| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Flinders Cancer Centre, Department of Surgery, Flinders University School of Medicine and Flinders Medical Centre, Adelaide, South Australia 5042, Australia [A. J. S., C. R., K. M., W. D. T., D. J. H.], and Division of Life Sciences, Cell and Molecular Biology, University of Texas at San Antonio, San Antonio, Texas 78249 [R. G. L.].
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
Primary cell cultures grown on coverslips were characterized using specific monoclonal antibodies to cytokeratin (Signet Laboratories Inc., Dedham, MA), vimentin (Biogenex Laboratories, San Ramon, CA), and desmin (Dako, New South Wales, Australia) using standard immunohistochemical techniques.
RT-PCR Detection of Versican Expression by Fibroblasts and
Prostate Cancer Cell Lines.
Total cellular RNA was isolated from prostatic fibroblasts and prostate
cancer cell lines (LNCaP, PC3, and DU145) using a modification of the
method of Chomczynski and Sacchi, as described previously
(6)
. Total RNA (1 µg) was reverse transcribed using
random hexamers and Reverse Transcriptase Superscript II (1 µl) in a
total volume of 20 µl, as described by the manufacturer (Life
Technologies, Inc.). Controls included for each reaction were the RNA
sample without reverse transcriptase (RNA-RT) and no RNA with reverse
transcriptase (no RNA+RT). PCR reactions were performed by combining 2
µl of cDNA from each sample with 14 µl of
H2O, 2 µl (25 mM
MgCl2), 5 µl of 5x reaction buffer [50
mM KCl and 10 mM Tris-Cl (pH 8.3)], 1 µl (50
ng) of sense and antisense primers, 1 µl (0.4 unit/ml) of Taq
polymerase (Bresatec, Adelaide, Australia), and 30 µl of mineral
oil. Versican sense sequence 1
(5'-CGGGATCCGGGGTGAGAACCCTGTATCG-3', 12271243, exon 6)
and versican antisense
(5'-ACTCTAGAGGCCACGCCTAGCTTCTGCAGC-3', 45634541, exon 8)
primers were used to amplify the V1 isoform of versican (375 bp),
whereas versican sense sequence 2
(ACAAGCTTACACAGCCAACAAGACCA, 41284145, exon 7) and the
same antisense primer were used to amplify the V0 isoform (436
bp). Nucleotide positions of the sense and antisense
oligonucleotide primers are in accordance with the published versican
V0 cDNA sequence (7)
. The primers also included
restriction enzyme sites (underlined) plus two additional
bases, respectively, at their 5' ends to facilitate cloning into
Bluescript plasmid vectors. The PCR reaction involved an initial
denaturation at 95°C for 5 min, followed by 30 cycles of annealing
for 2 min at 65°C, extension for 3 min at 62°C, and denaturation
for 3 min at 95°C, with a final 20-min extension at 72°C. RT-PCR
reactions were also performed using GAPDH primers as a positive control
for each reaction (sense, 5'-ACCACAGTCCATGCCATCAC-3'; antisense,
5'-TCCACCACCCTGTTGCTGTA-3'; 452-bp product). The PCR reaction for GAPDH
involved an initial denaturation at 94°C for 3 min, followed by 35
cycles of annealing for 45 s at 60°C, extension for 1 min at
72°C, and denaturation for 30 s at 94°C, with a final 10-min
extension at 72°C. RNA-RT, no RNA+RT, and no DNA controls were
included with each PCR run. PCR products were sequenced to confirm the
identity of the cDNA bands using standard techniques.
Collection of Cancer Cell-conditioned Medium.
The human prostate adenocarcinoma cell lines, LNCaP, PC3, and DU145,
were grown in 80-cm2 flasks in 10 ml of cRPMI
plus 5% FBS. At cell confluence, the culture medium was changed to
cRPMI plus 0.5% FBS, and 24 h later, the medium was changed to
serum-free cRPMI containing ITS (Sigma). After 72 h of growth in
cRPMI plus ITS, the conditioned medium was harvested and stored frozen
at -70°C. Control medium was collected in parallel from tissue
culture flasks containing no cells. All prostate cancer cell lines were
determined to be Mycoplasma-free by PCR.
Treatment of Fibroblasts with Cancer Cell-conditioned Medium,
TGF-ß1, and Anti-TGF-ß1.
