Cancer Research Meeting Calendar  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schell, T. D.
Right arrow Articles by Tevethia, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schell, T. D.
Right arrow Articles by Tevethia, S. S.
[Cancer Research 61, 873-879, February 1, 2001]
© 2001 American Association for Cancer Research


Advances in Brief

Cytotoxic T Lymphocytes from HLA-A2.1 Transgenic Mice Define a Potential Human Epitope from Simian Virus 40 Large T Antigen1

Todd D. Schell, John D. Lippolis and Satvir S. Tevethia2

Department of Microbiology and Immunology, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033 [T. D. S., S. S. T.], and Yerkes Regional Primate Center at Emory University, Atlanta, Georgia 30329 [J. D. L.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Recent reports have documented the presence of SV40 large T antigen (T ag) sequences in a number of human tumors and raised the question of whether cellular immunity to T ag is elicited in such individuals. We used HLA-A2.1 transgenic C57BL/6 mice to identify an epitope from T ag recognized by CD8+ CTLs when presented by this human MHC class I molecule. Immunization of HLA-A2.1 transgenic mice with syngeneic T ag-transformed cells resulted in the induction of HLA-A2.1-restricted, T ag-specific CTLs. The target epitope, residues 281–289 (KCDDVLLLL) of T ag, was identified using both cell lines expressing T ag variants and synthetic T ag peptides. Peptide 281-289 bound stably to HLA-A2.1 molecules, effectively sensitized target cells for CTL lysis, and was efficiently processed from endogenous T ag in cells of both mouse and human origin. CTLs were not cross-reactive on the human BK or JC virus T ags. Thus, SV40 T ag 281–289 represents a potential specific CTL recognition epitope for humans.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The SV40 T ag3 is a promiscuous oncogene, capable of transforming a large variety of cell types in vitro and in vivo. In rodent models, T ag is capable of inducing a wide variety of tumors dependent on the promoters that are used to drive T ag expression, including ependymomas, choroid plexus tumors, mesotheliomas, sarcomas, osteosarcomas, and some lymphomas (1 , 2) . A number of recent reports have indicated that SV40-specific coding sequences and T ag protein can be detected in some human tumors, such as choroid plexus papillomas and ependymomas of early childhood as well as mesotheliomas and osteosarcomas (Refs. 3 and 4 and reviewed in Ref. 1 ). A role for T ag in the progression of human tumors, however, remains to be established. SV40 is closely related to the human BKV and JCV, which establish persistent infections in a large percentage of the human population (5) . BKV and JCV are associated with the human diseases hemorrhagic cystitis and multifocal leukoencephalopathy, respectively, and share with SV40 the ability to induce tumors in rodent models (5, 6, 7) . Although SV40 is thought to infect humans only rarely, a study by Martini et al. (8) suggests that SV40 might be transmitted in the human population, where it may exist as a latent infection.

Little is known about the role of the immune response to SV40 in humans. Although neutralizing-antibody responses have been detected in individuals exposed to SV40, the potential cross-reactivity of antibodies specific for SV40, JCV, and BKV have made it difficult to conclusively demonstrate specific immunity (1 , 9) . Whereas the cellular immune response to SV40 in humans remains largely uncharacterized, it has been studied extensively in rodent models, where strong CTL responses to the T ag are elicited in mice and hamsters after immunization with SV40 (10) . Immunization of high-responder C57BL/6 mice with SV40 T ag results in the induction of CTLs specific for two H2-Db-restricted epitopes, designated I and II/III, and one H2-Kb-restricted epitope, designated IV, which are immunodominant (11) . A fourth epitope, the immunorecessive H2-Db-restricted epitope V, also has been defined in T ag (12) . We have shown previously that CTL clones specific for these four SV40 T ag epitopes can be used to distinguish between the T ags of SV40, BKV, and JCV (13) . Thus, CTLs represent a highly sensitive tool for distinguishing between these polyomaviruses. Because SV40 T ag CTL epitopes have not been defined in humans, it remains to be determined whether the presence of T ag-specific T cells could be used to determine exposure or active immunity to SV40. In this study, we identified a T ag CTL epitope restricted by the human HLA-A2.1 molecule, and we constructed HLA-A2.1/peptide tetramers that might serve as potential tools for the detection of SV40 T ag-specific CD8+ T cell responses in humans.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Mice.
Line A2.1 transgenic mice (H2b; Ref. 14 ) were generously provided by Dr. Victor Engelhard (University of Virginia, Charlottesville, VA) and were bred and maintained at the animal research facility of the Milton S. Hershey Medical Center, Hershey, PA.

Plasmids.
Plasmids used in this study include pSelectESV-1 (15) , which encodes wild-type SV40 T ag under the SV40 promoter, and pLMTS364-1 (16) , which encodes full-length T ag-containing substitutions at critical MHC anchor residues N210A, N227A, F408A, and N493A. These mutations disrupt the binding of T ag epitopes I, II/III, IV, and V to the H2b class I molecules. Plasmid pSV-941T encodes full-length SV40 T ag (17) . Plasmid pTDS14 was constructed by amplification of the T ag sequence encoding residues 275–300 from plasmid pSC-941T using primers STEV393(5'GTGTCCTGGAAGCTTGCCATGGAGTATGCAATGGAAACA3') and STEV394 (5'TTCTTCCATGGATCACTATGCGGCCGCTTCAAAACTGTACTGAAATTCCAAGTACATCCC3') and insertion of this fragment into the SmaI site of plasmid pUC19. The sequence encoding T ag epitope V, T ag 489–497 was then inserted as annealed oligonucleotides adjacent to T ag 275–300 at the NotI site located within the PCR product, and the entire sequence encoding T ag 275–300/V was excised from pUC19 by NcoI digestion and inserted into the NcoI site of plasmid pSC-SKNN, which contains a multiple cloning site downstream of the vaccinia virus promoter P7.5 (17) . All sequences were verified by DNA sequence analysis.

