Cancer Research Audrey Hepburn  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tateno, M.
Right arrow Articles by Hayashizaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tateno, M.
Right arrow Articles by Hayashizaki, Y.
[Cancer Research 61, 1144-1153, February 1, 2001]
© 2001 American Association for Cancer Research


Regular Articles

Identification of a Novel Member of the Snail/Gfi-1 Repressor Family, mlt 1, Which Is Methylated and Silenced in Liver Tumors of SV40 T Antigen Transgenic Mice1

Minako Tateno, Yoshifumi Fukunishi, Sei Komatsu, Yasushi Okazaki, Jun Kawai, Kazuhiro Shibata, Masayoshi Itoh, Masami Muramatsu, William A. Held and Yoshihide Hayashizaki2

CREST, Japan Science and Technology Corporation and Genome Science Laboratory, RIKEN Tsukuba Institute, Ibaraki 305-0074, Japan; Genome Exploration Research Group, RIKEN Genomic Sciences Center, Yokohama 230-0045, Japan [M. T., Y. F., S. K., Y. O., J. K., K. S., M. I., M. M., Y. H.]; Cooperative Graduate School of Medicine, University of Tsukuba, Ibaraki 305-0006, Japan [S. K., Y. H.]; and Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, New York 14263 [W. A. H.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA methylation is the only known mechanism for an epigenetic genomic DNA modification that is capable of altering gene expression. A recent study reveals that the pattern of CpG island methylation is largely characteristic of tumor type, suggesting that distinct sets of genes are inactivated by methylation during development of each tumor type. We compared previously the methylation status between normal liver and liver tumors in SV40 T/t antigen transgenic mice (MT-D2 mice) using Restriction Landmark Genomic Scanning for Methylation (RLGS-M) and identified several loci/spots that appeared to be methylated frequently in liver tumors. One of these spots, B236, identified a locus on chromosome 12 (D12Ncvs7) syntenic with human 14q12–q21 that is frequently lost in certain human cancers. Shotgun sequencing of a bacterial artificial chromosome clone containing this spot/locus was performed to identify genes within this region. The Genescan program predicted an open reading frame of a novel, intron-less gene adjacent to the B236 spot that encodes a putative 493-amino acid protein containing the SNAG repressor motif in the NH2-terminal region and five C2H2-type zinc finger motifs in the COOH-terminal half. This putative gene, methylated in liver tumor (mlt 1), is a novel member of the SNAG transcriptional repressor family with 43% amino acid identity to insulinoma-associated protein 1. An open reading frame encoding a protein quite similar to mouse mlt 1 (56% amino acid identity) was located in the syntenic region of the human genome, indicating that mlt 1 is evolutionarily conserved in human. Northern blot analysis revealed that mlt 1 is normally expressed in brain, spleen, stomach, and liver. However, mlt 1 expression was silenced in the liver tumors of MT-D2 mice. The putative promoter region of mlt 1 is unmethylated in normal tissues but methylated in all liver tumors from 11 MT-D2 mice. We also found that mlt 1 was methylated and not expressed in N18TG-2 cells, a mouse neuroblastoma cell line. Treatment of N18TG-2 cells with a demethylating agent, 5-aza-deoxycytidine, resulted in an expression of mlt 1, indicating that the repression of mlt 1 is attributable to methylation. Thus, mlt 1 is a novel target gene that is silenced by methylation during liver tumorigenesis initiated by SV40 T antigen.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cancer is a result of aberrant alterations in the pattern of gene expression. Cancer cells express genes that are not expressed in normal cells or cease expression of genes essential for maintaining a normal cell cycle. Inactivation of genes is frequently caused by mutation or deletion; however, it is becoming apparent that the gene inactivation in cancer cells is also achieved by epigenetic alterations such as DNA methylation (1 , 2) . Methylation in the promoter, enhancer, and/or early coding region can alter the recognition of the double helix by the transcriptional machinery and frequently results in an inactivation of gene expression (3) . DNA methyltransferase, which catalyzes the transfer of a methyl group from S-adenosyl-methionine to the 5' position on cytosines, is frequently up-regulated in many cancer cells (4) . Inhibition of DNA methyltransferase by either 5-aza-deoxycytidine or antisense oligonucleotides can arrest the growth of several lines of tumors in vivo and in vitro (5 , 6) and can inhibit the transformation of BALB/c 3T3 cells by SV40 T antigen (7) . These studies indicate that DNA methylation contributes to a development of many cancers, probably through the repression of tumor suppressor and tumor-associated genes.

The human genome is estimated to include about 45,000 CpG islands that are frequently associated with gene promoters (8 , 9) . Most of CpG islands are not methylated in normal cells but some regions are specifically methylated during oncogenesis, frequently resulting in a repression of neighboring genes (1) . A global study of the methylation status of CpG islands in human primary tumors revealed that the pattern of aberrant methylation is not random but has a tendency to be specific to each tumor type (9) . These findings strongly suggest that a certain set of genes, which may be cell type specific, is inactivated by methylation during tumor progression.

The MT-D2 C57BL/6J transgenic mouse, which contains an SV40 T/t antigen gene driven by a mouse major urinary protein enhancer/promoter (10) , is an animal model for studying development of liver tumors. These mice specifically express the SV40 T antigen in liver and develop liver tumors that have been characterized as hepatocellular carcinomas and adenomas (11) . We previously made interspecific F1 hybrids between the MT-D2 C57BL/6J mice and Mus spretus and analyzed the liver tumors by RLGS-M3 (12 , 13) . RLGS-M is a high-throughput genome scanning method that can detect differences in methylation status at certain restriction enzyme sites (14) . Because the NotI sites are found frequently in CpG islands, we compared the methylation status of NotI sites between the DNAs extracted from normal liver and liver tumors of the MT-D2B6/S F1 mice and identified 14 loci/spots that appeared to be frequently methylated in liver tumors (15) . Three of the loci corresponded to the promoters or exons of p16/INK4a, {alpha}4 integrin, and mac25/insulin-like growth factor binding protein-7 (Igfpb7), all reported to be associated with tumorigenesis. p16/INK4a is a tumor suppressor gene known to be silenced by methylation in many cancer cells (16) . {alpha}4 integrin is required to inhibit detachment and metastasis in melanomas, sarcomas, and lymphomas (17) . mac25/Igfpb7, which is down-regulated in human breast carcinomas (18) , has been reported to be methylated and repressed in the liver tumors (19) . These results indicate the great utility of the RLGS-M method for identifying a regulatory region that becomes methylated during tumorigenesis and may alter the expression of neighboring tumor suppressor or tumor-associated gene.

In this report, we performed a shotgun sequence analysis of the BAC clone covering the B236 RLGS-M spot region. The B236 spot was mapped to D12Ncvs7 on chromosome 12 in mouse genome (13) , a region that is syntenic with 14q12–q21 in the human genome according to the chromosome committee report released from the Jackson laboratory in 1999.4 Human 14q11–q13 is a hotspot for breakpoints in chromosomal translocations and deletions in many acute lymphoblastic leukemias and lymphoproliferative disorders according to the report of the cancer chromosome aberration project of NCI.5 Frequent chromosomal abnormalities in this region are reported for several types of tumors including liver tumors and neuroblastomas (20 , 21) , implying the presence of tumor suppressor-like gene or genes in this region. From the analysis of the working draft of this BAC clone, we identified a novel gene named mlt 1 located 64 bp downstream from the B236 spot region. The B236 spot itself was involved in the putative promoter region of mlt 1, which was commonly methylated in the liver tumors of the F1 mice. The silencing of mlt 1 expression was frequently associated with this methylation event. From these and other data, the inactivation of mlt 1 by methylation may be a common alteration associated with liver tumorigenesis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transgenic Line and Isolation of Liver Tumors.
The MT-D2 transgenic line, which contains the SV40 early region under control of mouse major urinary protein enhancer/promoter, has been described previously (10 , 11) . Female MT-D2 C57BL/6J mice were mated with Mus spretus males to obtain MT-D2B6/S F1 progeny, which develop multiple liver tumors. F1 mice were sacrificed at the age of 44–48 weeks to obtain liver tumors. Tumor samples were dissected and separated from adjacent non-tumor tissue. Normal liver samples were obtained from 44–48-week-old C57BL/6J and M. spretus mice.

