
[Cancer Research 61, 873-879, February 1, 2001]
© 2001 American Association for Cancer Research
Cytotoxic T Lymphocytes from HLA-A2.1 Transgenic Mice Define a Potential Human Epitope from Simian Virus 40 Large T Antigen1
Todd D. Schell,
John D. Lippolis and
Satvir S. Tevethia2
Department of Microbiology and Immunology, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033 [T. D. S., S. S. T.], and Yerkes Regional Primate Center at Emory University, Atlanta, Georgia 30329 [J. D. L.]
 |
ABSTRACT
|
|---|
Recent reports have documented the presence of SV40 large T
antigen (T ag) sequences in a number of human tumors and raised the
question of whether cellular immunity to T ag is elicited in such
individuals. We used HLA-A2.1 transgenic C57BL/6 mice to identify an
epitope from T ag recognized by CD8+ CTLs when
presented by this human MHC class I molecule. Immunization of
HLA-A2.1 transgenic mice with syngeneic T ag-transformed cells resulted
in the induction of HLA-A2.1-restricted, T ag-specific CTLs. The target
epitope, residues 281289 (KCDDVLLLL) of T ag, was identified using
both cell lines expressing T ag variants and synthetic T ag peptides.
Peptide 281-289 bound stably to HLA-A2.1 molecules, effectively
sensitized target cells for CTL lysis, and was efficiently processed
from endogenous T ag in cells of both mouse and human origin. CTLs were
not cross-reactive on the human BK or JC virus T ags. Thus, SV40
T ag 281289 represents a potential specific CTL recognition epitope
for humans.
 |
Introduction
|
|---|
The SV40 T
ag3
is a promiscuous oncogene, capable of transforming a large variety of
cell types in vitro and in vivo. In rodent
models, T ag is capable of inducing a wide variety of tumors dependent
on the promoters that are used to drive T ag expression, including
ependymomas, choroid plexus tumors, mesotheliomas, sarcomas,
osteosarcomas, and some lymphomas (1
, 2)
. A number of
recent reports have indicated that SV40-specific coding sequences and T
ag protein can be detected in some human tumors, such as choroid plexus
papillomas and ependymomas of early childhood as well as mesotheliomas
and osteosarcomas (Refs. 3
and 4
and reviewed
in Ref. 1
). A role for T ag in the progression of human
tumors, however, remains to be established. SV40 is closely related to
the human BKV and JCV, which establish persistent infections in a large
percentage of the human population (5)
. BKV and JCV are
associated with the human diseases hemorrhagic cystitis and multifocal
leukoencephalopathy, respectively, and share with SV40 the ability to
induce tumors in rodent models (5, 6, 7)
. Although SV40 is
thought to infect humans only rarely, a study by Martini et
al. (8)
suggests that SV40 might be transmitted in
the human population, where it may exist as a latent infection.
Little is known about the role of the immune response to SV40 in
humans. Although neutralizing-antibody responses have been detected in
individuals exposed to SV40, the potential cross-reactivity of
antibodies specific for SV40, JCV, and BKV have made it difficult to
conclusively demonstrate specific immunity (1
, 9)
.
Whereas the cellular immune response to SV40 in humans remains
largely uncharacterized, it has been studied extensively in rodent
models, where strong CTL responses to the T ag are elicited in mice and
hamsters after immunization with SV40 (10)
. Immunization
of high-responder C57BL/6 mice with SV40 T ag results in the induction
of CTLs specific for two H2-Db-restricted
epitopes, designated I and II/III, and one
H2-Kb-restricted epitope, designated IV, which
are immunodominant (11)
. A fourth epitope, the
immunorecessive H2-Db-restricted epitope V, also
has been defined in T ag (12)
. We have shown previously
that CTL clones specific for these four SV40 T ag epitopes can be used
to distinguish between the T ags of SV40, BKV, and JCV
(13)
. Thus, CTLs represent a highly sensitive tool for
distinguishing between these polyomaviruses. Because SV40 T ag CTL
epitopes have not been defined in humans, it remains to be determined
whether the presence of T ag-specific T cells could be used to
determine exposure or active immunity to SV40. In this study, we
identified a T ag CTL epitope restricted by the human HLA-A2.1
molecule, and we constructed HLA-A2.1/peptide tetramers that might
serve as potential tools for the detection of SV40 T ag-specific
CD8+ T cell responses in humans.
 |
Materials and Methods
|
|---|
Mice.
Line A2.1 transgenic mice (H2b; Ref.
14
) were generously provided by Dr. Victor Engelhard
(University of Virginia, Charlottesville, VA) and were bred and
maintained at the animal research facility of the Milton S. Hershey
Medical Center, Hershey, PA.
Plasmids.
Plasmids used in this study include pSelectESV-1 (15)
,
which encodes wild-type SV40 T ag under the SV40 promoter, and
pLMTS364-1 (16)
, which encodes full-length T ag-containing
substitutions at critical MHC anchor residues N210A, N227A, F408A, and
N493A. These mutations disrupt the binding of T ag epitopes I, II/III,
IV, and V to the H2b class I molecules. Plasmid
pSV-941T encodes full-length SV40 T ag (17)
. Plasmid
pTDS14 was constructed by amplification of the T ag sequence encoding
residues 275300 from plasmid pSC-941T using primers
STEV393(5'GTGTCCTGGAAGCTTGCCATGGAGTATGCAATGGAAACA3')
and STEV394
(5'TTCTTCCATGGATCACTATGCGGCCGCTTCAAAACTGTACTGAAATTCCAAGTACATCCC3')
and insertion of this fragment into the SmaI site of plasmid
pUC19. The sequence encoding T ag epitope V, T ag 489497 was then
inserted as annealed oligonucleotides adjacent to T ag 275300 at the
NotI site located within the PCR product, and the entire
sequence encoding T ag 275300/V was excised from pUC19 by
NcoI digestion and inserted into the NcoI site of
plasmid pSC-SKNN, which contains a multiple cloning site downstream of
the vaccinia virus promoter P7.5 (17)
. All sequences were
verified by DNA sequence analysis.