Cell Lines and Media.
The cell lines used in this study are summarized in Table 1Citation . T ag-transformed cells A2.1/WT-A2 and A2.1/364-A were derived by calcium phosphate-mediated transfection of A2.1 transgenic primary kidney cells with plasmid DNA as described previously (15) . The A2.1/WT-A2 cell line was derived by transfection with plasmid pSelectESV-1 (15) and expresses wild type SV40 T ag. A2.1/364-A cells were transformed by a mutant T ag from plasmid pLMTS364-1 (16) and express full-length T ag containing substitutions at critical MHC anchor residues that disrupt the binding of T ag epitopes I, II/III, IV, and V to the H2b class I molecules. A2.1/SponKC is a spontaneously immortalized line derived by continuous culture of A2.1 transgenic primary kidney cells. The SV40-transformed cell line B6/WT-19, which expresses wild-type T ag, has been described previously (18) . B6/122B1 cells were derived previously by transformation with the mutant T ag encoded by plasmid pLMTS364-1 described above (16) . The spontaneously immortalized C57BL/6 mouse embryo fibroblast cell line B6/Scl-7 has been described previously (19) . Caski, is an HLA-A2.1-expressing cell line derived from an HPV 16-expressing cervical carcinoma (20) and was generously provided by Dr. Neal Christensen (Penn State University, Hershey, PA). The JC/SV40 T ag hybrid expressing C57BL/6-derived cell lines, cell lines B6/dl 252-300, B6/dl 301-350, and B6/dl 330-350, B6/SVCPC Cl 4, and B6/SVCPC Cl 8 have been described previously (13 , 21 , 22) . The human osteosarcoma cell line HuTK-143 (ATCC CRL-8303) and the human lymphoid cell line T2 have been described previously (23) . Cell lines were maintained in Dulbecco’s modified Eagle medium supplemented with 100 units/ml of penicillin, 100 µg/ml of streptomycin, 100 µg/ml of kanamycin, 2 mM L-glutamine, 10 mM HEPES buffer, 0.075% (w/v) NaHCO3, and 5–10% FBS. T2 cells were maintained in suspension using RPMI 1640 supplemented with 10% FBS, 100 units/ml of penicillin, 100 µg/ml of streptomycin, 2 mM L-glutamine, 50 µM 2-mercaptoethanol, and 25 mg/ml of sodium pyruvate.


View this table:
[in this window]
[in a new window]

 
Table 1 Cell lines used in this study

 
Viruses and Synthetic Peptides.
rVVs used in this study are summarized in Table 2Citation and include rVV-941T, which encodes full-length SV40 T ag, and rVV-VgB11, kindly provided by Dr. Bernard Moss (NIH, Bethesda, MD), which encodes glycoprotein B from herpes simplex virus 1 (17 , 24) . rVV-A2.1, which encodes the human HLA-A2.1 heavy chain (25) , rVV-Kd, which encodes the murine H2-Kd heavy chain (26) , and rVV-Db, which encodes the murine H2-Db heavy chain, were kindly provided by Drs. Jonathan Yewdell and Jack Bennink (National Institute of Allergy and Infectious Diseases, Bethesda, MD). rVV-Tag 275–300/V was derived by recombination of plasmid pTDS14, encoding T ag 275–300 in tandem with T ag 489–497, with wild-type vaccinia virus strain WR as described previously (17) . The adenovirus/SV40 hybrid viruses Ad2+ND1 and Ad2+ND2 and the control adenovirus Ad2 have been described previously (27) . Peptides were synthesized at the Macromolecular Core Facility of the Milton S. Hershey Medical Center by FMoc chemistry using an automated peptide synthesizer (9050 MilliGen PepSynthesizer) or were purchased from Chiron Technologies (Clayton, Victoria, Australia). Peptides were solubilized in DMSO and diluted to the appropriate concentration with RPMI 1640. The peptides used in this study are summarized in Table 3Citation .


View this table:
[in this window]
[in a new window]

 
Table 2 Recombinant viruses used in this study

 

View this table:
[in this window]
[in a new window]

 
Table 3 Peptides used in this study

 
Induction of T ag-Specific CTLs and Establishment of CTL Lines and Clones.
A2.1 transgenic mice were immunized by i.p. injection of 3 x 107 A2.1/364-A cells and sacrificed at 2 weeks postimmunization for isolation of spleen cells. For in vitro stimulation, 1 x 107 RBC-depleted spleen cells were mixed with 1 x 106 {gamma}-irradiated (10,000 rads) A2.1/364-A cells in 4 ml of complete RPMI 1640 supplemented with 10% FBS/well of a 12-well tissue culture plate. Cultures were expanded weekly from 1 to 3 wells with fresh A2.1/364-A stimulator cells and 5 IU/ml recombinant interleukin-2 (generously provided by Amgen, Thousand Oaks, CA). CTL clones were isolated from established CTL lines by limiting dilution culture as described previously (12) . Peptide immunization was performed as described by Ressing et al. (28) , where A2.1 transgenic mice were injected s.c. at the base of the tail with a combination of 50 µg of T ag 281–289 and 140 µg of the hepatitis B virus core antigen T helper cell epitope 128–140 (29) emulsified in incomplete Freund’s adjuvant in a total of 100 µl. After 9 days, splenocytes from immunized mice were analyzed directly or restimulated in vitro at a 3:1 ratio with irradiated (3,000 rads) syngeneic 72-h lipopolysaccharide-induced blasts and 1 µM T ag 281–289 peptide.

Cytotoxicity Assays.
Assays for CTL lysis were performed at the indicated times after in vitro restimulation as previously described (17 , 30) . All data points represent the means of triplicate samples.

HLA-A2.1 Stabilization Assay.
Peptide-induced stabilization of HLA-A2.1 molecules on the cell surface of T2 cells was achieved as described previously (31) and detected by flow cytometry as described (30) after staining with the anti-HLA-A2.1-specific mAb BB7.2 (ATCC HB 82).

Production of HLA-A2.1 Tetramers and Staining of Lymphocytes.
HLA-A2.1 tetramers were produced as described previously (32) using peptides T ag 281–289 and HIV gag p17 77–85 (SLYNTVATL; Ref. 33 ). Staining of lymphocytes and flow cytometric analysis was performed as described previously (16) .


