 2008; 68(14): 6006 - 6013.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Clin. Nutr.Home page
C. S Guerreiro, M. L Cravo, M. Brito, P. M Vidal, P. O Fidalgo, and C. N Leitao
The D1822V APC polymorphism interacts with fat, calcium, and fiber intakes in modulating the risk of colorectal cancer in Portuguese persons
Am. J. Clinical Nutrition, June 1, 2007; 85(6): 1592 - 1597.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
G. J. Tranah, E. Giovannucci, J. Ma, C. Fuchs, and D. J. Hunter
APC Asp1822Val and Gly2502Ser Polymorphisms and Risk of Colorectal Cancer and Adenoma
Cancer Epidemiol. Biomarkers Prev., April 1, 2005; 14(4): 863 - 870.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Slattery, M. L.
Right arrow Articles by Potter, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slattery, M. L.
Right arrow Articles by Potter, J. D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online