Cell Lines and Media.
The cell lines used in this study are summarized in Table 1
. T ag-transformed cells A2.1/WT-A2 and A2.1/364-A were derived
by calcium phosphate-mediated transfection of A2.1 transgenic primary
kidney cells with plasmid DNA as described previously
(15)
. The A2.1/WT-A2 cell line was derived by transfection
with plasmid pSelectESV-1 (15)
and expresses wild type
SV40 T ag. A2.1/364-A cells were transformed by a mutant T ag from
plasmid pLMTS364-1 (16)
and express full-length T ag
containing substitutions at critical MHC anchor residues that disrupt
the binding of T ag epitopes I, II/III, IV, and V to the
H2b class I molecules. A2.1/SponKC is a
spontaneously immortalized line derived by continuous culture of A2.1
transgenic primary kidney cells. The SV40-transformed cell line
B6/WT-19, which expresses wild-type T ag, has been described previously
(18)
. B6/122B1 cells were derived previously by
transformation with the mutant T ag encoded by plasmid pLMTS364-1
described above (16)
. The spontaneously immortalized
C57BL/6 mouse embryo fibroblast cell line B6/Scl-7 has been described
previously (19)
. Caski, is an HLA-A2.1-expressing cell
line derived from an HPV 16-expressing cervical carcinoma
(20)
and was generously provided by Dr. Neal Christensen
(Penn State University, Hershey, PA). The JC/SV40 T ag hybrid
expressing C57BL/6-derived cell lines, cell lines B6/dl 252-300, B6/dl
301-350, and B6/dl 330-350, B6/SVCPC Cl 4, and B6/SVCPC Cl 8 have been
described previously (13
, 21
, 22)
. The human osteosarcoma
cell line HuTK-143 (ATCC CRL-8303) and the human
lymphoid cell line T2 have been described previously (23)
.
Cell lines were maintained in Dulbeccos modified Eagle medium
supplemented with 100 units/ml of penicillin, 100 µg/ml of
streptomycin, 100 µg/ml of kanamycin, 2 mM
L-glutamine, 10 mM HEPES buffer, 0.075% (w/v)
NaHCO3, and 510% FBS. T2 cells were
maintained in suspension using RPMI 1640 supplemented with 10% FBS,
100 units/ml of penicillin, 100 µg/ml of streptomycin, 2
mM L-glutamine, 50 µM
2-mercaptoethanol, and 25 mg/ml of sodium pyruvate.
Viruses and Synthetic Peptides.
rVVs used in this study are summarized in Table 2
and include rVV-941T, which encodes full-length SV40 T ag, and
rVV-VgB11, kindly provided by Dr. Bernard Moss (NIH, Bethesda, MD),
which encodes glycoprotein B from herpes simplex virus 1 (17
, 24)
. rVV-A2.1, which encodes the human HLA-A2.1 heavy chain
(25)
, rVV-Kd, which encodes the
murine H2-Kd heavy chain (26)
, and
rVV-Db, which encodes the murine
H2-Db heavy chain, were kindly provided by Drs.
Jonathan Yewdell and Jack Bennink (National Institute of Allergy and
Infectious Diseases, Bethesda, MD). rVV-Tag 275300/V was
derived by recombination of plasmid pTDS14, encoding T ag 275300 in
tandem with T ag 489497, with wild-type vaccinia virus strain
WR as described previously (17)
. The
adenovirus/SV40 hybrid viruses Ad2+ND1 and
Ad2+ND2 and the control adenovirus Ad2 have been
described previously (27)
. Peptides were synthesized at
the Macromolecular Core Facility of the Milton S. Hershey Medical
Center by FMoc chemistry using an automated peptide synthesizer (9050
MilliGen PepSynthesizer) or were purchased from Chiron Technologies
(Clayton, Victoria, Australia). Peptides were solubilized in DMSO and
diluted to the appropriate concentration with RPMI 1640. The peptides
used in this study are summarized in Table 3
.
Induction of T ag-Specific CTLs and Establishment of CTL Lines
and Clones.
A2.1 transgenic mice were immunized by i.p. injection of 3 x 107 A2.1/364-A cells and sacrificed at 2
weeks postimmunization for isolation of spleen cells. For in
vitro stimulation, 1 x 107
RBC-depleted spleen cells were mixed with 1 x 106
-irradiated (10,000 rads) A2.1/364-A cells
in 4 ml of complete RPMI 1640 supplemented with 10% FBS/well of a
12-well tissue culture plate. Cultures were expanded weekly from 1 to 3
wells with fresh A2.1/364-A stimulator cells and 5 IU/ml
recombinant interleukin-2 (generously provided by Amgen, Thousand
Oaks, CA). CTL clones were isolated from established CTL lines by
limiting dilution culture as described previously (12)
.
Peptide immunization was performed as described by Ressing et
al. (28)
, where A2.1 transgenic mice were
injected s.c. at the base of the tail with a combination of 50 µg of
T ag 281289 and 140 µg of the hepatitis B virus core antigen T
helper cell epitope 128140 (29)
emulsified in incomplete
Freunds adjuvant in a total of 100 µl. After 9 days, splenocytes
from immunized mice were analyzed directly or restimulated in
vitro at a 3:1 ratio with irradiated (3,000 rads) syngeneic 72-h
lipopolysaccharide-induced blasts and 1 µM T ag
281289 peptide.
Cytotoxicity Assays.
Assays for CTL lysis were performed at the indicated times after
in vitro restimulation as previously described (17
, 30)
. All data points represent the means of triplicate samples.
HLA-A2.1 Stabilization Assay.
Peptide-induced stabilization of HLA-A2.1 molecules on the cell surface
of T2 cells was achieved as described previously (31)
and
detected by flow cytometry as described (30)
after
staining with the anti-HLA-A2.1-specific mAb BB7.2 (ATCC HB 82).
Production of HLA-A2.1 Tetramers and Staining of Lymphocytes.