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Induction of T ag-specific, HLA-A2.1-restricted CTLs.
Line A2.1 transgenic mice on the C57BL/6 background express the murine H2-Kb and H2-Db MHC class I molecules as well as the human HLA-A2.1 transgenic product (14) . This line has been used previously to identify HLA-A2.1-restricted CTL epitopes recognized by human CTLs (34) . To avoid the masking of HLA-A2.1-resticted responses to T ag by the strong H2b-restricted CTL responses, a T ag-expressing cell line was derived, designated A2.1/364-A, which fails to present the H2b-restricted epitopes I, II/III, IV, and V because of alanine replacement of the critical MHC anchor residues for each of the four epitopes (Fig. 1ACitation ; Table 1Citation ). This cell line is not recognized by CTL clones specific for each of the known H2b epitopes and fails to induce CTL-specific for epitopes I, II/III, IV, or V after immunization of C57BL/6 mice (data not shown). Immunization of A2.1 transgenic mice with A2.1/364-A cells, and then in vitro restimulation with irradiated A2.1/364-A cells for 6 days, resulted in the induction of CTLs that lysed both A2.1/364-A cells and the wild-type T ag-transformed cells A2.1/WT-A2 (Fig. 1BCitation , panel a). These CTLs failed to lyse the T ag-negative, A2.1-expressing cell line A2.1/SponKC, as well as the C57BL/6-derived and A2.1-negative cell line B6/WT-19, which expresses wild-type T ag. The CTL line 58 was derived from the initial bulk CTLs by repeated in vitro culture with A2.1/364-A cells and subsequently cloned by limiting dilution culture. Both CTL line 58 and a representative clone 58.3 had identical reactivity to the bulk CTLs (Fig. 1BCitation , panels b and c). Additionally, CTL line 58 and clone 58.3 failed to lyse the A2.1-negative cell line B6/122B1, which expresses the same T ag variant as A2.1/364-A cells (16) . These results indicate that the CTLs derived from A2.1/364-A-immunized A2.1 transgenic mice are HLA-A2.1-restricted and T ag-specific.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, diagram of the mutant T ag expressed by A2.1/364-A cells showing the alanine replacement of critical MHC class I anchor residues (underlined) within the T ag CTL epitopes I, II/III, IV, and V. B, lysis of T ag- and A2.1-expressing cell lines in a standard 51Cr-release assay by (a) bulk CTL derived from A2.1/364-A-immunized A2.1 transgenic mice and restimulated in vitro for 6 days; (b) CTL line 58; and (c) CTL clone 58.3.

 
To confirm the specificity of this response, CTL line 58 was tested for its ability to lyse cell lines that lacked expression of T ag, HLA-A2.1, or both molecules after infection of target cells with rVVs (described in Table 2Citation ) expressing each of the missing components. Infection of the wild-type T ag-transformed cell line B6/WT-19 with rVV-A2.1 but not with rVV-Kd, which encodes the murine H2-Kd MHC class I molecule, allowed efficient lysis by CTL line 58 (Table 4)Citation . Infection of the HLA-A2.1-expressing, but T ag-negative, human Caski or mouse A2.1/SponKC cell lines with rVV-941T, which encodes full-length T ag, led to specific lysis of both cell lines (Table 4)Citation . Infection of these cell lines with rVV-VgB11, which encodes herpes simplex virus 1 gB, failed to result in CTL lysis. This demonstrates that the T ag CTL epitope is processed in both human and mouse cells from full-length T ag. Finally, B6/Scl-7 cells, which lack both HLA-A2.1 and T ag, were coinfected with rVV-A2.1 and rVV-941T, resulting in efficient lysis of target cells. Infection of B6.Scl-7 cells with rVV-A2.1 alone or in combination with rVV-VgB11 failed to induce significant lysis by CTL line 58 (Table 4)Citation . These results demonstrate that CTL line 58 recognizes an HLA-A2.1-restricted epitope processed from endogenous T ag.


View this table:
[in this window]
[in a new window]

 
Table 4 CTL line 58 is A2.1-restricted and T ag-specific

 
Localization of the A2.1-restricted Epitope within T ag.
To broadly localize the A2.1-restricted epitope within SV40 T ag, a panel of cell lines expressing SV40/JCV T ag hybrids was subjected to lytic assays using CTL clone 58.3 (Fig. 2A)Citation . These C57BL/6-derived cell lines were infected with rVV-A2.1 to provide appropriate targets for CTL clone 58.3. First, we determined if CTL clone 58.3 was cross-reactive on T ag epitopes from JCV. Cells expressing full-length SV40 T ag, but not full-length JCV T ag, were specifically lysed after infection with rVV-A2.1 (Fig. 2A)Citation . In addition, CTL clone 58.3 failed to specifically lyse the cell line B6/BKVD-1 (Fig. 2A)Citation , which expresses the full-length T ag derived from BKV. Thus, CTL clone 58.3 is specific for SV40 T ag. Identical results were obtained with CTL line 58 (data not shown). Using the SV40/JCV T ag hybrid cell lines, the target epitope recognized by CTL clone 58.3 was initially mapped between T ag residues 83–410 as indicated by specific lysis of rVV-A2.1-infected cell lines expressing SV40 T ag fragments 83–708 and 1–410, but not cell lines expressing SV40 T ag fragments 1–82 or 411–708 (Fig. 2A)Citation .



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Localization of the HLA-A2.1-restricted epitope within SV40 T ag. A, 51Cr-labeled JCV/SV40 T ag hybrid cell lines were infected with rVV-A2.1 or rVV-Db for 4 h before addition to CTL clone 58.3 at an E:T ratio of 3:1 in a standard 51Cr-release assay. B, 51Cr-labeled B6-derived cell lines were infected with rVV-A2.1 or rVV-Kd for 4 h before combining with CTL clone 58.3 at an E:T ratio of 3:1 in a standard 51Cr-release assay. Cell line names and the corresponding T ag construct expressed are indicated. Amino acid coordinates preceded by {Delta} indicate the region of T ag that is deleted.