Two primary cultures of prostatic fibroblasts at confluence were
trypsinized (0.05% trypsin and 0.02% EDTA), and cells (1 x 104 cells/cm2 )
were plated into 80-cm2 flasks containing 10 ml
of cRPMI plus 5% FBS. After 4 days of culture, the medium was changed
to cRPMI plus 0.5% FBS, and after an additional 24 h of culture,
the cells were washed with 2 ml of cRPMI plus ITS. Control or
conditioned medium from the prostate cancer cell lines (thawed and
filtered through 0.22 µm membranes and diluted 1:1 in cRPMI plus ITS)
was added to the fibroblast monolayers. After 24, 48, and 72 h of
culture, the culture medium was harvested. To inhibit proteolytic
degradation of versican, one protease inhibitor tablet (Boehringer
Mannheim, Mannheim, Germany) was added per 50 ml of harvested medium.
The culture medium was stored at -70°C until use in immunoblot
analysis.
To determine whether TGF-ß1 is a candidate paracrine mediator of increased versican levels, conditioned medium from the prostate cancer cell lines was added to the fibroblast monolayers, with or without the addition of TGF-ß1-neutralizing antibody (raised in chicken; Life Technologies, Inc.). Fibroblasts were also grown in control medium (as described previously) and treated with 10 ng/ml TGF-ß1 (Life Technologies, Inc.) with or without 15 µg/ml anti-TGF-ß1 antibody. For cell cultures treated with both growth factor and antibody or with antibody alone, the reagents were incubated in 100 µl of cRPMI plus ITS or 5 ml of cancer cell-conditioned medium, respectively, at room temperature for 1 h before the addition to the cell cultures. After 72 h, culture media were harvested as described above and stored at -70°C.
Immunoblot Analysis of Versican Expression.
Molecules in the thawed conditioned medium were concentrated 50-fold
using Centristart I centrifuge tubes (Sartorius, Goettingen, Germany)
with a molecular weight cutoff of 300,000 at 4°C for 4 h
at 2,000 x g.
To allow electrophoretic migration of versican on 5% polyacrylamide
gels, CS side chains were cleaved from the core protein
(Mr
400,000) by chondroitinase
ABC (0.4 units/ml; Sigma) for 3 h at 37°C. Sample buffer
[0.5 M Tris-HCl (pH 6.8), 10% (w/v) glycerol,
2% (w/v) SDS, 0.05% (v/v) ß-mercaptoethanol, and 0.0025% (w/v)
bromphenol blue] was added to each sample in a 1:1 ratio, and the
samples were incubated at 95°C for 5 min.
An equal volume (10 µl) of each sample was loaded into the wells of 5% polyacrylamide gels. Five µl of See Blue prestained standard molecular weight markers (Novex, San Diego, CA) were loaded after incubation at 95°C for 5 min. The gels were run in a Bio-Rad mini Protean II cell. Electrophoresis in Tris-glycine buffer pH 8.8, protein blotting, and immunostaining were performed by standard procedures. The membranes were incubated in rabbit antibody to recombinant human versican (Ref. 8 ; diluted 1:1000 in Tris-buffered saline and 0.1% Tween) for 2 h. Visualization was achieved by antirabbit IgG alkaline phosphatase-linked secondary antibody (Amersham, Buckinghamshire, United Kingdom). Measurement was achieved by the use of ECF (Amersham) and FluorImager scanning (Molecular Dynamics, Melbourne, Australia). All detected bands of versican were determined to be within the linear range of detection (data not shown). As an internal control for protein loading, an equal volume (10 µl) of each sample was run on an acrylamide gel and stained with Coomassie Blue using standard techniques. A protein band corresponding to the molecular weight of transferrin (a component of ITS) was identified for each sample and measured by laser densitometry.
Effect of Cancer Cell-conditioned Medium on Fibroblast
Proliferation.