HLA-A2.1 tetramers were produced as described previously
(32)
using peptides T ag 281289 and HIV gag p17 7785
(SLYNTVATL; Ref. 33
). Staining of lymphocytes and flow
cytometric analysis was performed as described previously
(16)
.
 |
Results
|
|---|
Induction of T ag-specific, HLA-A2.1-restricted CTLs.
Line A2.1 transgenic mice on the C57BL/6 background express the murine
H2-Kb and H2-Db MHC class I
molecules as well as the human HLA-A2.1 transgenic product
(14)
. This line has been used previously to identify
HLA-A2.1-restricted CTL epitopes recognized by human CTLs
(34)
. To avoid the masking of HLA-A2.1-resticted responses
to T ag by the strong H2b-restricted CTL
responses, a T ag-expressing cell line was derived, designated
A2.1/364-A, which fails to present the
H2b-restricted epitopes I, II/III, IV, and V
because of alanine replacement of the critical MHC anchor residues for
each of the four epitopes (Fig. 1A
; Table 1
). This cell line is not recognized by CTL clones
specific for each of the known H2b epitopes and
fails to induce CTL-specific for epitopes I, II/III, IV, or V after
immunization of C57BL/6 mice (data not shown). Immunization of A2.1
transgenic mice with A2.1/364-A cells, and then in vitro
restimulation with irradiated A2.1/364-A cells for 6 days, resulted in
the induction of CTLs that lysed both A2.1/364-A cells and the
wild-type T ag-transformed cells A2.1/WT-A2 (Fig. 1B
,
panel a). These CTLs failed to lyse the T ag-negative,
A2.1-expressing cell line A2.1/SponKC, as well as the C57BL/6-derived
and A2.1-negative cell line B6/WT-19, which expresses wild-type T ag.
The CTL line 58 was derived from the initial bulk CTLs by repeated
in vitro culture with A2.1/364-A cells and subsequently
cloned by limiting dilution culture. Both CTL line 58 and a
representative clone 58.3 had identical reactivity to the bulk CTLs
(Fig. 1B
, panels b and c).
Additionally, CTL line 58 and clone 58.3 failed to lyse the
A2.1-negative cell line B6/122B1, which expresses the same T ag variant
as A2.1/364-A cells (16)
. These results indicate that the
CTLs derived from A2.1/364-A-immunized A2.1 transgenic mice are
HLA-A2.1-restricted and T ag-specific.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 1. A, diagram of the mutant T ag expressed by
A2.1/364-A cells showing the alanine replacement of critical MHC class
I anchor residues (underlined) within the T ag CTL
epitopes I, II/III, IV, and V. B, lysis of T ag- and
A2.1-expressing cell lines in a standard 51Cr-release
assay by (a) bulk CTL derived from A2.1/364-A-immunized
A2.1 transgenic mice and restimulated in vitro for
6 days; (b) CTL line 58; and (c) CTL
clone 58.3.
|
|
To confirm the specificity of this response, CTL line 58 was tested for
its ability to lyse cell lines that lacked expression of T ag,
HLA-A2.1, or both molecules after infection of target cells with rVVs
(described in Table 2
) expressing each of the missing components.
Infection of the wild-type T ag-transformed cell line B6/WT-19 with
rVV-A2.1 but not with rVV-Kd, which encodes the
murine H2-Kd MHC class I molecule, allowed
efficient lysis by CTL line 58 (Table 4)
. Infection of the HLA-A2.1-expressing, but T ag-negative, human
Caski or mouse A2.1/SponKC cell lines with rVV-941T, which encodes
full-length T ag, led to specific lysis of both cell lines (Table 4)
.
Infection of these cell lines with rVV-VgB11, which encodes herpes
simplex virus 1 gB, failed to result in CTL lysis. This
demonstrates that the T ag CTL epitope is processed in both human and
mouse cells from full-length T ag. Finally, B6/Scl-7 cells, which lack
both HLA-A2.1 and T ag, were coinfected with rVV-A2.1 and rVV-941T,
resulting in efficient lysis of target cells. Infection of B6.Scl-7
cells with rVV-A2.1 alone or in combination with rVV-VgB11 failed to
induce significant lysis by CTL line 58 (Table 4)
. These results
demonstrate that CTL line 58 recognizes an HLA-A2.1-restricted epitope
processed from endogenous T ag.
Localization of the A2.1-restricted Epitope within T ag.
To broadly localize the A2.1-restricted epitope within SV40 T ag, a
panel of cell lines expressing SV40/JCV T ag hybrids was subjected to
lytic assays using CTL clone 58.3 (Fig. 2A)
. These C57BL/6-derived cell lines were infected with
rVV-A2.1 to provide appropriate targets for CTL clone 58.3. First, we
determined if CTL clone 58.3 was cross-reactive on T ag epitopes from
JCV. Cells expressing full-length SV40 T ag, but not full-length JCV T
ag, were specifically lysed after infection with rVV-A2.1 (Fig. 2A)
. In addition, CTL clone 58.3 failed to specifically lyse
the cell line B6/BKVD-1 (Fig. 2A)
, which expresses the
full-length T ag derived from BKV. Thus, CTL clone 58.3 is specific for
SV40 T ag. Identical results were obtained with CTL line 58 (data not
shown). Using the SV40/JCV T ag hybrid cell lines, the target epitope
recognized by CTL clone 58.3 was initially mapped between T ag residues
83410 as indicated by specific lysis of rVV-A2.1-infected cell lines
expressing SV40 T ag fragments 83708 and 1410, but not cell lines
expressing SV40 T ag fragments 182 or 411708 (Fig. 2A)
.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 2. Localization of the HLA-A2.1-restricted epitope within
SV40 T ag. A, 51Cr-labeled JCV/SV40 T ag
hybrid cell lines were infected with rVV-A2.1 or rVV-Db for
4 h before addition to CTL clone 58.3 at an E:T ratio of 3:1 in a
standard 51Cr-release assay. B,
51Cr-labeled B6-derived cell lines were infected with
rVV-A2.1 or rVV-Kd for 4 h before combining with CTL
clone 58.3 at an E:T ratio of 3:1 in a standard
51Cr-release assay. Cell line names and the corresponding T
ag construct expressed are indicated. Amino acid coordinates preceded
by indicate the region of T ag that is deleted.
|
|
The target epitope was localized further using a panel of cell lines
expressing SV40 T ag deletion mutants (Fig. 2B)
. Whereas
rVV-A2.1 infection of cell line B6/CPC Cl 8, which expresses
full-length T ag, resulted in efficient lysis by CTL clone 58.3, B6/CPC
Cl 4, which contains a deletion of T ag 154351, was not lysed. The
B6/CPC Cl 4 cell line serves as an efficient target in CTL assays using
the clone Y-4, which recognizes the
H-2Kb-restricted epitope IV (T ag sequence
404411; Ref. 13
), indicating that this cell line can
efficiently process T ag epitopes for CTL recognition. This result
localized further the epitope between T ag residues 154 and 351.