 
The target epitope was localized further using a panel of cell lines expressing SV40 T ag deletion mutants (Fig. 2B)Citation . Whereas rVV-A2.1 infection of cell line B6/CPC Cl 8, which expresses full-length T ag, resulted in efficient lysis by CTL clone 58.3, B6/CPC Cl 4, which contains a deletion of T ag 154–351, was not lysed. The B6/CPC Cl 4 cell line serves as an efficient target in CTL assays using the clone Y-4, which recognizes the H-2Kb-restricted epitope IV (T ag sequence 404–411; Ref. 13 ), indicating that this cell line can efficiently process T ag epitopes for CTL recognition. This result localized further the epitope between T ag residues 154 and 351.

To narrow the search for the A2.1-restricted epitope recognized by CTL clone 58.3, the A2.1-expressing human Caski cell line was infected with the Adenovirus/SV40 T ag hybrid viruses Ad2+ND1, which encodes T ag 512–708, or Ad2+ND2, which encodes two overlapping T ag fragments, residues 277–708 and residues 362–708 (27) . Only Ad2+ND2-infected Caski cells were lysed in a 51Cr-release assay (data not shown). In combination with the results obtained using B6/CPC Cl 4 (Fig. 2B)Citation , this result suggested that the T ag epitope was localized between residues 277 and 351. To search for the epitope within this region, C57BL/6-derived cell lines expressing SV40 T ag mutants containing deletions within the amino acid 250 to 350 region were infected with rVV-A2.1 or the control rVV-Kd and subjected to lytic assays using CTL clone 58.3 (Fig. 2B)Citation . Only cells that lack the 252–300 region were resistant to lysis by CTL clone 58.3, whereas cell lines which lack T ag residues 301–350 or 330–350 were lysed after infection with rVV-A2.1. Together, these results indicated that the T ag epitope was located between residues 277 and 300.

Identification of the A2.1-restricted SV40 T ag Epitope as T ag Residues 281–289.
To confirm that the A2.1-restricted epitope was localized to the T ag 277–300 region, a rVV expressing the T ag fragment 275–300 was constructed. The H2-Db-restricted T ag epitope V, residues 489–497, was linked to the carboxyl terminus of T ag 275–300 to verify expression of the recombinant T ag fragment. rVV-T ag 275–300/V effectively targeted lysis of infected cells by an epitope V-specific CTL clone (data not shown), demonstrating successful expression of the minigene product. To provide a sensitive target cell for infection with rVV-T ag 275–300/V, the T ag-negative 143TK- human osteosarcoma cell line, which is efficiently infected by vaccinia viruses, was used as a target cell in lytic assays with CTL clone 58.3 after coinfection with rVV-A2.1 (Fig. 3A)Citation . 143TK- cells coinfected with rVV-T ag 275–300/V + rVV-A2.1 were lysed as efficiently as rVV-941T + rVV-A2.1 coinfected cells, confirming the presence of the A2.1-restricted CTL epitope within the T ag 275–300 region. Cells coinfected with rVV-T ag 275–300/V + rVV-Db were not lysed. In addition, lysis of 143TK- cells by clone 58.3 was not detected after infection with rVV-ES V (Fig. 3A)Citation , which encodes only the epitope V sequence from SV40 T ag (17) , demonstrating that clone 58.3 does not cross-react on epitope V.



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. T ag 281–289 is the target epitope recognized by A2.1-restricted CTL. A, 51Cr-labeled HuTK-143 cells were infected with the indicated vaccinia recombinants and tested for susceptibility to lysis by CTL clone 58.3. B, 51Cr-labeled T2 cells were pulsed with 1 µM synthetic peptides representative of sequences spanning the T ag 277–300 region for 2 h, washed free of peptide, and incubated with CTL clone 58.3 at an E:T ratio of 3:1 in a standard 51Cr-release assay. A peptide corresponding to the HPV 16 E7 82-90 epitope was used as a control. C, peptides corresponding to T ag 281–289 (•), 281–288 ({circ}), 280–288 ({blacksquare}), 282–290 ({square}), and the control epitope HPV16 E7 82-90 ({diamond}) were titrated in the presence of 51Cr-labeled T2 target cells and CTL clone 58.3 at a 3:1 E:T ratio in a 5-h 51Cr-release assay. D, T2 cells were incubated in the presence of 100 µM peptide corresponding to T ag 281–289 (•), 281–288 ({circ}), 280–288 ({blacksquare}), 282–290 ({square}), the control epitope HPV16 E7 82–90 ({diamond}), or no peptide ({diamondsuit}) overnight at 37°C in serum-free media plus 50 µg/ml human ß2m. Peptide was removed and cells were incubated for the indicated times at 37°C in serum-free media, stained with the anti-HLA-A2.1 mAb BB7.2, and analyzed by flow cytometry. E, HLA-A2.1 tetramer and CD8 staining of CTL clone 58.3 and spleen cells derived from A2.1 transgenic mice immunized with A2.1/364-A cells or T ag 281–289 synthetic peptide plus hepatitis B virus core protein epitope 128–140 in incomplete Freund’s Adjuvant, either immediately after isolation or after 6 days of in vitro culture with A2.1/364-A cells, or 5 days of in vitro culture with syngeneic lipopolysaccharide blasts plus 1 µM of T ag 281–289 peptide, respectively. The percentage of CD8+ cells that stained positively with the indicated tetramer is shown in the upper right quadrant.