Cell Culture.
N18TG-2 cells were grown in DMEM containing 5% (v/v) FCS at 37°C in an atmosphere of 10% CO2. For demethylation experiments, cells were cultured in 9-cm dishes in the presence of 1.6 µM of 5-aza-deoxycytidine (Sigma), and the medium was exchanged every 3 days.

Primer Sequences.
Sequences of the primers used in this paper are summarized: T3 primer, AATTAACCCTCACTAAAGGG; T7 primer, GTAATACGACTCACTATAGGGC; SK primer, CGCTCTAGAACTAGTGGATC; M13-20 primer, GTAAAACGACGGCCAGT; mlt 1-U1 primer, GGCTGGTGGCTCTGGCTCCC; mlt 1-U3 primer, GAAACCTAAGGCGGTGAGAAG; mlt 1-L1 primer, CCCCACTCGGCGTCGTCCTG; mlt 1-L2 primer, AGAGGGAAGGTATGGGAAGGAA; mlt 1-L3 primer, GACAATACGGGCACACGAAGAC; GAPDH-U1 primer, AGCCAAACGGGTCATCATCT; GAPDH-L1 primer, GCCTGCTTCACCACCTTCTT; p16-U1 primer, TTGGGCGGGCACTGAATC; p16-L1 primer, AAAGAGTTCGGGGCGTTGG; S/T-U1 primer, GCCGAGCCTTTCAGAGCGACG; and S/T-L1 primer, GCTATTTCTGTTTTGAGGCTGTGG.

Screening of the BAC Library.
The preparation of HDRFs from the C57BL/6J mouse BAC library (RPCI23) were described previously (22 , 23) . The BAC clones contain an average insert size of 197 kb, and each filter contains 18,600 different BAC clones in duplicate. Thus, a single filter of HDRF covers approximately one haploid mouse genome (3 x 109 bp). The hybridization probe was prepared by PCR using RLGS-M spot clone as a template. The 20-µl PCR reaction contained 10 pg of spot clone DNA, 150 nM T3 and T7 primers, 80 µM each of dATP, dGTP, and dTTP, and 30 µM dCTP ([{alpha}-32P]dCTP; 60–180 Ci of 6000 Ci/mmol; Amersham Life Technology) and 1 unit of Ex Taq polymerase (TaKaRa) in the supplied buffer. The PCR was performed by the following two-cycle schedule; the first cycle (denaturing step at 96°C for 20 s, annealing at 62°C for 20 s, extension at 72°C for 30 s) repeated for 5 cycles and then performed the second cycle (96°C for 20 s, 60°C for 20 s, and 72°C for 30 s) for 30 cycles. We screened three sheets of HDRFs by colony hybridization and obtained two BAC clones with 176- and 185-kb inserts. Both clones were further examined by PCR and found to contain the B236 spot region. We chose the BAC clone with smaller insert of 176 kb (ID: 063B11) for a shotgun sequencing analysis.

Making Shotgun Libraries.
Five µg of CsCl/EtBr centrifugation-purified BAC DNA was randomly sheared into 1.0–2.5-kb fragments using the Hydroshear (GeneMachines) at speed code 3. After repairing the DNA ends with 12.5 units of T4 DNA polymerase (New England BioLabs) and 15 units of T4 polynucleotide kinase (New England BioLabs) using the conditions recommended by the manufacturer, the DNA was subjected to electrophoresis (0.8% agarose gel in 1x TAE buffer), and the region containing 1.5–2.0-kb fragments were excised from the gel. The DNA fragments were eluted and cloned into the EcoRV (New England BioLabs)-CIAP (Boehringer Mannheim)-treated pBluescriptII KS+ vector (Stratagene) and transformed into DH5a Escherichia coli. Transformants were picked and arrayed into 384-well multititer plates.

Sequencing and Assembling.
We prepared sequence templates by cell-PCR using bacterial glycerol stock as a template. A 20-µl PCR reaction contained about 0.2 µl of glycerol stock of each shotgun clone, 100 nM SK primer and M13-20 primer, 40 µM of each deoxynucleotide triphosphates, and 1 unit of TaKaRa Taq polymerase (TaKaRa, Japan) in the supplied buffer. The PCR conditions were the following: 96°C for 40 s, 55°C for 40 s, and 72°C for 2 min, repeated for 30 cycles with a final extension of 1 min at 72°C. Four µl of PCR reaction were treated with 0.19 unit of shrimp alkaline phosphatase (Amersham Life Technology) and 0.12 unit of exonuclease I (Epicentre) at 37°C for 30 min to inactivate the residual deoxynucleotide triphosphates and primers. After the incubation at 80°C for 15 min to inactivate the enzymes, the reaction was directly used for sequencing by Riken Integrated Sequencing Analysis system using either SK primer or M13-20 primer as described previously (24 , 25) . Base calls were performed with Phred program version 980904a, and the sequence traces were assembled into contigs using Phrap program version 0.990319 (26 , 27) .

BLAST Search Analysis.
After masking repetitive sequences using RepeatMasker (version 042199), BLAST search (28) was performed for all 61 contigs. From the GenBank mouse EST database, 604 EST hits were obtained with significant similarities. From the GenBank nonredundant nucleotide database, three significant hits were obtained; mouse IkB{alpha} (U36277), rat tulip 1 (tuberin-like protein 1; AF041106), and mouse aldolase A (J05517).6 We examined the Mouse Genome Database at the Jackson laboratory and found that the IkB{alpha} gene has been mapped to chromosome 12 near the C1–C3 cytogenic markers by fluorescence in situ hybridization analysis (29) , which is close to the D12Ncversus7 locus. Therefore, the IkB{alpha} gene is found within this BAC region. A sequence similar to the '3 UTR of rat tulip 1 was found at the end of the contig 58 (data not shown). Using the 5' rapid amplification of cDNA ends method, we cloned a 2.2-kb cDNA clone, which showed 97% identity to the rat tulip 1 cDNA. Thus, we submitted this 2.2-kb sequence as a mouse homologue of tulip 1 cDNA (AB032400). The aldolase A ORF found in this BAC clone did not contain any introns. Because the mouse aldolase A gene has been identified as an intron-containing gene (J05517) and is known to have a number of pseudogenes, the ORF we found may be one of the pseudogenes.

ORF Prediction.
The ORF prediction in the working draft was performed using the Genescan program (30 , 31) . The putative CDS of human mlt 1 was found in a human chromosome 14 sequence (NT_003188), which had been described as a predicted coding region in the feature table (Accession No. 9247253). During the review process, we found two EST clones, derived from eye (AW533302) and corpus striatum (AW529782) of rat, that closely matched the mouse mlt 1 sequence. We also found three human EST clones, two derived from retina (AA058826 and AA046477) and one from brain (AW148539), that matched human mlt 1 almost completely. All of these sequences were recently submitted to the GenBank database and support our results of ORF prediction.

Southern Hybridization with Genomic DNA.
Fifteen µg of genomic DNA from C57BL/6J mice were digested with 165 units of either EcoRI, EcoRV, HindIII, or PstI restriction enzyme (Nippongene, Japan) at 37°C overnight, and the DNA was separated by 0.8% agarose gel electrophoresis. Transfer and hybridization were performed using established methods (31) . The probe was generated by PCR using mlt 1-U1 and mlt 1-L2 primers and s-t clone 1 DNA as a template (Fig. 1)Citation . The PCR conditions are described in "Screening of the BAC library" (see above), except for changing the annealing temperature from 62–60°C to 64–62°C. The blots were autoradiographed and analyzed with a BAS 2000 image analyzer (Fuji, Japan).