To narrow the search for the A2.1-restricted epitope recognized by CTL
clone 58.3, the A2.1-expressing human Caski cell line was infected with
the Adenovirus/SV40 T ag hybrid viruses Ad2+ND1,
which encodes T ag 512708, or Ad2+ND2, which
encodes two overlapping T ag fragments, residues 277708 and residues
362708 (27)
. Only Ad2+ND2-infected
Caski cells were lysed in a 51Cr-release assay
(data not shown). In combination with the results obtained using B6/CPC
Cl 4 (Fig. 2B)
, this result suggested that the T ag epitope
was localized between residues 277 and 351. To search for the epitope
within this region, C57BL/6-derived cell lines expressing SV40 T ag
mutants containing deletions within the amino acid 250 to 350 region
were infected with rVV-A2.1 or the control rVV-Kd
and subjected to lytic assays using CTL clone 58.3 (Fig. 2B)
. Only cells that lack the 252300 region were resistant
to lysis by CTL clone 58.3, whereas cell lines which lack T ag residues
301350 or 330350 were lysed after infection with rVV-A2.1.
Together, these results indicated that the T ag epitope was located
between residues 277 and 300.
Identification of the A2.1-restricted SV40 T ag Epitope as T ag
Residues 281289.
To confirm that the A2.1-restricted epitope was localized to the T ag
277300 region, a rVV expressing the T ag fragment 275300 was
constructed. The H2-Db-restricted T ag epitope V,
residues 489497, was linked to the carboxyl terminus of T ag 275300
to verify expression of the recombinant T ag fragment. rVV-T ag
275300/V effectively targeted lysis of infected cells by an epitope
V-specific CTL clone (data not shown), demonstrating successful
expression of the minigene product. To provide a sensitive target cell
for infection with rVV-T ag 275300/V, the T ag-negative
143TK- human osteosarcoma cell line, which is
efficiently infected by vaccinia viruses, was used as a target cell in
lytic assays with CTL clone 58.3 after coinfection with rVV-A2.1 (Fig. 3A)
. 143TK- cells coinfected with rVV-T
ag 275300/V + rVV-A2.1 were lysed as efficiently as
rVV-941T + rVV-A2.1 coinfected cells, confirming the presence
of the A2.1-restricted CTL epitope within the T ag 275300 region.
Cells coinfected with rVV-T ag 275300/V + rVV-Db were not lysed. In addition, lysis of
143TK- cells by clone 58.3 was not detected
after infection with rVV-ES V (Fig. 3A)
, which encodes only
the epitope V sequence from SV40 T ag (17)
, demonstrating
that clone 58.3 does not cross-react on epitope V.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 3. T ag 281289 is the target epitope recognized by
A2.1-restricted CTL. A, 51Cr-labeled
HuTK-143 cells were infected with the indicated vaccinia recombinants
and tested for susceptibility to lysis by CTL clone 58.3.
B, 51Cr-labeled T2 cells were pulsed with 1
µM synthetic peptides representative of sequences
spanning the T ag 277300 region for 2 h, washed free of peptide,
and incubated with CTL clone 58.3 at an E:T ratio of 3:1 in a standard
51Cr-release assay. A peptide corresponding to the HPV 16
E7 82-90 epitope was used as a control. C, peptides
corresponding to T ag 281289 (), 281288 ( ), 280288 ( ),
282290 ( ), and the control epitope HPV16 E7 82-90 ( ) were
titrated in the presence of 51Cr-labeled T2 target cells
and CTL clone 58.3 at a 3:1 E:T ratio in a 5-h 51Cr-release
assay. D, T2 cells were incubated in the presence of 100
µM peptide corresponding to T ag 281289 (), 281288
( ), 280288 ( ), 282290 ( ), the control epitope HPV16 E7
8290 ( ), or no peptide ( ) overnight at 37°C in serum-free
media plus 50 µg/ml human ß2m. Peptide was removed and
cells were incubated for the indicated times at 37°C in serum-free
media, stained with the anti-HLA-A2.1 mAb BB7.2, and analyzed by flow
cytometry. E, HLA-A2.1 tetramer and CD8 staining of CTL
clone 58.3 and spleen cells derived from A2.1 transgenic mice immunized
with A2.1/364-A cells or T ag 281289 synthetic peptide plus hepatitis
B virus core protein epitope 128140 in incomplete Freunds
Adjuvant, either immediately after isolation or after 6 days of
in vitro culture with A2.1/364-A cells, or 5 days of
in vitro culture with syngeneic lipopolysaccharide
blasts plus 1 µM of T ag 281289 peptide, respectively.
The percentage of CD8+ cells that stained positively with
the indicated tetramer is shown in the upper right
quadrant.
|
|
To specifically define the target epitope, a series of peptides were
synthesized that spanned the T ag 277300 region (Table 3)
. Peptides
which bind to HLA-A2.1 typically are nonamers, which contain a leucine
or methionine at peptide position P2 and a hydrophobic residue at the
carboxyl terminus (35)
. Six peptides were synthesized that
correspond to nonamers that contain hydrophobic residues at the
carboxyl terminus (Fig. 3B)
. Four of these peptides
additionally contain a hydrophobic residue at the P2 position. The
transported associated with antigen processing (TAP)-negative
lymphoblastoid T2 cell line, which expresses HLA-A2.1 molecules that
can be loaded efficiently with exogenous peptides (36)
,
was pulsed with 1 µM T ag synthetic peptides.