 
To specifically define the target epitope, a series of peptides were synthesized that spanned the T ag 277–300 region (Table 3)Citation . Peptides which bind to HLA-A2.1 typically are nonamers, which contain a leucine or methionine at peptide position P2 and a hydrophobic residue at the carboxyl terminus (35) . Six peptides were synthesized that correspond to nonamers that contain hydrophobic residues at the carboxyl terminus (Fig. 3B)Citation . Four of these peptides additionally contain a hydrophobic residue at the P2 position. The transported associated with antigen processing (TAP)-negative lymphoblastoid T2 cell line, which expresses HLA-A2.1 molecules that can be loaded efficiently with exogenous peptides (36) , was pulsed with 1 µM T ag synthetic peptides. Only T ag peptide 281-289 (KCDDVLLLL) was recognized by CTL clone 58.3 in a lytic assay (Fig. 3B)Citation . Identical results were obtained using CTL line 58 (data not shown). To determine whether T ag 281–289 represented the optimal epitope, variants of the T ag 281–289 peptide were synthesized, and their abilities to target lysis of T2 cells by clone 58.3 in a peptide titration assay were compared (Fig. 3C)Citation . Peptides in which the epitope was shifted one residue toward the amino (T ag 280–288) or carboxyl (T ag 282–290) terminal were recognized ~10,000-fold less efficiently than T ag 281–289. In addition, removal of the carboxyl-terminal L289 residue reduced the efficiency of CTL recognition ~1,000-fold. Thus, Tag 281–289 represents the optimal peptide recognized by CTL clone 58.3.

Because the sequence of T ag 281–289 does not contain the classical HLA-A2.1-binding motif in which the P2 position is occupied by leucine or methionine, we determined the relative stability of T ag 281–289/HLA-A2.1 complexes versus another known HLA-A2.1-restricted epitope derived from HPV 16 E7, peptide 82–89 (LLMGTLGIV; Ref. 28 ), which contains the classical motif. T2 cells were incubated overnight with 100 µM peptide at 37°C as described (31) to form peptide/HLA-A2.1 complexes at the cell surface. Cells were then washed free of peptide and incubated at 37°C to allow the decay of unstable complexes. HLA-A2.1 expression was monitored by immunofluorescent staining and flow cytometry (Fig. 3D)Citation . The initial level of HLA-A2.1 complexes formed using T ag 281–289 was equivalent to that formed using HPV 16 E7 82-90, whereas variants of T ag 281–289 failed to form detectable complexes with HLA-A2.1. T ag 281–289/HLA-A2.1 complexes also displayed similar kinetics of decay compared with those formed using HPV 16 E7 82-90. These results demonstrate that T ag 281–289 forms relatively stable complexes with HLA-A2.1.

Detection of T ag 281–289-specific CD8+ T Cells from T ag Immunized HLA-A2.1 Transgenic Mice with A2.1/T ag 281–289 Tetramers.
To determine the magnitude of the T ag 281–289-specific CD8+ T cell response in the initial splenocyte populations from immunized A2.1 mice, we developed A2.1/T ag 281–289 tetramers for the direct staining of CD8+ T lymphocytes. A2.1 transgenic mice were immunized with A2.1/364-A cells, and after 11 days, spleen cells were analyzed either ex vivo for the presence of T ag 281–289 specific CD8+ T cells or after 6 days of in vitro restimulation with A2.1/364-A cells. CTL clone 58.3 stained specifically with the A2.1/T ag 281–289 tetramer but not with a control A2.1 tetramer (Fig. 3E)Citation . Ex vivo analysis of spleen cells from A2.1/364-A-immunized A2.1 transgenic mice failed to reveal the presence of T ag 281–289-specific CD8+ T cells (Fig. 3E)Citation . T ag 281–289-specific CD8+ T cells were detected, however, after a brief period of in vitro restimulation. To determine whether this result was attributable to the protocol used for immunization, we immunized A2.1 transgenic mice with a synthetic peptide corresponding to T ag 281–289. As shown for the A2.1/364-A-immunized mice, T ag 281–289-specific CD8+ T cells were not detectable in spleen cells ex vivo at 9 days postimmunization, but were readily detected after a short period of restimulation in vitro with syngeneic lipopolysaccharide blasts and T ag 281–289 peptide (Fig. 3E)Citation . These results suggest that T ag 281–289-specific CD8+ T cells are present at a low frequency in HLA-A2.1 transgenic mice after immunization with A2.1/364-A cells or T ag 281–289 peptide, but are successfully expanded by in vitro restimulation. We note that HLA-A2.1-restricted, T ag-specific lytic activity was only detected in spleen cell cultures that contained T ag 281–289-specific CD8+ T cells (data not shown), indicating that T ag 281–289-specific CD8+ T cells represent the sole A2.1-restricted CTLs detected under these conditions.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
In this study, we identified a CTL recognition epitope derived from the T ag oncoprotein of SV40, which is presented by the human HLA-A2.1 molecule. This epitope, T ag residues 281–289, was efficiently processed from endogenously synthesized T ag for presentation at the cell surface by HLA-A2.1. In addition, epitope 281–289 was processed from T ag by cells of both mouse and human origin for CTL recognition, demonstrating its potential for presentation by HLA-A2.1-positive human tumor cells that express SV40 T ag.

The T ag 281–289 epitope identified in this study lacks the complete consensus motif described for peptides binding to HLA-A2.1, in which the P2 position is most frequently occupied by a leucine or methionine (35) , but instead contains a cysteine residue. The P2 residue has been shown to interact within the hydrophobic B pocket of HLA-A2.1 and contributes toward stabilization of the peptide interaction within the peptide binding groove (37) . The ability of peptide 281–289 to target lysis of T2 cells and stabilize HLA-A2.1 molecules on the surface of T2 cells with significantly greater efficiency than peptide analogues in which the peptide sequence was shifted one residue toward the amino or carboxyl terminus demonstrates that T ag 281–289 represents the optimal peptide epitope. Indeed, this peptide bound as efficiently to HLA-A2.1 as another known HLA-A2.1-restricted CTL epitope from HPV 16 E7. We have determined recently that replacement of the cysteine at P2 of T ag 281–289 with alanine slightly reduces the stability of the HLA-A2.1 complex (data not shown), suggesting that the C282 residue contributes to the stable binding of the T ag 281–289 peptide to HLA-A2.1. Thus, we are confident that T ag 281–289 represents the optimal peptide recognized by the A2.1-restricted CTL.