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Identification of the mlt 1 ORF adjacent to the B236 RLGS-M spot region. The BAC clone containing the B236 spot was shotgun sequenced and assembled into contigs. Among the 61 contigs, the B236 spot was found on contig 58. By a PCR using S/T-U1 and S/T-L1 primers, a 4209-bp S/T-1 clone covering the whole mlt 1 ORF was isolated. The mlt 1 CDS starts at 64 bp downstream from the NotI site of the B236 spot, and the B236 spot region itself is involved in the putative promoter region. A CpG island, a cap signal for transcription initiation (cap), and a poly-adenylation signal (AATAAA) were found from -180 to +234, from -44 to -37, and from +2540 to +2545, respectively, when the position of the first A of mlt 1 CDS is defined as +1. Arrows, PCR primer sites. Restriction enzyme sites: E, EcoRI; N, NotI; P, PstI; B, BssHII.

 
Northern Hybridization.
Five µg of poly(A) RNA were prepared from 13 different tissues from male C57BL/6J mice. The RNAs were electrophoresed and blotted onto a nylon membrane using established methods (31) . mlt 1 probe was generated by PCR using the same condition as in the Southern hybridization analysis (see above). For the preparation of GAPDH control probe, GAPDH-U1 and GAPDH-L1 primers were used.

Analysis of Methylation Status Using PCR.
Genomic DNAs were prepared from tumors from MT-D2 C57BL/6J x M. spretus F1 mice (tumor DNA) and normal liver of C57BL/6J mice (normal DNA). To reduce the viscosity of the DNA solution, the genomic DNA was treated with the HydroShear at speed code 20 for 15 cycles to be randomly sheared to 200–600-kb fragments. Five hundred ng of sheared DNA were treated with either 1 unit of NotI (Nippongene) or BssHII (Nippongene) in 10 µl of the supplied buffer at 37°C for 3 h. As a non-enzyme-treated sample, the same volume of 100 µg/ml BSA in 50% glycerol was added instead of each enzyme. Then, the reaction was diluted with 10 µl of TE buffer and incubated at 65°C for 15 min to inactivate the restriction enzyme. PCR was performed using 1.6 µl (40 ng of DNA) of each heat-inactivated reaction as a template in the presence of mlt 1-U1, mlt 1-L1, p16-U1, and p16-L1 primers. The condition of PCR was the same as that used for the probe preparation in the genomic Southern analysis. The p16 primers were used for comparing the DNA amounts among samples; this primer pair amplifies a 164-bp of a part of p16/INK4a ORF, which does not contain any NotI and BssHII sites. After PCR, all of the reactions were electrophoresed onto 5% polyacrylamide gel and analyzed with a BAS 2000 image analyzer (Fuji). To confirm the complete digestion of DNA by NotI and BssHII, 5 ng of pBlueScriptIISK(+) were added to each 500 ng of sheared DNA before NotI or BssHII treatment. PCR was also performed using SK and M13-20 primers to amplify the multiple cloning site of pBlueScriptIISK(+) (containing NotI and BssHII sites), but no product was obtained (data not shown). Thus, the digestion condition we used was appropriate, and the DNA was completely digested by NotI or BssHII enzyme if it was not methylated.

RT-PCR.
As a normal sample, poly(A) RNA was prepared from the liver of 42-week-old M. spretus and C57BL/6J mice and 6-week-old MT-D2 C57BL/6J x M. spretus F1 mice, which do not have any tumors at this age. For tumor samples, poly(A) RNA was prepared from tumors from the livers of 42–48-week-old MT-D2 C57BL/6J x M. spretus F1 mice. The RNA was treated with the RQ1 RNase-free DNase (Promega) at 37°C for 1 h to digest contaminating DNA and then extracted with phenol/chloroform and recovered by an ethanol precipitation. One µg of poly(A) RNA from each sample was reverse-transcribed with SuperScriptII (Life Technologies, Inc.) using the mlt 1-L3 primer and the GAPDH-L1 primer in the supplied buffer. One-twentieth of the first-stranded cDNA was then used for PCR as a template with the following four primers; mlt 1-U3, mlt 1-L2, GAPDH-U1, and GAPDH–L1 primers. The combination of mlt 1-U3 and mlt 1-L2 primers is expected to produce 608 bp of PCR product (Fig. 1)Citation . The combination of GAPDH-U1 and GAPDH-L1 primers is expected to produce 450 bp of PCR product derived from the GAPDH mRNA. As a negative control, 100 ng of the DNase-treated poly(A) RNA were subjected to PCR using the same four primers, but no product was obtained (data not shown), indicating that the PCR products described in Figs. 5Citation and 7Citation are derived from mRNA.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. The promoter region of mlt 1 is unmethylated in normal liver (a) but methylated in the liver tumors of the MT-D2 C57BL/6J x M. spretus F1 mice (b). a, 15 µg of DNA from normal C57BL/6J liver were treated with either EcoRI, EcoRI/NotI, or BssHII restriction enzymes and blotted. Southern hybridization was performed using the probe prepared by PCR with mlt 1-U1 and mlt 1-L2 primers. The EcoRI fragment was further cleaved by NotI, indicating that the NotI site was not methylated. The BssHII digestion resulted in three fragments, all of which were expected sizes from the sequence information described in Fig. 1Citation . Thus, these BssHII sites are also unmethylated in normal liver. b, DNA was extracted from normal liver of C57BL/6J mice and from liver tumors of MT-D2 C57BL/6J x M. spretus F1 mice and digested with or without BssHII restriction enzyme. An aliquot of the DNA was used for PCR with mlt 1-U1 and mlt 1-L1 primers. In normal liver, 456 bp of mlt 1 upstream region containing NotI and BssHII sites were not amplified when the DNA was treated with BssHII, because these BssHII sites were unmethylated. On the other hand, the 456-bp region was amplified in all 11 liver tumors, regardless of the BssHII treatment, indicating that these BssHII sites were commonly methylated in liver tumors. The other is a result of using a control primer pair to normalize the DNA amounts among samples, which is designed for amplifying the 164 bp in p16/INK4a gene without any NotI and BssHII sites. As a positive control and to normalize the DNA amounts, a 164-bp region from the p16/INK4a, which does not contain NotI and BssHII sites, was amplified.

 


View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Treatment of a neuroblastoma cell line with a demethylating agent (5-aza-deoxycytidine) results in re-expression and demethylation of mlt 1. a, mlt 1 expression after the treatment with 5-aza-deoxycytidine. N18TG-2 neuroblastoma cells were cultured in the presence or absence of 1.6 µM of 5-aza-deoxycytidine. RNAs were extracted after 4 and 7 days (with the reagent) and 7 days (without the reagent), and mlt 1 expression was examined by RT-PCR as described in "Materials and Methods." As a control for mlt 1-expressing tissue, RNA was extracted from a normal brain of C57BL/6J mouse. To normalize the RNA amounts among samples, RT-PCR was performed using GAPDH-U1/L1 primers. b, mlt 1 was demethylated after the treatment with 5-aza-deoxycytidine. DNA was extracted from 7-day culture with or without 5-aza-deoxycytidine. The methylation status of the NotI and BssHII sites in the promoter and early region of mlt 1 was examined in the same manner described in "Materials and Methods." DNA from a brain of C57BL/6J mouse was also examined as a control. These results indicate that mlt 1 is normally methylated in the N18TG-2 cells but demethylated after the treatment with 5-aza-deoxycytidine.

 

    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prediction of a Novel ORF Just Downstream of the B236 RLGS-M Spot Region.
The B236 spot is one of the more interesting of the 11 uncharacterized RLGS-M spots that were cloned, because this spot has been mapped to a putative tumor suppressor locus, D12Ncvs7, taking into consideration the syntenic map between the mouse and human genome. To identify the gene located nearest to this spot, a shotgun sequence analysis of the BAC clone covering this region was performed. A C57BL/6J mouse BAC library was screened using the B236 spot sequence as a probe and identified a BAC clone with a 176-kb insert that contained the B236 sequence. A shotgun library from this BAC was sequenced nearly 6-fold. Finally, 61 contigs derived from the BAC insert were obtained by assembling the sequence traces combined with a gap-filling procedure. The B236 spot sequence was found on contig 58, which consisted of 8393 bp covering 2.3 kb upstream and 5.7 kb downstream of the B236 spot (Fig. 1)Citation . The BLAST search analysis of contig 58 resulted in no significant hit to cDNA/EST sequences around the spot (see "BLAST Search Analysis and ORF Prediction" in "Materials and Methods"). However, the Genescan program predicted a 2.6-kb ORF just downstream of the B236 spot region with quite a high probability. This putative CDS started at 64 bp downstream of the NotI cleavage site of the B236 spot and consisted of 1482 bp of one continuous coding region. A consensus sequence for poly-adenylation was found from 1059 to 1064 bp downstream of this putative CDS, suggesting that it was followed by 1064-bp of 3' UTR. A cap signal for transcription initiation was found from 37 to 44 bp upstream of the putative CDS. However, primer extension experiments, generally required to determine the start of the 5' UTR, were not performed. A CG-rich CpG island sequence extended from approximately the middle of the putative promoter to the early region of the putative CDS. The B236 spot region was associated with the putative promoter region.