Only T ag peptide 281-289 (KCDDVLLLL) was recognized by CTL clone 58.3
in a lytic assay (Fig. 3B)
. Identical results were obtained
using CTL line 58 (data not shown). To determine whether T ag 281289
represented the optimal epitope, variants of the T ag 281289 peptide
were synthesized, and their abilities to target lysis of T2 cells by
clone 58.3 in a peptide titration assay were compared (Fig. 3C)
. Peptides in which the epitope was shifted one residue
toward the amino (T ag 280288) or carboxyl (T ag 282290) terminal
were recognized
10,000-fold less efficiently than T ag 281289. In
addition, removal of the carboxyl-terminal L289 residue reduced the
efficiency of CTL recognition
1,000-fold. Thus, Tag 281289
represents the optimal peptide recognized by CTL clone 58.3.
Because the sequence of T ag 281289 does not contain the classical
HLA-A2.1-binding motif in which the P2 position is occupied by leucine
or methionine, we determined the relative stability of T ag
281289/HLA-A2.1 complexes versus another known
HLA-A2.1-restricted epitope derived from HPV 16 E7, peptide 8289
(LLMGTLGIV; Ref. 28
), which contains the classical motif.
T2 cells were incubated overnight with 100 µM
peptide at 37°C as described (31)
to form
peptide/HLA-A2.1 complexes at the cell surface. Cells were then washed
free of peptide and incubated at 37°C to allow the decay of unstable
complexes. HLA-A2.1 expression was monitored by immunofluorescent
staining and flow cytometry (Fig. 3D)
. The initial level of
HLA-A2.1 complexes formed using T ag 281289 was equivalent to that
formed using HPV 16 E7 82-90, whereas variants of T ag 281289 failed
to form detectable complexes with HLA-A2.1. T ag 281289/HLA-A2.1
complexes also displayed similar kinetics of decay compared with those
formed using HPV 16 E7 82-90. These results demonstrate that T ag
281289 forms relatively stable complexes with HLA-A2.1.
Detection of T ag 281289-specific CD8+ T Cells from T
ag Immunized HLA-A2.1 Transgenic Mice with A2.1/T ag 281289
Tetramers.
To determine the magnitude of the T ag 281289-specific
CD8+ T cell response in the initial splenocyte
populations from immunized A2.1 mice, we developed A2.1/T ag 281289
tetramers for the direct staining of CD8+ T
lymphocytes. A2.1 transgenic mice were immunized with A2.1/364-A cells,
and after 11 days, spleen cells were analyzed either ex vivo
for the presence of T ag 281289 specific CD8+ T
cells or after 6 days of in vitro restimulation with
A2.1/364-A cells. CTL clone 58.3 stained specifically with the A2.1/T
ag 281289 tetramer but not with a control A2.1 tetramer (Fig. 3E)
. Ex vivo analysis of spleen cells from
A2.1/364-A-immunized A2.1 transgenic mice failed to reveal the presence
of T ag 281289-specific CD8+ T cells (Fig. 3E)
. T ag 281289-specific CD8+ T
cells were detected, however, after a brief period of in
vitro restimulation. To determine whether this result was
attributable to the protocol used for immunization, we immunized A2.1
transgenic mice with a synthetic peptide corresponding to T ag
281289. As shown for the A2.1/364-A-immunized mice, T ag
281289-specific CD8+ T cells were not
detectable in spleen cells ex vivo at 9 days
postimmunization, but were readily detected after a short period of
restimulation in vitro with syngeneic
lipopolysaccharide blasts and T ag 281289 peptide (Fig. 3E)
. These results suggest that T ag 281289-specific
CD8+ T cells are present at a low frequency in
HLA-A2.1 transgenic mice after immunization with A2.1/364-A cells or T
ag 281289 peptide, but are successfully expanded by in
vitro restimulation. We note that HLA-A2.1-restricted, T
ag-specific lytic activity was only detected in spleen cell cultures
that contained T ag 281289-specific CD8+ T
cells (data not shown), indicating that T ag 281289-specific
CD8+ T cells represent the sole A2.1-restricted
CTLs detected under these conditions.
 |
Discussion
|
|---|
In this study, we identified a CTL recognition epitope derived
from the T ag oncoprotein of SV40, which is presented by the human
HLA-A2.1 molecule. This epitope, T ag residues 281289, was
efficiently processed from endogenously synthesized T ag for
presentation at the cell surface by HLA-A2.1. In addition, epitope
281289 was processed from T ag by cells of both mouse and human
origin for CTL recognition, demonstrating its potential for
presentation by HLA-A2.1-positive human tumor cells that express SV40 T
ag.
The T ag 281289 epitope identified in this study lacks the complete
consensus motif described for peptides binding to HLA-A2.1, in which
the P2 position is most frequently occupied by a leucine or methionine
(35)
, but instead contains a cysteine residue. The P2
residue has been shown to interact within the hydrophobic B pocket of
HLA-A2.1 and contributes toward stabilization of the peptide
interaction within the peptide binding groove (37)
. The
ability of peptide 281289 to target lysis of T2 cells and stabilize
HLA-A2.1 molecules on the surface of T2 cells with significantly
greater efficiency than peptide analogues in which the peptide sequence
was shifted one residue toward the amino or carboxyl terminus
demonstrates that T ag 281289 represents the optimal peptide epitope.
Indeed, this peptide bound as efficiently to HLA-A2.1 as another known
HLA-A2.1-restricted CTL epitope from HPV 16 E7. We have determined
recently that replacement of the cysteine at P2 of T ag 281289
with alanine slightly reduces the stability of the HLA-A2.1 complex
(data not shown), suggesting that the C282 residue contributes to the
stable binding of the T ag 281289 peptide to HLA-A2.1. Thus, we are
confident that T ag 281289 represents the optimal peptide recognized
by the A2.1-restricted CTL.
The specificity of the A2.1 transgenic CTL for SV40 T ag was
demonstrated by the lack of recognition of cell lines expressing T ag
derived from the human polyomaviruses BKV and JCV. The SV40 T ag
epitope 281289 (KCDDVLLLL) differs from the corresponding sequence in
BKV T ag (KCEDVFLLL) at peptide positions P3 and
P6 and from JCV T ag (KCEDVFLLM) at
these same two residues plus the P9 position. We are currently
investigating which of these residues may be critical for CTL
recognition. In light of recent reports that T ag protein can be
detected in tumor cells that contain SV40-specific DNA sequences
(1
, 3
, 38
, 39)
and our previous results using
H2b-restricted CTL clones to distinguish between
tumors expressing T ags from SV40, BKV or JCV (13)
, T ag
281289-specific CTLs might be used to determine whether SV40 T ag
epitope 281289 is processed and presented in HLA-A2.1-expressing
human tumor cell lines. We have shown here that T ag 281289 is
processed from full-length T ag in the human cell lines Caski
and 143TK- after expression from a rVV. Thus, it
is expected that these CTLs will recognize cell lines derived
from HLA-A2.1 positive human tumors expressing SV40 T ag.
The frequency of T ag epitope 281289-specific
CD8+ T cells induced by immunization with the
syngeneic T ag-transformed kidney cell line A2.1/364-A or T ag 281289
synthetic peptide was below the limit of detection when measured
ex vivo with HLA-A2.1/T ag 281289 tetramers but
represented
23% of the CD8+ T cells after
in vitro restimulation. Thus, the efficiency of T
cell-induction and expansion in vivo in this system is low.
We are currently addressing whether increased numbers of T ag
281289-specific CD8+ T cells can be recruited
using alternate immunization strategies. Thus, it remains to be
determined whether T ag 281289 represents a weak epitope, or whether
our results are attributable to the specific transgenic mouse line
and/or immunization protocol used. Regardless, the T ag
281289-specific CTL represented the only A2.1-restricted, T
ag-specific CTLs detected after immunization with the T
ag-expressing A2.1/364-A cells in these experiments.
Thus, we have identified an SV40 T ag epitope recognized by
HLA-A2.1-resticted CTLs that is naturally processed from full-length T
ag. Although processing and presentation of an epitope does not
guarantee its immunogenicity in humans, these factors are a
prerequisite for immunogenicity. Previous investigations into
the use of A2.1/Kb transgenic mice to predict CTL
epitopes that might be recognized in humans found a good correlation
between the epitopes that were immunogenic in
A2.1/Kb transgenic mice and in humans
(40)
. Whether CTLs specific for T ag 281289 can be
elicited from human peripheral blood lymphocytes remains to be
determined. If so, T ag 281289-specific CD8+ T
cell responses could be monitored in individuals potentially exposed to
SV40. In addition, the possible role of active cellular immunity or
tolerance attributable to endogenous T ag expression might be monitored
in individuals bearing tumors that have been associated with an
increased incidence of SV40-specific sequences (41)
.
Finally, SV40 T ag expression in human tumors might provide a target
for CTLs directed against T ag epitopes such as T ag 281289
(30)
. In summary, we have defined an HLA-A2.1-restricted,
SV40 T ag-specific epitope that represents a plausible candidate for a
human CTL epitope.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Victor Engelhard (University of Virginia,
Charlottesville, VA) for providing the line A2.1 transgenic mice. We
thank Dr. Judy Tevethia (Pennsylvania State University College of
Medicine, Hershey, PA) for providing cell lines expressing T ag
deletion mutants and for helpful advice in the derivation of A2.1
transgenic cell lines. We thank Dr. Lawrence Mylin (Messiah College,
Grantham, PA) for helpful discussions and Melanie Epler (Pennsylvania
State University, Hershey, PA) for excellent technical
assistance.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by Research Grant R37
CA25000 (to S. S. T.) from the National Cancer Institute, NIH. 
2 To whom requests for reprints should be
addressed, at Department of Microbiology and Immunology, H107,
Pennsylvania State University College of Medicine, 500 University
Drive, Hershey, PA 17033. Phone: (717) 531-8872; Fax; (717) 531-5578;
E-mail: sst1{at}psu.edu 
3 The abbreviations used are: T ag, T antigen;
BKV, BK virus; JCV, JC virus; FBS, fetal bovine serum; rVV, recombinant
vaccinia virus; 51Cr, Chromium-51; HPV, human papilloma
virus; gB, glycoprotein B. 
Received 8/18/00.
Accepted 12/ 8/00.
 |
REFERENCES
|
|---|
-
Butel J. S., Lednicky J. A. Cell and molecular biology of simian virus 40: implications for human infections and disease.. J. Natl. Cancer Inst., 91: 119-134, 1999.