The specificity of the A2.1 transgenic CTL for SV40 T ag was demonstrated by the lack of recognition of cell lines expressing T ag derived from the human polyomaviruses BKV and JCV. The SV40 T ag epitope 281–289 (KCDDVLLLL) differs from the corresponding sequence in BKV T ag (KCEDVFLLL) at peptide positions P3 and P6 and from JCV T ag (KCEDVFLLM) at these same two residues plus the P9 position. We are currently investigating which of these residues may be critical for CTL recognition. In light of recent reports that T ag protein can be detected in tumor cells that contain SV40-specific DNA sequences (1 , 3 , 38 , 39) and our previous results using H2b-restricted CTL clones to distinguish between tumors expressing T ags from SV40, BKV or JCV (13) , T ag 281–289-specific CTLs might be used to determine whether SV40 T ag epitope 281–289 is processed and presented in HLA-A2.1-expressing human tumor cell lines. We have shown here that T ag 281–289 is processed from full-length T ag in the human cell lines Caski and 143TK- after expression from a rVV. Thus, it is expected that these CTLs will recognize cell lines derived from HLA-A2.1 positive human tumors expressing SV40 T ag.

The frequency of T ag epitope 281–289-specific CD8+ T cells induced by immunization with the syngeneic T ag-transformed kidney cell line A2.1/364-A or T ag 281–289 synthetic peptide was below the limit of detection when measured ex vivo with HLA-A2.1/T ag 281–289 tetramers but represented ~2–3% of the CD8+ T cells after in vitro restimulation. Thus, the efficiency of T cell-induction and expansion in vivo in this system is low. We are currently addressing whether increased numbers of T ag 281–289-specific CD8+ T cells can be recruited using alternate immunization strategies. Thus, it remains to be determined whether T ag 281–289 represents a weak epitope, or whether our results are attributable to the specific transgenic mouse line and/or immunization protocol used. Regardless, the T ag 281–289-specific CTL represented the only A2.1-restricted, T ag-specific CTLs detected after immunization with the T ag-expressing A2.1/364-A cells in these experiments.

Thus, we have identified an SV40 T ag epitope recognized by HLA-A2.1-resticted CTLs that is naturally processed from full-length T ag. Although processing and presentation of an epitope does not guarantee its immunogenicity in humans, these factors are a prerequisite for immunogenicity. Previous investigations into the use of A2.1/Kb transgenic mice to predict CTL epitopes that might be recognized in humans found a good correlation between the epitopes that were immunogenic in A2.1/Kb transgenic mice and in humans (40) . Whether CTLs specific for T ag 281–289 can be elicited from human peripheral blood lymphocytes remains to be determined. If so, T ag 281–289-specific CD8+ T cell responses could be monitored in individuals potentially exposed to SV40. In addition, the possible role of active cellular immunity or tolerance attributable to endogenous T ag expression might be monitored in individuals bearing tumors that have been associated with an increased incidence of SV40-specific sequences (41) . Finally, SV40 T ag expression in human tumors might provide a target for CTLs directed against T ag epitopes such as T ag 281–289 (30) . In summary, we have defined an HLA-A2.1-restricted, SV40 T ag-specific epitope that represents a plausible candidate for a human CTL epitope.


    ACKNOWLEDGMENTS
 
We thank Dr. Victor Engelhard (University of Virginia, Charlottesville, VA) for providing the line A2.1 transgenic mice. We thank Dr. Judy Tevethia (Pennsylvania State University College of Medicine, Hershey, PA) for providing cell lines expressing T ag deletion mutants and for helpful advice in the derivation of A2.1 transgenic cell lines. We thank Dr. Lawrence Mylin (Messiah College, Grantham, PA) for helpful discussions and Melanie Epler (Pennsylvania State University, Hershey, PA) for excellent technical assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Research Grant R37 CA25000 (to S. S. T.) from the National Cancer Institute, NIH. Back

2 To whom requests for reprints should be addressed, at Department of Microbiology and Immunology, H107, Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033. Phone: (717) 531-8872; Fax; (717) 531-5578; E-mail: sst1{at}psu.edu Back

3 The abbreviations used are: T ag, T antigen; BKV, BK virus; JCV, JC virus; FBS, fetal bovine serum; rVV, recombinant vaccinia virus; 51Cr, Chromium-51; HPV, human papilloma virus; gB, glycoprotein B. Back

Received 8/18/00. Accepted 12/ 8/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Butel J. S., Lednicky J. A. Cell and molecular biology of simian virus 40: implications for human infections and disease.. J. Natl. Cancer Inst., 91: 119-134, 1999.
  2. Cory S., Adams J. M. Transgenic mice and oncogenesis.. Annu. Rev. Immunol., 6: 25-48, 1988.[Medline]
  3. Bergsagel D. J., Finegold M. J., Butel J. S., Kupsky W. J., Garcea R. L. DNA sequences similar to those of simian virus 40 in ependymomas and choroid plexus tumors of childhood.. N. Engl. J. Med., 326: 988-993, 1992.[Abstract]
  4. Carbone M., Pass H. I., Rizzo P., Marinetti M., Di Muzio M., Mew D. J., Levine A. S., Procopio A. Simian virus 40-like DNA sequences in human pleural mesothelioma.. Oncogene, 9: 1781-1790, 1994.[Medline]
  5. Imperiale M. J. The human polyomaviruses, BKV and JCV: molecular pathogenesis of acute disease and potential role in cancer.. Virology, 267: 1-7, 2000.[Medline]
  6. Small J. A., Khoury G., Jay G., Howley P. M., Scangos G. A. Early regions of JC virus and Bk virus induce distinct and tissue-specific tumors in transgenic mice.. Proc. Natl. Acad. Sci. USA, 83: 8288-8292, 1986.[Abstract/Free Full Text]
  7. Dalrymple S. A., Beemon K. L. BK virus T antigens induce kidney carcinomas and thymoproliferative disorders in transgenic mice.. J. Virol., 64: 1182-1191, 1990.[Abstract/Free Full Text]
  8. Martini F., Iaccheri L., Lazzarin L., Carinci P., Corallini A., Gerosa M., Iuzzolino P., Barbanti-Brodano G., Tognon M. SV40 early region and large T antigen in human brain tumors, peripheral blood cells, and sperm fluids from healthy individuals.. Cancer Res., 56: 4820-4825, 1996.[Abstract/Free Full Text]
  9. Shah K., Nathanson N. Human exposure to SV40: review and comment.. Am. J. Epidemiol., 103: 1-12, 1976.[Free Full Text]
  10. Tevethia S. S. Recognition of simian virus 40 T antigen by cytotoxic T lymphocytes.. Mol. Biol. Med., 7: 83-96, 1990.[Medline]
  11. Tanaka Y., Tevethia M. J., Kalderon D., Smith A. E., Tevethia S. S. Clustering of antigenic sites recognized by cytotoxic T lymphocyte clones in the amino terminal half of SV40 T antigen.. Virology, 162: 427-436, 1988.[Medline]
  12. Tanaka Y., Anderson R. W., Maloy W. L., Tevethia S. S. Localization of an immunorecessive epitope on SV40 T antigen by H-2Db-restricted cytotoxic T-lymphocyte clones and a synthetic peptide.. Virology, 171: 205-213, 1989.[Medline]
  13. Tevethia S. S., Mylin L., Newmaster R., Epler M., Lednicky J. A., Butel J. S., Tevethia M. J. Cytotoxic T lymphocyte recognition sequences as markers for distinguishing among tumour antigens encoded by SV40, BKV and JCV.. Dev. Biol. Stand., 94: 329-339, 1998.[Medline]
  14. Le A. X., Bernhard E. J., Holterman M. J., Strub S., Parham P., Lacy E., Engelhard V. H. Cytotoxic T cell responses in HLA-A2.1 transgenic mice.. Recognition of HLA alloantigens and utilization of HLA-A2.1 as a restriction element. J. Immunol., 142: 1366-1371, 1989.[Abstract]
  15. Mylin L. M., Deckhut A. M., Bonneau R. H., Kierstead T. D., Tevethia M. J., Simmons D. T., Tevethia S. S. Cytotoxic T lymphocyte escape variants, induced mutations, and synthetic peptides define a dominant H-2Kb-restricted determinant in simian virus 40 tumor antigen.. Virology, 208: 159-172, 1995.[Medline]
  16. Mylin L. M., Schell T. D., Roberts D., Epler M., Boesteanu A., Collins E. J., Frelinger J. A., Joyce S., Tevethia S. S. Quantitation of CD8+ T-lymphocyte responses to multiple epitopes from simian virus 40 (SV40) large T antigen in C57BL/6 mice immunized with SV40, SV40 T-antigen-transformed cells, or vaccinia virus recombinants expressing full-length T antigen or epitope minigenes.. J. Virol., 74: 6922-6934, 2000.[Abstract/Free Full Text]
  17. Fu T-M., Mylin L. M., Schell T. D., Bacik I., Russ G., Yewdell J. W., Bennink J. R., Tevethia S. S. An endoplasmic reticulum-targeting signal sequence enhances the immunogenicity of an immunorecessive simian virus 40 large T antigen cytotoxic T-lymphocyte epitope.. J. Virol., 72: 1469-1481, 1998.[Abstract/Free Full Text]
  18. Pretell J., Greenfield R. S., Tevethia S. S. Biology of simian virus 40 (SV40) transplantation rejection antigen (TrAg).. In vitro demonstration of SV40 TrAg in SV40 infected non-permissive mouse cells by the lymphocyte-mediated cytotoxicity assay. Virology, 97: 32-41, 1979.[Medline]
  19. Thompson D. L., Kalderon D., Smith A. E., Tevethia M. J. Dissociation of Rb-binding and anchorage-independent growth from immortalization and tumorigenicity using SV40 mutants producing N-terminally truncated large T antigens.. Virology, 178: 15-34, 1990.[Medline]
  20. Pattillo R. A., Hussa R. O., Story M. T., Ruckert A. C., Shalaby M. R., Mattingly R. F. Tumor antigen and human chorionic gonadotropin in CaSki cells: a new epidermoid cervical cancer cell line.. Science (Washington DC), 196: 1456-1458, 1977.[Abstract/Free Full Text]
  21. Deckhut A. M., Tevethia M. J., Haggerty S., Frisque R. J., Tevethia S. S. Localization of common cytotoxic T lymphocyte recognition epitopes on simian papovavirus SV40 and human papovavirus JC virus T antigens.. Virology, 183: 122-132, 1991.[Medline]
  22. Kierstead T. D., Tevethia M. J. Association of p53 binding and immortalization of primary C57BL/6 mouse embryo fibroblasts by using simian virus 40 T-antigen mutants bearing internal overlapping deletion mutations.. J. Virol., 67: 1817-1829, 1993.[Abstract/Free Full Text]
  23. Salter R. D., Howell D. N., Cresswell P. Genes regulating HLA class I antigen expression in T-B lymphoblast hybrids.. Immunogenetics, 21: 235-246, 1985.[Medline]
  24. Cantin E. M., Eberle R., Baldick J. L., Moss B., Willey D. E., Notkins A. L., Openshaw H. Expression of herpes simplex virus glycoprotein B by a recombinant vaccinia virus and protection of mice against lethal herpes simplex virus 1 infection.. Proc. Natl. Acad. Sci. USA, 84: 5908-5912, 1987.[Abstract/Free Full Text]
  25. O’Neil B. H., Kawakami Y., Restifo N. P., Bennink J. R., Yewdell J. W., Rosenberg S. A. Detection of shared MHC-restricted human melanoma antigens after vaccinia virus-mediated transduction of genes coding for HLA.. J. Immunol., 151: 1410-1418, 1993.[Abstract]
  26. Bacik I., Cox J. H., Anderson R., Yewdell J. W., Bennink J. R. TAP (transporter associated with antigen processing)-independent presentation of endogenously synthesized peptides is enhanced by endoplasmic reticulum insertion sequences located at the amino- but not carboxyl-terminus of the peptide.. J. Immunol., 152: 381-387, 1994.[Abstract]
  27. Lewis A. M., Jr. Defective and nondefective AD2-SV40 hybrids.. Prog. Med. Virol., 23: 96-139, 1977.[Medline]
  28. Ressing M. E., Sette A., Brandt R. M. P., Ruppert J., Wentworth P. A., Hartman M., Oseroff C., Grey H. M., Melief C. J. M., Kast W. M. Human CTL epitopes encoded by human papillomavirus type 16 E6 and E7 identified through in vivo and in vitro immunogenicity studies of HLA-A*0201-binding peptides.. J. Immunol., 154: 5934-5943, 1995.[Abstract]
  29. Millich D. R., Hughes J. L., McLachlan A., Thornton G. B., Moriarty A. Hepatitis B synthetic immunogen comprised of nucleocapsid T-cell sites and an envelope B-cell epitope.. Proc. Natl. Acad. Sci. USA, 85: 1610-1614, 1988.[Abstract/Free Full Text]
  30. Schell T. D., Mylin L. M., Georgoff I., Teresky A. K., Levine A. J., Tevethia S. S. Cytotoxic T-lymphocyte epitope immunodominance in the control of choroid plexus tumors in simian virus 40 large T antigen transgenic mice.. J. Virol., 73: 5981-5993, 1999.[Abstract/Free Full Text]
  31. Kast W. M., Brandt R. M., Drijfhout J. W., Melief C. J. Human leukocyte antigen-A2.1 restricted candidate cytotoxic T lymphocyte epitopes of human papillomavirus type 16 E6 and E7 proteins identified by using the processing-defective human cell line T2.. J. Immunother., 14: 115-120, 1993.
  32. Altman J. D., Moss P. A. H., Goulder P. J. R., Barouch D. H., McHeyzer-Williams M. G., Bell J. I., McMichael A. J., Davis M. M. Phenotypic analysis of antigen-specific T lymphocytes.. Science (Washington DC), 274: 94-96, 1996.[Abstract/Free Full Text]
  33. Yang O. O., Kalams S. A., Rosenzweig M., Trocha A., Jones N., Koziel M., Walker B. D., Johnson R. P. Efficient lysis of human immunodeficiency virus type 1-infected cells by cytotoxic T lymphocytes.. J. Virol., 70: 5799-5806, 1996.[Abstract]
  34. Man S., Newberg M. H., Crotzer V. L., Luckey C. J., Williams N. S., Chen Y., Huczko E. L., Ridge J. P., Engelhard V. H. Definition of a human T cell epitope from influenza A non-structural protein 1 using HLA-A2.1 transgenic mice.. Int. Immunol., 7: 597-605, 1995.[Abstract/Free Full Text]
  35. Rammensee H-G., Friede T., Stevanovic S. MHC ligands and peptide motifs: first listing.. Immunogenetics, 41: 178-228, 1995.[Medline]
  36. Hosken N. A., Bevan M. J. Defective presentation of endogenous antigen by a cell line expressing class I molecules.. Science (Washington DC), 248: 367-370, 1990.[Abstract/Free Full Text]
  37. Madden D. R. The three-dimensional structure of peptide-MHC complexes.. Annu. Rev. Immunol., 13: 587-622, 1995.[Medline]
  38. Carbone M., Rizzo P., Grimley P. M., Procopio A., Mew D. J., Shridhar V., de Bartolomeis A., Esposito V., Giuliano M. T., Steinberg S. M., Levine A. S., Giordano A., Pass H. I. Simian virus-40 large-T antigen binds p53 in human mesotheliomas.. Nat. Med., 3: 908-912, 1997.[Medline]
  39. De Luca A., Baldi A., Esposito V., Howard C. M., Bagella L., Rizzo P., Caputi M., Pass H. I., Giordano G. G., Baldi F., Carbone M., Giordano A. The retinoblastoma gene family pRb/p105, p107, pRb2/p130 and simian virus-40 large T-antigen in human mesotheliomas.. Nat. Med., 3: 913-916, 1997.[Medline]
  40. Wentworth P. A., Vitiello A., Sidney J., Keogh E., Chesnut R. W., Grey H., Sette A. Differences and similarities in the A2.1-restricted cytotoxic T cell repertoire in humans and human leukocyte antigen-transgenic mice.. Eur. J. Immunol., 26: 97-101, 1996.[Medline]
  41. Schell T. D., Knowles B. B., Tevethia S. S. Sequential loss of cytotoxic T lymphocyte responses to simian virus 40 large T antigen epitopes in T antigen transgenic mice developing osteosarcomas.. Cancer Res., 60: 3002-3012, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. N. Hasan, W. J. Kollen, D. Trivedi, A. Selvakumar, B. Dupont, M. Sadelain, and R. J. O'Reilly
A Panel of Artificial APCs Expressing Prevalent HLA Alleles Permits Generation of Cytotoxic T Cells Specific for Both Dominant and Subdominant Viral Epitopes for Adoptive Therapy
J. Immunol., August 15, 2009; 183(4): 2837 - 2850.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Hu, X. Peng, L. R. Budgeon, N. M. Cladel, K. K. Balogh, and N. D. Christensen
Establishment of a Cottontail Rabbit Papillomavirus/HLA-A2.1 Transgenic Rabbit Model
J. Virol., July 1, 2007; 81(13): 7171 - 7177.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Hu, X. Peng, T. D. Schell, L. R. Budgeon, N. M. Cladel, and N. D. Christensen
An HLA-A2.1-Transgenic Rabbit Model to Study Immunity to Papillomavirus Infection
J. Immunol., December 1, 2006; 177(11): 8037 - 8045.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Wang, H. Chen, X. Jiang, M. Zhang, T. Wan, N. Li, X. Zhou, Y. Wu, F. Yang, Y. Yu, et al.
Identification of an HLA-A*0201-restricted CD8+ T-cell epitope SSp-1 of SARS-CoV spike protein
Blood, July 1, 2004; 104(1): 200 - 206.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Xia, Y. Tanaka, S. Koido, C. Liu, P. Mukherjee, S. J. Gendler, and J. Gong
Prevention of Spontaneous Breast Carcinoma by Prophylactic Vaccination with Dendritic/Tumor Fusion Cells
J. Immunol., February 15, 2003; 170(4): 1980 - 1986.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schell, T. D.
Right arrow Articles by Tevethia, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schell, T. D.
Right arrow Articles by Tevethia, S. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online