The Predicted ORF Encodes a 2.9-kb Transcript, mlt 1, Which Is Normally Expressed in Brain, Spleen, Stomach, and Liver.
To examine whether this putative ORF actually encodes a transcript, a Northern hybridization analysis was performed using the CDS sequence as a probe. Poly(A) RNAs were prepared from 13 different tissues from adult C57BL/6J mice. As shown in Fig. 2Citation , a 2.9-kb transcript was detected at high levels in brain and at significant levels in spleen, stomach, and liver. We designated this transcript mlt 1. The nucleotide sequence and deduced amino acid sequence of mlt 1 are described in Fig. 3Citation .



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Expression of mlt 1 in normal tissues. Five µg of poly(A) RNA from 13 different tissues from adult C57BL/6J mice were analyzed by Northern blot. The probe was prepared by PCR using mlt 1-U3 and mlt 1-L2 primers shown in Fig. 1Citation . The 2.9-kb mlt 1 transcript was detected in brain, spleen, stomach, and liver. As a control, the same membrane was hybridized with the GAPDH probe after stripping.

 


View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. The nucleotide and deduced amino acid sequence of mlt 1. The position of the first nucleotide of mlt 1 CDS is defined as +1. In the upstream region of mlt 1 CDS, the consensus sequences for TATA box, cap signal for transcription initiation (cap), Kozak consensus sequence for translation initiation, and Sp1 and GATA-1 transcriptional factors are shown by name adjacent to the corresponding underlined sequences. The B236 RLGS-M spot region extends from the PstI site (443) to the NotI site (-64) marked by asterisks (*). Putative mlt 1 protein has the SNAG motif (MPRSFLV) in NH2-terminal and five C2H2-type zinc finger motifs (C-X (2,4)-C-X (3)-[LIVMFYWC]-X (8)-H-X (3, 5)-H) (Z1-Z5), which are indicated by boxed amino acid sequences.

 
mlt 1 Is a Single-Copy Gene in the Mouse Genome.
Because mlt 1 was identified as an intronless gene, we could not exclude a possibility that this ORF we found near the B236 spot is a pseudogene and that the actual mlt 1 gene is located at another region in mouse genome. Therefore, we examined the copy number of this gene in mouse genome by Southern hybridization. DNA from C57BL/6J mice was digested with one of four different restriction enzymes, and Southern hybridization was performed using the probe prepared in the same manner as the Northern hybridization analysis. The result in Fig. 4Citation shows that only one fragment was detected in each treatment, indicating that mlt 1 is a single-copy gene and exists as a unique coding sequence in C57BL/6J mouse genome.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. mlt 1 is a single-copy gene. Fifteen µg of DNA from C57BL/6J mice were treated with either EcoRI, EcoRV, HindIII, or PstI restriction enzyme and blotted. Southern hybridization was performed using the probe prepared by PCR with mlt 1-U3 and mlt 1-L2 primers. The result indicates that mlt 1 is a single-copy gene with a unique sequence.

 
The Putative Promoter Region of mlt 1 Is Unmethylated in Normal Liver but Commonly Methylated in Liver Tumors from the SV40 T Antigen Transgenic Mice.
The RLGS-M profile of B236 spot implied that the NotI site is unmethylated in normal liver but might be methylated in the liver tumors of the MT-D2 C57BL/6J x M. spretus F1 mice (15) . This NotI site is involved in the CpG island that covers the putative promoter of mlt 1 (Fig. 1)Citation . When the position of the first A of mlt 1 CDS is defined as +1, the NotI cleavage site is located at -64 bp. In addition to this NotI site, we found two cleavage sites of another methylation-sensitive restriction enzyme, BssHII, at +53 and +55 bp. Thus, we examined the methylation status of these three methylation-sensitive enzyme sites between normal liver and liver tumors.

For the analysis of normal liver, we extracted DNA from the liver of 44–48-week-old C57BL/6J mice. The DNA was digested with either EcoRI, a combination of EcoRI/NotI, or BssHII, and analyzed by Southern hybridization using a part of mlt 1 CDS as a probe. The results are shown in Fig. 5aCitation ; the DNA fragment treated with EcoRl/NotI is smaller that the EcoRI fragment, indicating that the NotI site in this EcoRI/NotI fragment was unmethylated and cleaved by NotI enzyme. The BssHII treatment resulted in three fragments that approximately match the expected sizes (873, 730, and 580 bp) from the sequence information described in Fig. 1Citation . Therefore, the NotI and two BssHII sites are not methylated in normal liver DNA.

For the analysis of liver tumors, we used PCR because we did not have enough tumor DNA for Southern analysis. The DNAs were extracted from tumors in the livers of 11 F1 mice at the age of 44–48 weeks. At this age, the F1 mice have multiple tumors in the liver, which were characterized as hepatocellular carcinomas and adenomas (11) . Each DNA was completely digested with either NotI or BssHII enzyme and used for PCR as a template. PCR primers were designed to amplify 456 bp in mlt 1 ORF (-274 to +181), which contained the NotI and two BssHII sites. Similar results were obtained with both NotI and BssHII treatment, although only the result of BssHII treatment is shown in Fig. 5bCitation . In normal liver DNA, the 456-bp region of mlt 1 ORF was not amplified when the DNA was treated with BssHII, indicating that the DNA was not methylated at one or both BssHII sites and therefore cleaved by BssHII enzyme. This result is consistent with that of the Southern hybridization analysis in Fig. 5aCitation . On the other hand, in tumor DNAs, the 456-bp region was amplified in all 11 samples, regardless of the BssHII treatment, indicating that both BssHII sites were methylated. We directly sequenced the 456-bp PCR products obtained in the BssHII and NotI treatments and confirmed that they were derived from the mlt 1 ORF without any mutations in both restriction enzyme sites (data not shown). Considering these data, the NotI site in the putative promoter and two BssHII sites just downstream from the initiation site of mlt 1 CDS are commonly methylated during tumorigenesis in the F1 mice. This methylation is thought to be a tumor-specific aberrant event, because no methylation was observed in normal tissues such as brain (strong expression of mlt 1), kidney, and lung (no expression of mlt 1) by the same PCR analysis (data not shown).

mlt 1 Is Silenced in the Liver Tumors.
Methylation in the promoter and/or the early exon can cause a repression of gene transcription (32) . The tumor-specific methylation pattern of mlt 1 suggests the possibility that mlt 1 transcription is repressed in the liver tumors. To examine this possibility, we investigated the transcript level of mlt 1 in normal liver and liver tumors using RT-PCR. The results in Fig. 6Citation indicate that the transcript levels of mlt 1 are greatly reduced in the tumors compared with the level in the normal livers. We cloned the 605 bp of PCR product from the normal liver, sequenced, and confirmed that it completely matches the expected sequence of mlt 1 CDS (Accession No. AB032418). To determine whether there was contamination of mouse genomic DNA in RNA samples, we performed PCR without the reverse transcriptase reaction and found that nothing was amplified (data not shown).



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. The expression of mlt 1 is silenced in liver tumors in MT-D2 C57BL/6J x M. spretus F1 mice. Poly(A) RNA was extracted from normal liver of M. spretus, C57BL/6J, and preneoplastic liver (prior to tumor formation) from young MT-D2 C57BL/6J x M. spretus F1 mice (N) and from tumors from the livers of MT-D2 C57BL/6J x M. spretus F1 mice (T). RT-PCR analysis was performed as described in "Materials and Methods." The data indicate that the expression of mlt 1 is commonly diminished in the liver tumors. To determine whether there was contamination of mouse genomic DNA in RNA samples, we performed PCR using 20 times the normal amount of the RNA samples without reverse transcriptase reaction and found that nothing was amplified (data not shown). Therefore, the PCR products observed here were derived from the mlt 1 mRNA. As a control, we examined the expression of the GAPDH gene in each sample.

 
mlt 1 Is Also Methylated and Silenced in a Neuroblastoma Cell Line but Reactivated by Demethylation with 5-Aza-deoxycytidine.
To investigate the possibility that the silencing of mlt 1 was attributable to methylation, neuronal tumor-derived cell lines were screened for mlt 1 expression because mlt 1 expression was highest in the brain. The results shown in Fig. 7aCitation indicate that N18TG-2 does not express significant levels of mlt 1 mRNA. Next, the methylation status of mlt 1 in this neuroblastoma cell line was examined using the same PCR analysis used previously. As shown in Fig. 7Citation b, the 456-bp PCR products were obtained regardless of NotI or BssHII treatment, indicating that the NotI and BssHII sites are methylated in the N18TG-2 cells, as well as in the liver tumors from the F1 mice. Direct sequencing of these PCR products indicated that there was no mutation or deletion of the NotI and BssHII sites (data not shown).

If the silencing of mlt 1 was attributable to methylation, the treatment of the cell line with a demethylating agent should restore expression. The N18TG-2 cells were cultured in the absence or presence of 5-aza-deoxycytidine, a demethylating agent, for 4 or 7 days, and then RNAs were extracted. The results of RT-PCR are shown in the Fig. 7Citation a, indicating that mlt 1 began to be transcribed after 4 day of treatment, and was significantly transcribed after 7 days of culture with 5-aza-deoxycytidine. By 7 days after the addition of 5-aza-deoxycytidine, the NotI and BssHII sites were demethylated (Fig. 7b)Citation . These data indicate that the silencing of mlt 1 in the N18TG-2 cell line and the liver tumors may be attributable to DNA methylation.

mlt 1 Encodes a Putative Zinc Finger Protein with a SNAG Repressor Motif, a Novel Member of the SNAG Repressor Family.
mlt 1 CDS encodes a putative protein consisting of 493 amino acids (Fig. 3)Citation . The Blocks searcher7 found five putative C2H2-type zinc finger motifs in COOH-terminal half of the mlt 1 protein (Fig. 3)Citation . PSORTII (33) and SOSUI (34) programs predicted that mlt 1 protein is localized in the nucleus with 90 and 95% probability, respectively. These results strongly suggest that mlt 1 encodes a nuclear DNA binding protein. By searching the GenBank databases, we found only two proteins with significant similarity to mlt 1: the mouse and human IA-1 proteins, which had 43 and 41% identity to mlt 1 protein, respectively. IA-1 was cloned from human insulinoma, and its expression has only been found in insulinomas and small cell lung carcinomas (35) . IA-1 also has five C2H2-type zinc finger motifs in the COOH-terminal half, and those motif regions are highly conserved between IA-1 and mlt 1 proteins. Comparing each 21 amino acids in a zinc finger motif, 18 (85.7%), 20 (95.2%), 16 (76.2%), 8 (38.1%), and 19 (90.5%) amino acids are identical in the 1st, 2nd, 3rd, 4th, and 5th zinc finger motifs between mouse IA-1 and mlt 1 proteins, respectively. The NH2-terminal regions are also well conserved between IA-1 and mlt 1; however, the other regions are not conserved. IA-1 is described as a member of the SNAG (Snail/Gfi 1) transcriptional repressor family, which is characterized by four to six C2H2-type zinc finger motifs in the COOH-terminal half and seven amino acid SNAG repressor motif in the NH2 terminal (Fig. 8A)Citation . Thus, mlt 1 is thought to be a novel member of the SNAG repressor family.



View larger version (92K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. mlt 1 is a novel member of the SNAG transcriptional repressor family. A, a schematic structure of the SNAG family. The SNAG members have four to six C2H2-type zinc finger motifs in the COOH-terminal half. Four zinc finger regions numbered 2, 3, 4, and 5 are relatively conserved among all members. B, the multiple alignment of the NH2-terminal SNAG motif and four zinc finger motifs conserved in all SNAG members (zinc finger regions numbered as Z2–Z5 in A). The conserved residues are pictured with white on black lettering. C, the phylogenetic tree of the SNAG family. This result indicates that the SNAG family has developed into three subfamilies.

 
Human Homologue of mlt 1 Is Predicted in the Syntenic Region of the Human Genome.
After we had identified the mlt 1 ORF in the mouse genome, the human genome sequence covering 14q12–q21 that is syntenic with mouse D12Ncvs7 was submitted to the National Center for Biotechnology Information database. BLAST search analysis with the mlt 1 CDS resulted in a single hit with high homology in a chromosome 14 sequence (NT_003188). The Genescan program predicted a 2.9-kb intron-less ORF between D14S925 and D14S888 sequence-tagged site markers within 14q12–q21. This putative ORF has many similarities to the mouse mlt 1 ORF and encodes a putative 566 amino acid protein with a SNAG motif in the NH2-terminal region and five putative C2H2-type zinc finger motifs in the COOH-terminal half. The amino acid identity between human and mouse mlt 1 proteins is 56% for the full-length proteins and 100% in the SNAG and zinc finger motifs, except for only one amino acid substitution in the 1st and 3rd zinc finger motifs (Fig. 8B)Citation . A CpG island and B236 spot-like sequence are also found within a putative promoter region just upstream of the human CDS (data not shown). All of these similarities strongly suggest that this predicted ORF encodes a human homologue of mlt 1.

The SNAG Family Has Developed into Three Subfamilies, and mlt 1 and IA-1 Constitute a Subfamily.
By searching all available protein databases, we found 20 proteins that have both the SNAG motif in the NH2-terminal and C2H2-type zinc finger motifs. Those proteins are categorized into three groups; Snail/Slug proteins, Gfi1 (growth factor independence 1) proteins, and IA-1 proteins (Fig. 8B)Citation . Snail/Slug proteins are transcriptional repressors essential for a development of several organs (see "Discussions"). Gfi 1 proteins are also transcriptional repressors categorized into proto-oncogenes. Fig. 8BCitation shows the multiple alignment of all 20 proteins and mlt 1 proteins in the NH2-terminal region and four zinc finger motifs that are relatively conserved in all members. The result shows that the zinc finger motifs are highly conserved within each group but different among these three groups. Although the 4th residue in the SNAG motif of IA-1 and mlt 1 is different from that of other members, the alteration in this position is shown to have no effect on the repressor activity of Gfi 1 (36) .

We analyzed all of these proteins with the PHYLIP program, which estimates the evolutionary relationship among proteins by calculating the rate of amino acid substitution (37) . The resulting phylogenetic tree is shown in Fig. 8Citation C, indicating that the SNAG family has developed into three subfamilies; (a) Snail/Slug proteins; (b) Gfi 1 and Gfi 1-related proteins; and (c) Mlt 1 and IA-1 proteins.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
mlt 1 Is a New Target Gene That Is Silenced by Methylation during Tumorigenesis Triggered by the SV40 T Antigen.
DNA methylation clearly has an important role in oncogenesis (1) . However, investigations have, for the most part, focused on known tumor suppressor genes or a relatively limited portion of the genome. Very recently, Costello et al. (9) examined the methylation status of the same set of 1184 CpG islands in each of 98 primary human tumors and matched normal DNA samples using RLGS-M. They found that most of the CpG islands were not methylated in any tumors, but on the average, ~1.35% of them were methylated in certain tumors. The patterns of aberrant methylation appear to be shared within the same tumor type, although some methylation sites are shared among different tumor types. In addition, their results indicated that methylation, in some cases, influenced the expression of neighboring genes. Thus, methylation of specific subsets of CpG islands within a tumor type may significantly impact on gene expression patterns, probably to inactivate a specific set of genes. A recent study of colorectal cancers complements this and proposes a novel oncogenic pathway called a CIMP (38) . Colorectal tumors with a CIMP+ phenotype were characterized by a high degree of concordant methylation of CpG islands causing a repression of a tumor suppressor gene, p16/INK4a, and several tumor-associated genes, such as a mismatch repair gene hMLH1 and an angiogenesis inhibitor THBS1. Because the genetic alterations were largely different between the tumors with or without CIMP, colorectal cancers are now thought to develop through one of two distinct pathways: one that is accompanied by repression of a certain set of genes by methylation, and the other that is not. Taken together, these results indicate that there are several pathways toward cancer, and in some, methylation plays a critical role.

In the MT-D2 and interspecific F1 mice, the tumorigenesis is triggered by the SV40 T antigen. The SV40 T antigen can mediate transformation by inactivating p53, the retinoblastoma (pRB) tumor suppressor gene, and perhaps other tumor suppressor genes (39) . Inactivation of p53 protein by SV40 T antigen (40) and an activation of c-H-ras oncogene by mutation (41) were reported in liver tumors that developed in another SV40 T antigen-transgenic mouse. Our previous work using RLGS-M revealed that 14 loci were frequently lost in the liver tumors of the F1 mice, probably because of methylation (15) . Three of these loci were characterized and found to be located in the promoter or exon of p16/INK4a, {alpha}4 integrin (15) , and mac25/Igfpb7 (19) . All three genes are known to have roles in tumorigenesis. p16/INK4a is a well-known tumor suppressor gene. {alpha}4 integrin is required for anchorage of cancer cells to a primary tumor and inhibits metastasis in melanomas, sarcomas, and lymphomas (17) . mac25/Igfpb7, which is also down-regulated in human breast carcinomas (18) , is thought to modulate the binding of insulin-like growth factors to their receptors, leading to the inhibition of mitogenic activity. Considering these data, it appears possible that the methylation of some of the 14 RLGS loci may contribute to the cancer phenotype. mlt 1 is a putative tumor suppressor locus that can be silenced by methylation and is the fourth target of the 14 RLGS loci to be more fully characterized. The complete methylation and repression of mlt 1 in all tumors from F1 mice imply a strong selection for mlt 1 inactivation for liver tumorigenesis. mlt 1 is normally expressed in brain at relatively high levels (Fig. 2)Citation but is not detected in the N18TG neuroblastoma cell line (Fig. 7a)Citation . Silencing of mlt 1 in this neuroblastoma cell line is also attributable to methylation (Fig. 7b)Citation . After treating cells with 5 aza-deoxycytidine, a demethylating agent, the N18TG neuroblastoma cells can respond to differentiation agents, such as retinoic acid, and differentiate into nonmitotic, cholinergic neuron-like cells (42) . These data raise the possibility that mlt 1 may function to suppress growth and promote differentiation of neuronal cells, although expression of many other genes may also be affected by treatment with 5-aza-deoxycytidine. Additional experiments are necessary to more clearly define the role of mlt 1 in growth suppression and tumorigenesis.

mlt 1 Is a Novel Member of the SNAG Transcriptional Repressor Family, But Only mlt 1 May Work in a Growth-suppressive or Tumor-suppressive Process.
mlt 1 encodes a putative transcriptional repressor protein that belongs to the SNAG repressor family. The SNAG family was first proposed by Grimes et al. from the analysis of Gfi 1 proto-oncogene, which was identified as a target of provirus integration in retrovirus-induced T-cell lymphoma lines selected for IL-2 independence (43 , 44) . Gfi 1 encodes a transcriptional repressor that can repress an apoptosis-promoting protein Bax and inhibit G1 arrest and apoptosis induced by IL-2 deprivation in IL-2-dependent T-cell lines (45) . Gfi 1B, a Gfi 1-related protein, is also a transcriptional repressor that can repress the cyclin-dependent kinase inhibitor p21WAF1 to block IL-6-induced G1 arrest in IL-6-dependent B-cell lines (46) . A deletion and mutation study revealed that the NH2-terminal region was required for the repressor activity of Gfi 1 and Gfi 1B, in addition to the zinc finger regions that determine the binding specificity to DNA (36 , 38) . This NH2-terminal motif was denoted the SNAG motif because it was found in all Snail/Slug zinc finger proteins in vertebrates. Slug proteins are thought to be produced by duplication of snail genes (47) , and both Snail/Slug proteins work as transcriptional repressors in several developmental processes, such as a boundary formation between mesoderm and neuroectoderm and a formation of neural tube (48) . The seven-amino acid SNAG motif in Snail/Slug proteins is also essential for the maximum repressor activity (49) .

The phylogenetic tree analysis indicates that the SNAG family has branched and developed into three subfamilies: Snail/Slug proteins; Gfi 1 proteins; and the third group consisting of two intronless genes, mlt 1 and IA-1 (50) . The first two groups have developed specified functions in restricted cell types as described above. The third group also shows restricted pattern of expression, but their function has not yet been characterized. IA-1 is not known to be expressed in normal cells but is induced during the development of insulinomas and certain neuroendocrine neoplasms, such as small cell lung carcinomas. Therefore, IA-1 is used for a diagnostic marker for human lung carcinomas (51) . Considering these data, IA-1 is thought to function in an oncogenic process in pancreas ß-cells and lung epithelial cells, like Gfi 1 and Gfi 1-B in thymocytes and myelomonocytes, respectively. In contrast to the tumor-specific expression pattern of IA-1, mlt 1 is down-regulated during tumor progression in the SV40 T antigen-initiated liver tumors and in a neuroblastoma cell line. These results suggest that mlt 1 functions as a growth suppressor or tumor suppressor in liver cells and possibly in certain neurons. Because the zinc finger region usually determines the specificity for DNA binding, the quite high similarity in zinc finger regions between mlt 1 and IA-1 proteins suggests that these two proteins can recognize and bind to a similar DNA sequence. It is unknown whether both proteins regulate the transcription of the same genes or their targets are different. It is possible that other proteins bind to mlt 1 and/or IA-1 and modulate their DNA recognition function differently. The phylogenetic tree analysis indicates that mlt 1 and IA-1 proteins had branched a very long time before mouse and human branched and implies that the proteins have developed a different function independently during their long time of evolution.


    ACKNOWLEDGMENTS
 
We thank Dr. Piero Carninci, Yuko Shibata, and Norihito Hayatsu for the cDNA cloning; Drs. Toshinori Endo and Masaru Tateno for the evolutionary tree analysis and helpful discussions; Mari Ito, Hideaki Konno, Kenjiro Sato, Toshiyuki Shiraki, Yumi Kojima, Ayako Hara, Shiro Fukuda, Noriko Kikuchi, and Saiko Akahira for technical assistance; and Chie Owa for secretarial assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This study was supported by Special Coordination Funds and a Research Grant for the RIKEN Genome Exploration Research Project, CREST (Core Research for Evolutional Science and Technology), and ACT-JST (Research and Development for Applying Advanced Computational Science and Technology) of Japan Science and Technology Corporation. There are funds from the Science Technology Agency of the Japanese Government (to Y. H.). This work was also supported by a Grant-in-Aid for Scientific Research on Priority Areas and Human Genome Program from the Ministry of Education, Science and Culture, and by a Grant-in-Aid for a Second Term Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health and Welfare (to Y. H.). This work was also supported by National Cancer Institute Grant CA68612 (to W. A. H.) and by National Cancer Institute Core Grant 5P30CA16056 (to Roswell Park Cancer Institute). Back

2 To whom requests for reprints should be addressed, at Genome Exploration Research Group, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045, Japan. Phone: 81-45-503-9222; Fax: 81-45-503-9216; E-mail: rgscerg{at}gsc.riken.go.jp Back

3 The abbreviations used are: RLGS-M, restriction landmark genomic scanning for methylation; mlt 1, methylated in liver cancer; HDRF, high-density-replica filter; UTR, untranslated region; EST, expressed sequence tag; BAC, bacterial artificial chromosome; ORF, open reading frame; IA-1, insulinoma-associated protein 1; CDS, coding sequence; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcription-PCR; CIMP, CpG island methylator phenotype; IL, interleukin; SNAG, Snail/Gfi-1. Back

4 Internet address: http://www.informatics.jax.org/mlr/searches/index.cgi. Back

5 Internet address: http://www.ncbi.nlm.nih.gov/CCAP/mitelsum.cgi. Back

6 Sequence data for the mlt 1, mouse tulip 1, and the B236 BAC working draft have been deposited with the DDBJ Data Library under Accession Nos. AB032418, AB032400, and AP000491, respectively. Back

7 E-mail address: blocks@blocks.fhcrc.org. Back

Received 4/21/00. Accepted 11/21/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia.. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
  2. McBurney M. W. Gene silencing in the development of cancer.. Exp. Cell Res., 248: 25-29, 1998.
  3. Becker, P. B., Ruppert, S., and Schutz, G. Cell, 51: 435–443, 1987.
  4. Wu J., Issa J. P., Herman J., Bassett D. E., Jr., Nelkin B. D., Baylin S. B. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells. Proc. Natl. Acad. Sci. USA, 90: 8891-8895, 1993.[Abstract/Free Full Text]
  5. Laird P. W., Jackson-Grusby L., Fazeli A., Dickinson S. L., Jung W. E., Li E., Weinberg R. A., Jaenisch R. Suppression of intestinal neoplasia by DNA hypomethylation.. Cell, 81: 197-205, 1995.[Medline]
  6. Ramchandani S., MacLeod A. R., Pinard M., von Hofe E., Szyf M. Inhibition of tumorigenesis by a cytosine-DNA, methyltransferase, antisense oligodeoxynucleotide.. Proc. Natl. Acad. Sci. USA, 94: 684-689, 1997.[Abstract/Free Full Text]
  7. Slack A., Cervoni N., Pinard M., Syzf M. DNA methyltransferase is a downstream effector of cellular transformation triggered by simian virus 40 large T antigen.. J. Biol. Chem., 15: 10105-10112, 1999.
  8. Antequera F., Bird A. Number of CpG islands and genes in human and mouse.. Proc. Natl. Acad. Sci. USA, 90: 11995-11999, 1993.[Abstract/Free Full Text]
  9. Costello J. F., Fruhwald M. C., Smiraglia D. J., Rush L. J., Robertson G. P., Gao X., Wright F. A., Feramisco J. D., Peltomaki P., Lang J. C., Schuller D. E., Yu L., Bloomfield C. D., Caligiuri M. A., Yates A., Nishikawa R., Huang H. S., Petrelli N. J., Zhang X., O’Dorisio M. S., Held W. A., Cavenee W. K., Plass C. Aberrant CpG-island methylation has non-random and tumor-type-specific pattern.. Nat. Genet., 24: 132-138, 2000.[Medline]
  10. Held W. A., Mullins J. J., Kuhn N. J., Gallagher J. F., Gu G. D., Gross K. W. T antigen expression and tumorigenesis in transgenic mice containing a mouse major urinary protein/SV40 T antigen hybrid gene.. EMBO J., 8: 183-191, 1989.[Medline]
  11. Schirmacher P., Held W. A., Yang D., Biempica L., Rogler C. E. Selective amplification of periportal transitional cells precedes formation of hepatocellular carcinoma in SV40 large T Ag transgenic mice.. Am. J. Pathol., 139: 231-241, 1991.[Abstract]
  12. Ohsumi T., Okazaki Y., Okuizumi H., Shibata K., Hanami T., Mizuno Y., Takahara T., Sasaki N., Ueda M., Muramatsu M., Kerns K. A., Chapman V. M., Held W. A., Hayashizaki Y. Loss of heterozygosity in chromosome 1, 5, 7 and 13 in mouse hepatoma detected by systematic genome-wide scanning using RLGS genetic ma. p. Biochem. Biophys. Res. Commun., 212: 632-639, 1995.
  13. Okuizumi H., Okazaki Y., Ohsumi T., Hanami T., Mizuno Y., Muramatsu M., Hayashizaki Y., Plass C., Chapmen V. M. A single gel analysis of 575 dominant and codominant restriction landmark genomic scanning loci in mice interspecific backcross progeny.. Electrophoresis, 16: 253-260, 1995.[Medline]
  14. Hatada I., Hayashizaki Y., Hirotsune S., Komatsubara H., Mukai T. A genomic scanning method for higher organisms using restriction sites as landmarks.. Proc. Natl. Acad. Sci. USA, 88: 9523-9527, 1991.[Abstract/Free Full Text]
  15. Akama T. O., Okazaki Y., Ito M., Okuizumi H., Konno H., Muramatsu M., Plass C., Held W. A., Hayashizaki Y. Restriction landmark genomic scanning (RLGS-M)-based genome-wide scanning of mouse liver tumors for alterations in DNA methylation status.. Cancer Res., 57: 3294-3299, 1997.[Abstract/Free Full Text]
  16. Merlo A., Herman J. G., Mao L., Lee D. J., Gabrielson E., Burger P. C., Baylin S. B., Sidransky D. 5' CpG island methylation is associated with transcriptional silencing of the tumor suppressor p16/CDKN2/MTS1 in human cancers.. Nat. Med., 1: 686-692, 1995.[Medline]
  17. Holzmann B., Gosslar U., Bittner M. {alpha}4 integrins and tumor metastasis.. Curr. Top Microbiol. Immunol., 231: 125-141, 1998.[Medline]
  18. Burge C. B., Karlin S. Finding the genes in genomic DNA.. Curr. Opin. Struct. Biol., 8: 346-354, 1998.[Medline]
  19. Komatsu S., Okazaki Y., Tateno M., Kawai J., Konno H., Kusakabe M., Yoshiki A., Muramatsu M., Held W. A., Hayashizaki Y. Methylation and downregulated expression of mac25/insulin-like growth factor binding protein-7 is associated with liver tumorigenesis in SV40T/t antigen transgenic mice, screened by restriction landmark genomic scanning for methylation (RLGS-M).. Biochem. Biophys. Res. Commun., 267: 109-117, 2000.[Medline]
  20. Parada L. A., Hallen M., Tranberg K. G., Hagerstrand I., Bondeson L., Mitelman F., Johansson B. Frequent rearrangements of chromosomes 1, 7, and 8 in primary liver cancer.. Genes Chromosomes, 1: 26-35, 1998.
  21. Theobald M., Christiansen H., Schmidt A., Melekian B., Wolkewitz N., Christriansen N. M., Brinkschmidt C., Berthold F., Lampert F. Sublocalization of putative tumor suppressor gene loci on chromosome arm 14q in neuroblastoma.. Genes Chromosomes Cancer, 26: 40-46, 1999.[Medline]
  22. Tateno M., Hayashizaki Y. Construction of large-insert BAC library from C57BL/6J mouse.. Bioimages, 6: 117-125, 1999.
  23. Osoegawa K., Tateno M., Woon P. Y., Frengen E., Mammoser A. G., Catanese J. J., Hayashizaki Y., de Jong P. J. Bacterial artificial chromosome libraries for mouse sequencing and functional analysis.. Genome Res., 10: 116-128, 2000.[Abstract/Free Full Text]
  24. Hayashizaki, Y., Okazaki, Y., Kawai, J., Carninci, P., Shibata, K., Kawahire, S., Izawa, M., Shibata, Y., Watahiki, M., Yoneda, Y., Tanaka, T., Matsuura, S., and Muramatsu, M. Full-length mouse cDNA analysis by automated fluorescent 384 capillary sequencer system (RISA: Riken Integrated Sequence Analysis System). The Institute for Genomic Research Presents the 10th International Genome Sequencing and Analysis Conference, Miami, USA, September 17–20, 1998.
  25. Shibata, K., Nagaoka, S., Sasaki, N., Muramatsu, M., Hayashizaki, Y., Nakamura, S., Harada, A., Hazama, M., Nishine, T., Ikegami, T., Kashiwagi, K., Yamamoto, R., Matsumoto, H., Sakaguchi, S., Fujiwake, H., Inoue, K., and Togawa, Y. Development of the 384 multi-capillary sequencing system. The 21th Society of Molecular Biology in Japan, Yokohama, Japan, December 16–19, 1998.
  26. Ewing B., Hillier L., Wendl M. C., Green P. Base-calling of automated sequencer traces using Phred.. I. Accuracy assessment. Genome Res., 8: 175-185, 1998.[Abstract/Free Full Text]
  27. Ewing B., Green P. Base-calling of automated sequencer traces using Phred.. II. Error probabilities. Genome Res., 8: 186-194, 1998.[Abstract/Free Full Text]
  28. Altshul S. F., Gish W., Miller W., Myers E. W., Lipman D. J. Basic local alignment search tool.. J. Mol. Biol., 215: 403-410, 1990.[Medline]
  29. Rupec R. A., Poujol D., Grosgeorge J., Carle G. F., Livolsi A., Peyron J. F., Schmid R. M., Baeuerle P. A., Messer G. Structural analysis, expression, and chromosomal localization of the mouse I{kappa}B{alpha} gene.. Immunogenetics, 49: 395-403, 1999.[Medline]
  30. Burge C. B., Karline S. Prediction of complete gene structures in human genomic DNA.. J. Mol. Biol., 268: 78-94, 1997.[Medline]
  31. Sambrook J., Fritsch E., Maniatis T. Molecular Cloning: A Laboratory ManualEd Cold Spring Harbor Laboratory Press 2. Plainview, NY 1989.
  32. Kass S. U., Pruss D., Wolffe A. P. How does DNA methylation repress transcription?. Trends Genet., 13: 444-449, 1997.[Medline]
  33. Horton P., Nakai K. Better prediction of protein cellular localization sites with the k nearest neighbors classifier. Ismb., 5: 147-152, 1997.
  34. Hirokawa T., Boon-Chieng S., Mitaku S. SOSUI: classification and secondary structure prediction system for membrane proteins.. Bioinformatics, 14: 378-379, 1998.[Abstract/Free Full Text]
  35. Goto Y., de Silva M. G., Toscani A., Prabhakar B. S., Notkins A. L., Lan M. S. A novel human insulinoma-associated cDNA, IA-1, encodes a protein with "zinc-finger" DNA-binding motifs.. J. Biol. Chem., 267: 15252-15257, 1992.[Abstract/Free Full Text]
  36. Grimes H. L., Chan T. O., Zweidler-McKay P. A., Tong B., Tsichlis P. N. The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin-2 withdrawal.. Mol. Cell. Biol., 16: 6263-6272, 1996.[Abstract]
  37. Retief J. D. Phylogenic analysis using PHYLIP.. Methods Mol Biol., 132: 243-258, 2000.[Medline]
  38. Toyota M., Ohe-Toyota M., Ahuja N., Issa J. P. Distinct genetic profiles in colorectal tumors with or without the CpG island methylation phenotype.. Proc. Natl. Acad. Sci. USA, 97: 710-715, 2000.[Abstract/Free Full Text]
  39. DeCaprio J. A. The Role of the J domain of SV40 large T in cellular transformation.. Biologicals, 27: 23-28, 1999.[Medline]
  40. Sepulveda A. R., Finegold M. J., Smith B., Slagle B. L., DeMayo J. L., Shen R. F., Woo S. L., Butel J. S. Development of a transgenic mouse system for the analysis of stages in liver carcinogenesis using tissue-specific expression of SV40 large T-antigen controlled by regulatory elements of the human {alpha}-1-antitrypsin gene.. Cancer Res., 49: 6108-6117, 1989.[Abstract/Free Full Text]
  41. Lee G. H., Li H., Ohtake K., Nomura K., Hino O., Furuta Y., Aizawa S., Kitagawa T. Detection of activated c-H-ras oncogene in hepatocellular carcinomas developing in transgenic mice harboring albumin promoter-regulated simian virus 40 gene.. Carcinogenesis (Lond.), 11: 1145-1148, 1990.[Abstract/Free Full Text]
  42. Okuse K., Mizuno N., Matsuoka I., Kurihara K. Induction of cholinergic and adrenergic differentiation in N-18 cells by differentiation agents and DNA demethylating agents.. Brain Res., 626: 225-233, 1993.[Medline]
  43. Gilks C. B., Bear S. E., Grimes H. L., Tsichlis P. N. Progression of interleukin-2 (IL-2)-dependent rat T cell lymphoma lines to IL-2-independent growth following activation of a gene (Gfi 1) encoding a novel zinc finger protein.. Mol. Cell. Biol., 13: 1759-1768, 1993.[Abstract/Free Full Text]
  44. Zweidler-McKay P. A., Grimes H. L., Flubacher M. M., Tsichlis P. N. Gfi-1 encodes a nuclear zinc finger protein that binds DNA and functions as a transcriptional repressor.. Mol. Cell. Biol., 16: 4024-4034, 1996.[Abstract]
  45. Grimes H. L., Gilks C. B., Chan T. O., Porter S., Tsichlis P. N. The Gfi-1 protoocoprotein represses Bax expression and inhibits T-cell death.. Proc. Natl. Acad. Sci. USA, 93: 14569-14573, 1996.[Abstract/Free Full Text]
  46. Tong B., Grimes H. L., Yang T., Bear S., Qin Z., Du K., El-Deiry W. S., Tsichlis P. N. The Gfi-1B proto-oncoprotein represses p21WAF1 and inhibition.. Mol. Cell. Biol., 18: 2462-2473, 1998.[Abstract/Free Full Text]
  47. Sefton M., Sanchez S., Nieto M. A. Conserved and divergent roles for members of the snail family of transcription factors in the chick and mouse embryo.. Development (Camb.), 125: 3111-3121, 1998.[Abstract]
  48. Stegmann K., Boecker J., Kosman C., Ermert A., Kunz J., Koch M. C. Human transcription factor SLUG: mutation analysis in patients with neural tube defects and identification of a missense mutation (D119E) in the Slug subfamily-defining region.. Mutat. Res., 406: 63-69, 1999.[Medline]
  49. Nakayama H., Scott I. C., Cross J. C. The transition to endoreduplication in trophoblast giant cells is regulated by the mSNA zinc finger transcription factor.. Dev. Biol., 199: 150-163, 1998.[Medline]
  50. Lan M. S., Li Q., Lu J., Modi W. S., Notkins A. L. Genomic organization, 5'-upstream sequence, and chromosomal location of an insulinoma-associated intronless gene, IA-1.. J. Biol. Chem., 269: 14170-14174, 1994.[Abstract/Free Full Text]
  51. Lan M. S., Russell E. K., Lu J., Johnson B. E., Notkins A. L. IA-1, a new marker for neuroendocrine differentiation in human lung cancer cell lines.. Cancer Res., 53: 4169-4171, 1993.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum Mol GenetHome page
M. Tateno, H. Sadakata, M. Tanaka, S. Itohara, R.-M. Shin, M. Miura, M. Masuda, T. Aosaki, M. Urushitani, H. Misawa, et al.
Calcium-permeable AMPA receptors promote misfolding of mutant SOD1 protein and development of amyotrophic lateral sclerosis in a transgenic mouse model
Hum. Mol. Genet., October 1, 2004; 13(19): 2183 - 2196.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Yu, R. F. Pretot, T. R. Burglin, and P. W. Sternberg
Distinct roles of transcription factors EGL-46 and DAF-19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior
Development, November 1, 2003; 130(21): 5217 - 5227.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Uhlmann-Schiffler, S. Seinsoth, and H. Stahl
Preformed hexamers of SV40 T antigen are active in RNA and origin-DNA unwinding
Nucleic Acids Res., July 15, 2002; 30(14): 3192 - 3201.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. B. Breslin, M. Zhu, A. L. Notkins, and M. S. Lan
Neuroendocrine differentiation factor, IA-1, is a transcriptional repressor and contains a specific DNA-binding domain: identification of consensus IA-1 binding sequence
Nucleic Acids Res., February 15, 2002; 30(4): 1038 - 1045.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tateno, M.
Right arrow Articles by Hayashizaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tateno, M.
Right arrow Articles by Hayashizaki, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online