-
Cory S., Adams J. M. Transgenic mice and oncogenesis.. Annu. Rev. Immunol., 6: 25-48, 1988.[Medline]
-
Bergsagel D. J., Finegold M. J., Butel J. S., Kupsky W. J., Garcea R. L. DNA sequences similar to those of simian virus 40 in ependymomas and choroid plexus tumors of childhood.. N. Engl. J. Med., 326: 988-993, 1992.[Abstract]
-
Carbone M., Pass H. I., Rizzo P., Marinetti M., Di Muzio M., Mew D. J., Levine A. S., Procopio A. Simian virus 40-like DNA sequences in human pleural mesothelioma.. Oncogene, 9: 1781-1790, 1994.[Medline]
-
Imperiale M. J. The human polyomaviruses, BKV and JCV: molecular pathogenesis of acute disease and potential role in cancer.. Virology, 267: 1-7, 2000.[Medline]
-
Small J. A., Khoury G., Jay G., Howley P. M., Scangos G. A. Early regions of JC virus and Bk virus induce distinct and tissue-specific tumors in transgenic mice.. Proc. Natl. Acad. Sci. USA, 83: 8288-8292, 1986.[Abstract/Free Full Text]
-
Dalrymple S. A., Beemon K. L. BK virus T antigens induce kidney carcinomas and thymoproliferative disorders in transgenic mice.. J. Virol., 64: 1182-1191, 1990.[Abstract/Free Full Text]
-
Martini F., Iaccheri L., Lazzarin L., Carinci P., Corallini A., Gerosa M., Iuzzolino P., Barbanti-Brodano G., Tognon M. SV40 early region and large T antigen in human brain tumors, peripheral blood cells, and sperm fluids from healthy individuals.. Cancer Res., 56: 4820-4825, 1996.[Abstract/Free Full Text]
-
Shah K., Nathanson N. Human exposure to SV40: review and comment.. Am. J. Epidemiol., 103: 1-12, 1976.[Free Full Text]
-
Tevethia S. S. Recognition of simian virus 40 T antigen by cytotoxic T lymphocytes.. Mol. Biol. Med., 7: 83-96, 1990.[Medline]
-
Tanaka Y., Tevethia M. J., Kalderon D., Smith A. E., Tevethia S. S. Clustering of antigenic sites recognized by cytotoxic T lymphocyte clones in the amino terminal half of SV40 T antigen.. Virology, 162: 427-436, 1988.[Medline]
-
Tanaka Y., Anderson R. W., Maloy W. L., Tevethia S. S. Localization of an immunorecessive epitope on SV40 T antigen by H-2Db-restricted cytotoxic T-lymphocyte clones and a synthetic peptide.. Virology, 171: 205-213, 1989.[Medline]
-
Tevethia S. S., Mylin L., Newmaster R., Epler M., Lednicky J. A., Butel J. S., Tevethia M. J. Cytotoxic T lymphocyte recognition sequences as markers for distinguishing among tumour antigens encoded by SV40, BKV and JCV.. Dev. Biol. Stand., 94: 329-339, 1998.[Medline]
-
Le A. X., Bernhard E. J., Holterman M. J., Strub S., Parham P., Lacy E., Engelhard V. H. Cytotoxic T cell responses in HLA-A2.1 transgenic mice.. Recognition of HLA alloantigens and utilization of HLA-A2.1 as a restriction element. J. Immunol., 142: 1366-1371, 1989.[Abstract]
-
Mylin L. M., Deckhut A. M., Bonneau R. H., Kierstead T. D., Tevethia M. J., Simmons D. T., Tevethia S. S. Cytotoxic T lymphocyte escape variants, induced mutations, and synthetic peptides define a dominant H-2Kb-restricted determinant in simian virus 40 tumor antigen.. Virology, 208: 159-172, 1995.[Medline]
-
Mylin L. M., Schell T. D., Roberts D., Epler M., Boesteanu A., Collins E. J., Frelinger J. A., Joyce S., Tevethia S. S. Quantitation of CD8+ T-lymphocyte responses to multiple epitopes from simian virus 40 (SV40) large T antigen in C57BL/6 mice immunized with SV40, SV40 T-antigen-transformed cells, or vaccinia virus recombinants expressing full-length T antigen or epitope minigenes.. J. Virol., 74: 6922-6934, 2000.[Abstract/Free Full Text]
-
Fu T-M., Mylin L. M., Schell T. D., Bacik I., Russ G., Yewdell J. W., Bennink J. R., Tevethia S. S. An endoplasmic reticulum-targeting signal sequence enhances the immunogenicity of an immunorecessive simian virus 40 large T antigen cytotoxic T-lymphocyte epitope.. J. Virol., 72: 1469-1481, 1998.[Abstract/Free Full Text]
-
Pretell J., Greenfield R. S., Tevethia S. S. Biology of simian virus 40 (SV40) transplantation rejection antigen (TrAg).. In vitro demonstration of SV40 TrAg in SV40 infected non-permissive mouse cells by the lymphocyte-mediated cytotoxicity assay. Virology, 97: 32-41, 1979.[Medline]
-
Thompson D. L., Kalderon D., Smith A. E., Tevethia M. J. Dissociation of Rb-binding and anchorage-independent growth from immortalization and tumorigenicity using SV40 mutants producing N-terminally truncated large T antigens.. Virology, 178: 15-34, 1990.[Medline]
-
Pattillo R. A., Hussa R. O., Story M. T., Ruckert A. C., Shalaby M. R., Mattingly R. F. Tumor antigen and human chorionic gonadotropin in CaSki cells: a new epidermoid cervical cancer cell line.. Science (Washington DC), 196: 1456-1458, 1977.[Abstract/Free Full Text]
-
Deckhut A. M., Tevethia M. J., Haggerty S., Frisque R. J., Tevethia S. S. Localization of common cytotoxic T lymphocyte recognition epitopes on simian papovavirus SV40 and human papovavirus JC virus T antigens.. Virology, 183: 122-132, 1991.[Medline]
-
Kierstead T. D., Tevethia M. J. Association of p53 binding and immortalization of primary C57BL/6 mouse embryo fibroblasts by using simian virus 40 T-antigen mutants bearing internal overlapping deletion mutations.. J. Virol., 67: 1817-1829, 1993.[Abstract/Free Full Text]
-
Salter R. D., Howell D. N., Cresswell P. Genes regulating HLA class I antigen expression in T-B lymphoblast hybrids.. Immunogenetics, 21: 235-246, 1985.[Medline]
-
Cantin E. M., Eberle R., Baldick J. L., Moss B., Willey D. E., Notkins A. L., Openshaw H. Expression of herpes simplex virus glycoprotein B by a recombinant vaccinia virus and protection of mice against lethal herpes simplex virus 1 infection.. Proc. Natl. Acad. Sci. USA, 84: 5908-5912, 1987.[Abstract/Free Full Text]
-
ONeil B. H., Kawakami Y., Restifo N. P., Bennink J. R., Yewdell J. W., Rosenberg S. A. Detection of shared MHC-restricted human melanoma antigens after vaccinia virus-mediated transduction of genes coding for HLA.. J. Immunol., 151: 1410-1418, 1993.[Abstract]
-
Bacik I., Cox J. H., Anderson R., Yewdell J. W., Bennink J. R. TAP (transporter associated with antigen processing)-independent presentation of endogenously synthesized peptides is enhanced by endoplasmic reticulum insertion sequences located at the amino- but not carboxyl-terminus of the peptide.. J. Immunol., 152: 381-387, 1994.[Abstract]
-
Lewis A. M., Jr. Defective and nondefective AD2-SV40 hybrids.. Prog. Med. Virol., 23: 96-139, 1977.[Medline]
-
Ressing M. E., Sette A., Brandt R. M. P., Ruppert J., Wentworth P. A., Hartman M., Oseroff C., Grey H. M., Melief C. J. M., Kast W. M. Human CTL epitopes encoded by human papillomavirus type 16 E6 and E7 identified through in vivo and in vitro immunogenicity studies of HLA-A*0201-binding peptides.. J. Immunol., 154: 5934-5943, 1995.[Abstract]
-
Millich D. R., Hughes J. L., McLachlan A., Thornton G. B., Moriarty A. Hepatitis B synthetic immunogen comprised of nucleocapsid T-cell sites and an envelope B-cell epitope.. Proc. Natl. Acad. Sci. USA, 85: 1610-1614, 1988.[Abstract/Free Full Text]
-
Schell T. D., Mylin L. M., Georgoff I., Teresky A. K., Levine A. J., Tevethia S. S. Cytotoxic T-lymphocyte epitope immunodominance in the control of choroid plexus tumors in simian virus 40 large T antigen transgenic mice.. J. Virol., 73: 5981-5993, 1999.[Abstract/Free Full Text]
-
Kast W. M., Brandt R. M., Drijfhout J. W., Melief C. J. Human leukocyte antigen-A2.1 restricted candidate cytotoxic T lymphocyte epitopes of human papillomavirus type 16 E6 and E7 proteins identified by using the processing-defective human cell line T2.. J. Immunother., 14: 115-120, 1993.