Primary fibroblast cultures were plated into 96-well plates at a
density of 4 x 103
cells/well and
grown in cRPMI plus 5% FBS. After 4 days, the culture medium was
changed to cRPMI plus 0.5% FBS. After an additional 24 h, the
cells were washed with cRPMI plus ITS. Control or conditioned medium
from the prostate cancer cell lines was added to the fibroblast
monolayers. At each time point (24, 48, and 72 h), 0.1 mg of
aqueous MTT (Sigma) was added to each well and incubated at 37°C for
4 h. This was followed by the addition of 100 µl of 20% SDS in
0.02 M HCl, and then the cells were left to solubilize
overnight in a dark environment at room temperature. The plates were
then read in a microplate reader (Bio-Rad 450, Bio-Rad, Sydney,
Australia) using a dual wavelength setting of 570 and 655 nm, and the
cell numbers were calculated using a standard plot of known cell
number.
| Results |
|---|
|
|
|---|
No cytokeratin immunostaining was observed in the primary cell cultures, indicating that the cells were unlikely to be of epithelial origin. Vimentin staining was observed in 100% of cells in the primary cultures, confirming their mesenchymal origin. Staining with the antidesmin antibody indicated that the cell cultures contained approximately 5% smooth muscle cells.
RT-PCR of Versican mRNA in Cultured Prostate Cells.
Primary cultures of prostatic fibroblasts expressed the expected sizes
(436 and 375 bp, respectively) of the V0 and V1 isoforms of versican
RNA, whereas the prostate cancer cell lines (LNCaP, PC3, and DU145)
lacked detectable V1 or V0 versican RNA (Fig. 1, A and B)
. No bands were detected for the
controls, no RNA+RT, RNA-RT, and no DNA (data not shown). The PCR
products for V1 and V0 were sequenced and confirmed to be human
versican sequences. Bands corresponding to GAPDH were observed for all
reactions (data not shown).
|
|
|
|
| Discussion |
|---|
|
|
|---|
In this study, versican isoforms V0 and V1 were shown by RT-PCR to be expressed by prostatic fibroblasts, but not by any of the prostate cancer cell lines tested. Similarly, no versican protein was detected in the culture medium of LNCaP, PC3, and DU145 prostate cancer cells by immunoblotting. This observation is consistent with previous immunohistochemical studies that suggest that versican is expressed exclusively in the prostatic stroma (2) . The spatial separation of the stromal versican deposition from cancer cells in prostate tissue sections implies production of a soluble mediator by prostate cancer cells. In support of this hypothesis, conditioned media from LNCaP, PC3, and DU145 adenocarcinoma cell lines stimulated increased accumulation of the V0 and V1 isoforms of versican in culture medium from prostatic fibroblasts. Similarly, human colon carcinoma cells produce an undefined class of polypeptides that stimulate the synthesis and release of 35S-sulfated proteoglycans into culture medium by normal colon fibroblasts (9) .
The increased accumulation of versican with time was not due to an increased proliferation rate by fibroblasts cultured in cancer cell-conditioned medium compared with control medium. Indeed, the use of cancer cell-conditioned medium led to a decrease in the rate of fibroblast proliferation, possibly due to a depletion of nutrients in the cancer cell-conditioned medium. Similarly, conditioned medium from colon carcinoma cells up-regulated CS proteoglycan secretion without inducing cell proliferation (9) .
The increased incidence of prostate specific antigen relapse in patient groups with higher levels of versican in the peritumoral stroma suggests that the level of versican is directly correlated with the aggressiveness of prostate cancer cells. In this study, PC3 and DU145 cell lines stimulated versican secretion by fibroblasts to a greater degree than LNCaP prostate cancer cells. PC3 and DU145 cancer cells have been considered to demonstrate a more aggressive phenotype than LNCaP cells, based on their androgen independence and the production of extensive metastatic deposits in nude mice (10) . Versican secretion has been reported to be up-regulated in arterial smooth muscle cells and in skin fibroblasts by TGF-ß1 (5 , 11) . TGF-ß1 and TGF-ß2 mRNA and protein have been detected in both the PC3 and DU145 cell lines (12) , whereas LNCaP cells are known to express TGF-ß1 mRNA (13) . TGF-ß1 is expressed at higher levels in prostate cancer than in the normal prostate (14) and is associated with a worse clinical outcome (15) . In this study, we demonstrate that TGF-ß1 enhanced the level of versican accumulation in the culture medium of prostatic fibroblasts and that neutralizing antibody to TGF-ß1 inhibited the ability of prostate cancer cell-conditioned medium to stimulate versican accumulation. We are currently examining additional specific neutralizing antibodies to determine other candidate growth factors in prostate cancer cell-conditioned medium.