-
Altman J. D., Moss P. A. H., Goulder P. J. R., Barouch D. H., McHeyzer-Williams M. G., Bell J. I., McMichael A. J., Davis M. M. Phenotypic analysis of antigen-specific T lymphocytes.. Science (Washington DC), 274: 94-96, 1996.[Abstract/Free Full Text]
-
Yang O. O., Kalams S. A., Rosenzweig M., Trocha A., Jones N., Koziel M., Walker B. D., Johnson R. P. Efficient lysis of human immunodeficiency virus type 1-infected cells by cytotoxic T lymphocytes.. J. Virol., 70: 5799-5806, 1996.[Abstract]
-
Man S., Newberg M. H., Crotzer V. L., Luckey C. J., Williams N. S., Chen Y., Huczko E. L., Ridge J. P., Engelhard V. H. Definition of a human T cell epitope from influenza A non-structural protein 1 using HLA-A2.1 transgenic mice.. Int. Immunol., 7: 597-605, 1995.[Abstract/Free Full Text]
-
Rammensee H-G., Friede T., Stevanovic S. MHC ligands and peptide motifs: first listing.. Immunogenetics, 41: 178-228, 1995.[Medline]
-
Hosken N. A., Bevan M. J. Defective presentation of endogenous antigen by a cell line expressing class I molecules.. Science (Washington DC), 248: 367-370, 1990.[Abstract/Free Full Text]
-
Madden D. R. The three-dimensional structure of peptide-MHC complexes.. Annu. Rev. Immunol., 13: 587-622, 1995.[Medline]
-
Carbone M., Rizzo P., Grimley P. M., Procopio A., Mew D. J., Shridhar V., de Bartolomeis A., Esposito V., Giuliano M. T., Steinberg S. M., Levine A. S., Giordano A., Pass H. I. Simian virus-40 large-T antigen binds p53 in human mesotheliomas.. Nat. Med., 3: 908-912, 1997.[Medline]
-
De Luca A., Baldi A., Esposito V., Howard C. M., Bagella L., Rizzo P., Caputi M., Pass H. I., Giordano G. G., Baldi F., Carbone M., Giordano A. The retinoblastoma gene family pRb/p105, p107, pRb2/p130 and simian virus-40 large T-antigen in human mesotheliomas.. Nat. Med., 3: 913-916, 1997.[Medline]
-
Wentworth P. A., Vitiello A., Sidney J., Keogh E., Chesnut R. W., Grey H., Sette A. Differences and similarities in the A2.1-restricted cytotoxic T cell repertoire in humans and human leukocyte antigen-transgenic mice.. Eur. J. Immunol., 26: 97-101, 1996.[Medline]
-
Schell T. D., Knowles B. B., Tevethia S. S. Sequential loss of cytotoxic T lymphocyte responses to simian virus 40 large T antigen epitopes in T antigen transgenic mice developing osteosarcomas.. Cancer Res., 60: 3002-3012, 2000.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. Hu, X. Peng, L. R. Budgeon, N. M. Cladel, K. K. Balogh, and N. D. Christensen
Establishment of a Cottontail Rabbit Papillomavirus/HLA-A2.1 Transgenic Rabbit Model
J. Virol.,
July 1, 2007;
81(13):
7171 - 7177.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hu, X. Peng, T. D. Schell, L. R. Budgeon, N. M. Cladel, and N. D. Christensen
An HLA-A2.1-Transgenic Rabbit Model to Study Immunity to Papillomavirus Infection
J. Immunol.,
December 1, 2006;
177(11):
8037 - 8045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Wang, H. Chen, X. Jiang, M. Zhang, T. Wan, N. Li, X. Zhou, Y. Wu, F. Yang, Y. Yu, et al.
Identification of an HLA-A*0201-restricted CD8+ T-cell epitope SSp-1 of SARS-CoV spike protein
Blood,
July 1, 2004;
104(1):
200 - 206.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xia, Y. Tanaka, S. Koido, C. Liu, P. Mukherjee, S. J. Gendler, and J. Gong
Prevention of Spontaneous Breast Carcinoma by Prophylactic Vaccination with Dendritic/Tumor Fusion Cells
J. Immunol.,
February 15, 2003;
170(4):
1980 - 1986.
[Abstract]
[Full Text]
[PDF]
|
 |
|