The ability of malignant epithelial cells to regulate versican secretion by fibroblasts may have implications for tumor metastasis. Accumulation of versican in the ECM surrounding a tumor could be a crucial aspect of remodeling of the stroma, resulting in an environment that supports tumor cell proliferation and invasion. Several lines of evidence suggest that versican and hyaluronan may play a role in cell motility. Substrata rich in versican and hyaluronan promote movement and proliferation of arterial smooth muscle cells (16) and astrocytoma cells (17) . Versican may act as a bridge between hyaluronan and cell surfaces, thereby anchoring hyaluronan (18) . Removal of CS from versican core protein by chondroitinase ABC treatment eliminates the antiadhesive action of versican for neonatal dorsal root ganglion neurons and Schwann cells (19) . It therefore appears that the antiadhesive properties of versican are mediated through complementary functions of the core-protein and the CS side chains. Although this study did not investigate any posttranslational modifications to the versican molecule, such as changes in the length and composition of the CS side chains, our results indicate that prostate cancer cells, as a minimum, induce an increase in the amount of versican molecules detected in fibroblast-conditioned medium.
In conclusion, neoplastic remodeling of the ECM through modulation of stromal cell secretion of macromolecules such as versican may be one mechanism by which prostate tumor cells control their microenvironment to facilitate local invasion and metastasis.
| FOOTNOTES |
|---|
1 Supported by the National Health and Medical
Research Council of Australia, the Anti-Cancer Foundation of South
Australia, the Flinders Medical Centre Foundation, and NIH Grant
GM08194. ![]()
2 To whom requests for reprints should be
addressed, at Flinders Cancer Centre, Department of Surgery, Flinders
Medical Centre, Bedford Park, Adelaide, South Australia 5042,
Australia. Phone: (618) 82044389; Fax: (618) 82045899; E-mail: david.horsfall{at}flinders.edu.au ![]()
3 The abbreviations used are: CS, chondroitin
sulfate; ECF, enhanced chemifluorescence; ECM, extracellular matrix;
FBS, fetal bovine serum; GAPDH, glyceraldehyde 3-phosphate
dehydrogenase; ITS, insulin, transferrin, and sodium selenite medium
supplement; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide; RT-PCR, reverse transcription-PCR; TGF, transforming growth
factor; cRPMI, complete RPMI. ![]()
Received 9/25/00. Accepted 12/ 8/00.
| REFERENCES |
|---|
|
|
|---|
-dihydrotestosterone on guinea-pig prostate smooth muscle cell proliferation and steroid receptor expression in vitro.. J. Endocrinol., 140: 373-383, 1994.
- and
-interferon and tumor necrosis factor alone or in combinations against two prostate cancer xenografts transplanted in nude mice.. Prostate, 18: 331-344, 1991.[Medline]
This article has been cited by other articles:
![]() |
E. M. Kozma, K. Olczyk, G. Wisowski, A. Glowacki, and R. Bobinski Alterations in the Extracellular Matrix Proteoglycan Profile in Dupuytren's Contracture Affect the Palmar Fascia J. Biochem., April 1, 2005; 137(4): 463 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Russell, S. A. Ochsner, M. Hsieh, S. Mulders, and J. S. Richards Hormone-Regulated Expression and Localization of Versican in the Rodent Ovary Endocrinology, March 1, 2003; 144(3): 1020 - 1031. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Tuxhorn, G. E. Ayala, M. J. Smith, V. C. Smith, T. D. Dang, and D. R. Rowley Reactive Stroma in Human Prostate Cancer: Induction of Myofibroblast Phenotype and Extracellular Matrix Remodeling Clin. Cancer Res., September 1, 2002; 8(9): 2912 - 2923. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ricciardelli, J. H. Brooks, S. Suwiwat, A. J. Sakko, K. Mayne, W. A. Raymond, R. Seshadri, R. G. LeBaron, and D. J. Horsfall Regulation of Stromal Versican Expression by Breast Cancer Cells and Importance to Relapse-free Survival in Patients with Node-negative Primary Breast Cancer Clin. Cancer Res., April 1, 2002; 8(4): 1054 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Touab, J. Villena, C. Barranco, M. Arumi-Uria, and A. Bassols Versican Is Differentially Expressed in Human Melanoma and May Play a Role in Tumor Development Am. J. Pathol., February 1, 2002; 160(2): 549 - 557. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |