Cancer Research Versailles No Abst  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakko, A. J.
Right arrow Articles by Horsfall, D. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sakko, A. J.
Right arrow Articles by Horsfall, D. J.
[Cancer Research 61, 926-930, February 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Versican Accumulation in Human Prostatic Fibroblast Cultures Is Enhanced by Prostate Cancer Cell-derived Transforming Growth Factor ß11

Andrew J. Sakko, Carmela Ricciardelli, Keiko Mayne, Wayne D. Tilley, Richard G. LeBaron and David J. Horsfall2

Flinders Cancer Centre, Department of Surgery, Flinders University School of Medicine and Flinders Medical Centre, Adelaide, South Australia 5042, Australia [A. J. S., C. R., K. M., W. D. T., D. J. H.], and Division of Life Sciences, Cell and Molecular Biology, University of Texas at San Antonio, San Antonio, Texas 78249 [R. G. L.].


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We have previously demonstrated that peritumoral stromal matrix derived from prostate cancer patients who relapse after radical surgery contains elevated levels of versican. The purpose of this study was to determine whether prostate cancer cells control stromal cell secretion of versican. Serum-free conditioned medium from three prostate adenocarcinoma cell lines, LNCaP, PC3, and DU145, was added to cultures of fibroblasts established from prostatic tissue of patients with benign prostatic hyperplasia, and the medium was harvested at 24, 48, and 72 h. Immunoblotting with an antiversican core protein antibody revealed that prostatic fibroblast medium harvested at 72 h contained increased levels of versican after treatment with either LNCaP-, PC3- or DU145-conditioned medium (2.5-, 4.5-, and 5-fold, respectively) compared with control cultures. This increase in versican in the culture medium was not observed after coincubation with transforming growth factor ß1-neutralizing antisera. The results of this study suggest that prostate tumor cells induce host stromal cells to secrete increased versican levels via a paracrine mechanism mediated by transforming growth factor ß1.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Stromal-epithelial interactions play critical roles in the development, maintenance, and functional activity of the prostate gland. Stromal-epithelial interactions also facilitate malignant growth of the prostate gland. For instance, cancer-associated fibroblasts stimulate tumor formation by immortalized but nontumorigenic epithelial cells in an in vivo tissue recombination system (1) . Remodeling of the peritumoral stroma associated with altered regulation of metalloproteinases and adhesive molecules is essential for local invasion and the establishment of metastases. We have demonstrated previously that an increase in the concentration of the CS3 proteoglycan versican, an antiadhesive molecule within the peritumoral stroma, was associated with an increased risk of developing metastatic disease after radical prostatectomy (2 , 3) . Because versican appears to be exclusively associated with the stromal compartment of the prostate, we proposed that epithelial cells and, in particular, tumor cells regulate stromal versican concentrations. A potential mediator for such an interaction is TGF-ß1, which has been shown to increase versican expression by cultured smooth muscle cells (4) and normal human skin and gingival fibroblasts (5) . Therefore, the aim of this study was to investigate whether prostate cancer cells regulate versican accumulation in the culture medium of primary cultures of prostatic fibroblasts, and whether this might be achieved by production of a paracrine growth factor such as TGF-ß1.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Establishment of Primary Cultures of Prostatic Fibroblasts.
Fibroblasts were isolated from prostatic tissue obtained from consenting patients undergoing transurethral resection of the prostate to resolve clinical symptoms of benign prostatic hyperplasia. The tissue was digested as described previously (6) , except that the enzyme concentrations used were 225 units/ml type II collagenase (Sigma, St. Louis, MO) and 125 units/ml type V hyaluronidase (Sigma), and further digested with 0.25% trypsin (Life Technologies, Inc.). The resultant fibroblast suspension was maintained in culture to passage 2 or 3 and then cryopreserved in RPMI 1640 (Life Technologies, Inc., Grand Island, NY) containing 4 mM L-glutamine, 100 µg/ml penicillin, 100 µg/ml streptomycin, and 2 µg/ml amphotericin B (referred to hereafter as cRPMI) supplemented with 10% DMSO. Fibroblast cultures derived from these stocks were grown in cRPMI plus 5% FBS. PCR analysis demonstrated the primary cell cultures to be free of Mycoplasma.

Primary cell cultures grown on coverslips were characterized using specific monoclonal antibodies to cytokeratin (Signet Laboratories Inc., Dedham, MA), vimentin (Biogenex Laboratories, San Ramon, CA), and desmin (Dako, New South Wales, Australia) using standard immunohistochemical techniques.

RT-PCR Detection of Versican Expression by Fibroblasts and Prostate Cancer Cell Lines.
Total cellular RNA was isolated from prostatic fibroblasts and prostate cancer cell lines (LNCaP, PC3, and DU145) using a modification of the method of Chomczynski and Sacchi, as described previously (6) . Total RNA (1 µg) was reverse transcribed using random hexamers and Reverse Transcriptase Superscript II (1 µl) in a total volume of 20 µl, as described by the manufacturer (Life Technologies, Inc.). Controls included for each reaction were the RNA sample without reverse transcriptase (RNA-RT) and no RNA with reverse transcriptase (no RNA+RT). PCR reactions were performed by combining 2 µl of cDNA from each sample with 14 µl of H2O, 2 µl (25 mM MgCl2), 5 µl of 5x reaction buffer [50 mM KCl and 10 mM Tris-Cl (pH 8.3)], 1 µl (50 ng) of sense and antisense primers, 1 µl (0.4 unit/ml) of Taq polymerase (Bresatec, Adelaide, Australia), and 30 µl of mineral oil. Versican sense sequence 1 (5'-CGGGATCCGGGGTGAGAACCCTGTATCG-3', 1227–1243, exon 6) and versican antisense (5'-ACTCTAGAGGCCACGCCTAGCTTCTGCAGC-3', 4563–4541, exon 8) primers were used to amplify the V1 isoform of versican (375 bp), whereas versican sense sequence 2 (ACAAGCTTACACAGCCAACAAGACCA, 4128–4145, exon 7) and the same antisense primer were used to amplify the V0 isoform (436 bp). Nucleotide positions of the sense and antisense oligonucleotide primers are in accordance with the published versican V0 cDNA sequence (7) . The primers also included restriction enzyme sites (underlined) plus two additional bases, respectively, at their 5' ends to facilitate cloning into Bluescript plasmid vectors. The PCR reaction involved an initial denaturation at 95°C for 5 min, followed by 30 cycles of annealing for 2 min at 65°C, extension for 3 min at 62°C, and denaturation for 3 min at 95°C, with a final 20-min extension at 72°C. RT-PCR reactions were also performed using GAPDH primers as a positive control for each reaction (sense, 5'-ACCACAGTCCATGCCATCAC-3'; antisense, 5'-TCCACCACCCTGTTGCTGTA-3'; 452-bp product). The PCR reaction for GAPDH involved an initial denaturation at 94°C for 3 min, followed by 35 cycles of annealing for 45 s at 60°C, extension for 1 min at 72°C, and denaturation for 30 s at 94°C, with a final 10-min extension at 72°C. RNA-RT, no RNA+RT, and no DNA controls were included with each PCR run. PCR products were sequenced to confirm the identity of the cDNA bands using standard techniques.

Collection of Cancer Cell-conditioned Medium.
The human prostate adenocarcinoma cell lines, LNCaP, PC3, and DU145, were grown in 80-cm2 flasks in 10 ml of cRPMI plus 5% FBS. At cell confluence, the culture medium was changed to cRPMI plus 0.5% FBS, and 24 h later, the medium was changed to serum-free cRPMI containing ITS (Sigma). After 72 h of growth in cRPMI plus ITS, the conditioned medium was harvested and stored frozen at -70°C. Control medium was collected in parallel from tissue culture flasks containing no cells. All prostate cancer cell lines were determined to be Mycoplasma-free by PCR.

Treatment of Fibroblasts with Cancer Cell-conditioned Medium, TGF-ß1, and Anti-TGF-ß1.
Two primary cultures of prostatic fibroblasts at confluence were trypsinized (0.05% trypsin and 0.02% EDTA), and cells (1 x 104 cells/cm2 ) were plated into 80-cm2 flasks containing 10 ml of cRPMI plus 5% FBS. After 4 days of culture, the medium was changed to cRPMI plus 0.5% FBS, and after an additional 24 h of culture, the cells were washed with 2 ml of cRPMI plus ITS. Control or conditioned medium from the prostate cancer cell lines (thawed and filtered through 0.22 µm membranes and diluted 1:1 in cRPMI plus ITS) was added to the fibroblast monolayers. After 24, 48, and 72 h of culture, the culture medium was harvested. To inhibit proteolytic degradation of versican, one protease inhibitor tablet (Boehringer Mannheim, Mannheim, Germany) was added per 50 ml of harvested medium. The culture medium was stored at -70°C until use in immunoblot analysis.

To determine whether TGF-ß1 is a candidate paracrine mediator of increased versican levels, conditioned medium from the prostate cancer cell lines was added to the fibroblast monolayers, with or without the addition of TGF-ß1-neutralizing antibody (raised in chicken; Life Technologies, Inc.). Fibroblasts were also grown in control medium (as described previously) and treated with 10 ng/ml TGF-ß1 (Life Technologies, Inc.) with or without 15 µg/ml anti-TGF-ß1 antibody. For cell cultures treated with both growth factor and antibody or with antibody alone, the reagents were incubated in 100 µl of cRPMI plus ITS or 5 ml of cancer cell-conditioned medium, respectively, at room temperature for 1 h before the addition to the cell cultures. After 72 h, culture media were harvested as described above and stored at -70°C.

Immunoblot Analysis of Versican Expression.
Molecules in the thawed conditioned medium were concentrated 50-fold using Centristart I centrifuge tubes (Sartorius, Goettingen, Germany) with a molecular weight cutoff of 300,000 at 4°C for 4 h at 2,000 x g.

To allow electrophoretic migration of versican on 5% polyacrylamide gels, CS side chains were cleaved from the core protein (Mr ~400,000) by chondroitinase ABC (0.4 units/ml; Sigma) for 3 h at 37°C. Sample buffer [0.5 M Tris-HCl (pH 6.8), 10% (w/v) glycerol, 2% (w/v) SDS, 0.05% (v/v) ß-mercaptoethanol, and 0.0025% (w/v) bromphenol blue] was added to each sample in a 1:1 ratio, and the samples were incubated at 95°C for 5 min.

An equal volume (10 µl) of each sample was loaded into the wells of 5% polyacrylamide gels. Five µl of See Blue prestained standard molecular weight markers (Novex, San Diego, CA) were loaded after incubation at 95°C for 5 min. The gels were run in a Bio-Rad mini Protean II cell. Electrophoresis in Tris-glycine buffer pH 8.8, protein blotting, and immunostaining were performed by standard procedures. The membranes were incubated in rabbit antibody to recombinant human versican (Ref. 8 ; diluted 1:1000 in Tris-buffered saline and 0.1% Tween) for 2 h. Visualization was achieved by antirabbit IgG alkaline phosphatase-linked secondary antibody (Amersham, Buckinghamshire, United Kingdom). Measurement was achieved by the use of ECF (Amersham) and FluorImager scanning (Molecular Dynamics, Melbourne, Australia). All detected bands of versican were determined to be within the linear range of detection (data not shown). As an internal control for protein loading, an equal volume (10 µl) of each sample was run on an acrylamide gel and stained with Coomassie Blue using standard techniques. A protein band corresponding to the molecular weight of transferrin (a component of ITS) was identified for each sample and measured by laser densitometry.

Effect of Cancer Cell-conditioned Medium on Fibroblast Proliferation.
Primary fibroblast cultures were plated into 96-well plates at a density of 4 x 103 cells/well and grown in cRPMI plus 5% FBS. After 4 days, the culture medium was changed to cRPMI plus 0.5% FBS. After an additional 24 h, the cells were washed with cRPMI plus ITS. Control or conditioned medium from the prostate cancer cell lines was added to the fibroblast monolayers. At each time point (24, 48, and 72 h), 0.1 mg of aqueous MTT (Sigma) was added to each well and incubated at 37°C for 4 h. This was followed by the addition of 100 µl of 20% SDS in 0.02 M HCl, and then the cells were left to solubilize overnight in a dark environment at room temperature. The plates were then read in a microplate reader (Bio-Rad 450, Bio-Rad, Sydney, Australia) using a dual wavelength setting of 570 and 655 nm, and the cell numbers were calculated using a standard plot of known cell number.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Derivation and Characterization of Primary Cultures of Prostatic Fibroblasts.
Cell suspensions containing 8 x 105 cells were derived per 500 mg of wet tissue. The viability of the cells released was 60–70%. After 10 days of culture, the cells were trypsinized and plated into 80-cm2 flasks. The absence of cancer from the transurethral resected tissue was confirmed by pathological review of H&E-stained sections of tissue adjacent to that used to generate the primary cell cultures.

No cytokeratin immunostaining was observed in the primary cell cultures, indicating that the cells were unlikely to be of epithelial origin. Vimentin staining was observed in 100% of cells in the primary cultures, confirming their mesenchymal origin. Staining with the antidesmin antibody indicated that the cell cultures contained approximately 5% smooth muscle cells.

RT-PCR of Versican mRNA in Cultured Prostate Cells.
Primary cultures of prostatic fibroblasts expressed the expected sizes (436 and 375 bp, respectively) of the V0 and V1 isoforms of versican RNA, whereas the prostate cancer cell lines (LNCaP, PC3, and DU145) lacked detectable V1 or V0 versican RNA (Fig. 1, A and B)Citation . No bands were detected for the controls, no RNA+RT, RNA-RT, and no DNA (data not shown). The PCR products for V1 and V0 were sequenced and confirmed to be human versican sequences. Bands corresponding to GAPDH were observed for all reactions (data not shown).



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. RT-PCR of versican V0 (A) and V1 (B) mRNA expression. Primary cultures of human prostatic fibroblasts express the expected sizes (436 and 375 bp, respectively) of the V0 and V1 isoforms of versican. In contrast, the prostate cancer cell lines LNCaP, PC3, and DU145 were found to have undetectable mRNA levels of the V0 and V1 isoforms of versican.

 
Immunoblot Analysis of Versican in Fibroblast Culture Medium.
Immunoblot analysis of serum-free media harvested from fibroblasts treated with either LNCaP-, PC3-, or DU145-conditioned medium demonstrated increased levels of versican in the culture medium compared with control fibroblast medium at 24, 48, and 72 h (Fig. 2)Citation . In some cases, bands at approximately Mr 450,000 and Mr 400,000 representing versican isoforms V0 and V1, respectively, were observed; however, in most experiments, the two isoforms were observed as a single broad band due to incomplete resolution. The V2 and V3 isoforms of versican were not detected. Quantitative measurement revealed the increased versican levels to be 2.5-, 4.5-, and 5-fold at 72 h after treatment with LNCaP-, PC3-, and DU145-conditioned medium, respectively, when compared with control cultures. There appeared to be no difference in the response to cancer cell-conditioned medium between the fibroblast cultures isolated from two patients (data not shown). Quantification using laser densitometry of the Mr 80,000 transferrin band in Coomassie Blue-stained gels confirmed that an equal level of protein from each sample was loaded onto the gels (Fig. 2ECitation ; quantification data not shown).



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Immunoblot analysis of versican accumulation in culture medium of prostate fibroblasts stimulated with conditioned medium (CM) from LNCaP (A), PC3 (B), and DU145 (C) prostate cancer cell lines. Graphs to the right of each immunoblot summarize the mean ± SD of eight determinations from four independent experiments. No versican was detected in the culture medium of any of the prostate cancer cell lines (D). Immunoblots were detected using Vistra ECF with a FluorImager and quantitated using ImageQuant software. Coomassie Blue-stained gel indicated an equivalent loading of transferrin protein per lane (E).

 
Effect of Cancer Cell-conditioned Medium on Fibroblast Proliferation.
To determine whether the increased accumulation of versican in culture medium was due to cellular proliferation, the fibroblast number during culture in cancer cell-conditioned medium was measured using a MTT assay. Prostate fibroblast proliferation, as determined by the MTT assay, was significantly decreased at 48 and 72 h of culture in conditioned medium from all three prostate cancer cell lines when compared with proliferation of control medium-treated fibroblasts (one-way ANOVA, P < 0.05; Fig. 3Citation ).



View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Prostatic fibroblast proliferation measured by MTT assay in the presence of cancer cell-conditioned media. Conditioned media from LNCaP ({blacksquare}), PC3 ({blacktriangleup}), and DU145 ({diamondsuit}) prostate cancer cell lines decreased fibroblast proliferation when compared with control medium-treated fibroblasts (x). Each data point represents the mean ± SD of 16 replicate values from two independent experiments. At 48 and 72 h, all treatment groups were significantly different from the control medium-treated group (one-way ANOVA, P < 0.05).

 
Effect of TGF-ß1 and Specific Neutralizing Antibody on Fibroblast Versican Accumulation.
The addition of 10 ng/ml TGF-ß1 to prostatic fibroblast cultures resulted in a 4-fold increase in versican accumulation in culture medium over that of control medium-treated fibroblasts (Fig. 4, A and B)Citation . The addition of 15 µg/ml neutralizing antibody to TGF-ß1 prevented the increase in versican accumulation induced by either 10 ng/ml exogenous TGF-ß1 or conditioned medium from LNCaP, PC3, and DU145 prostate cancer cell lines (Fig. 4, A and B)Citation .



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Immunoblot analysis of the effect of TGF-ß1-specific neutralizing antibody on fibroblast versican accumulation. The addition of 10 ng/ml TGF-ß1 to prostatic fibroblast cultures resulted in an increase in versican accumulation in culture medium over that of control medium-treated fibroblasts (A, Lane 2 versus Lane 1). The addition of 15 µg/ml neutralizing antibody to TGF-ß1 prevented the increase in versican accumulation induced by either 10 ng/ml exogenous TGF-ß1 (A, Lane 3 versus Lane 2) or conditioned medium (CM) from LNCaP, PC3, and DU145 prostate cancer cell lines (A, Lanes 5, 7, and 9 versus Lanes 4, 6, and 8, respectively). Immunoblots were detected using Vistra ECF with a FluorImager and quantitated using ImageQuant software (B). Each data point represents the mean ± SD from two independent experiments.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Recent studies from this laboratory demonstrated that an increase in immunoreactive versican in stromal tissue surrounding early-stage prostate tumors is associated with an elevated risk of prostate specific antigen-assessed progression (2) . An increase in versican expression in the peritumoral matrix of the prostate may facilitate local invasion and formation of metastases by decreasing cell-ECM adhesion sufficient to promote tumor cell migration through the ECM.

In this study, versican isoforms V0 and V1 were shown by RT-PCR to be expressed by prostatic fibroblasts, but not by any of the prostate cancer cell lines tested. Similarly, no versican protein was detected in the culture medium of LNCaP, PC3, and DU145 prostate cancer cells by immunoblotting. This observation is consistent with previous immunohistochemical studies that suggest that versican is expressed exclusively in the prostatic stroma (2) . The spatial separation of the stromal versican deposition from cancer cells in prostate tissue sections implies production of a soluble mediator by prostate cancer cells. In support of this hypothesis, conditioned media from LNCaP, PC3, and DU145 adenocarcinoma cell lines stimulated increased accumulation of the V0 and V1 isoforms of versican in culture medium from prostatic fibroblasts. Similarly, human colon carcinoma cells produce an undefined class of polypeptides that stimulate the synthesis and release of 35S-sulfated proteoglycans into culture medium by normal colon fibroblasts (9) .

The increased accumulation of versican with time was not due to an increased proliferation rate by fibroblasts cultured in cancer cell-conditioned medium compared with control medium. Indeed, the use of cancer cell-conditioned medium led to a decrease in the rate of fibroblast proliferation, possibly due to a depletion of nutrients in the cancer cell-conditioned medium. Similarly, conditioned medium from colon carcinoma cells up-regulated CS proteoglycan secretion without inducing cell proliferation (9) .

The increased incidence of prostate specific antigen relapse in patient groups with higher levels of versican in the peritumoral stroma suggests that the level of versican is directly correlated with the aggressiveness of prostate cancer cells. In this study, PC3 and DU145 cell lines stimulated versican secretion by fibroblasts to a greater degree than LNCaP prostate cancer cells. PC3 and DU145 cancer cells have been considered to demonstrate a more aggressive phenotype than LNCaP cells, based on their androgen independence and the production of extensive metastatic deposits in nude mice (10) . Versican secretion has been reported to be up-regulated in arterial smooth muscle cells and in skin fibroblasts by TGF-ß1 (5 , 11) . TGF-ß1 and TGF-ß2 mRNA and protein have been detected in both the PC3 and DU145 cell lines (12) , whereas LNCaP cells are known to express TGF-ß1 mRNA (13) . TGF-ß1 is expressed at higher levels in prostate cancer than in the normal prostate (14) and is associated with a worse clinical outcome (15) . In this study, we demonstrate that TGF-ß1 enhanced the level of versican accumulation in the culture medium of prostatic fibroblasts and that neutralizing antibody to TGF-ß1 inhibited the ability of prostate cancer cell-conditioned medium to stimulate versican accumulation. We are currently examining additional specific neutralizing antibodies to determine other candidate growth factors in prostate cancer cell-conditioned medium.

The ability of malignant epithelial cells to regulate versican secretion by fibroblasts may have implications for tumor metastasis. Accumulation of versican in the ECM surrounding a tumor could be a crucial aspect of remodeling of the stroma, resulting in an environment that supports tumor cell proliferation and invasion. Several lines of evidence suggest that versican and hyaluronan may play a role in cell motility. Substrata rich in versican and hyaluronan promote movement and proliferation of arterial smooth muscle cells (16) and astrocytoma cells (17) . Versican may act as a bridge between hyaluronan and cell surfaces, thereby anchoring hyaluronan (18) . Removal of CS from versican core protein by chondroitinase ABC treatment eliminates the antiadhesive action of versican for neonatal dorsal root ganglion neurons and Schwann cells (19) . It therefore appears that the antiadhesive properties of versican are mediated through complementary functions of the core-protein and the CS side chains. Although this study did not investigate any posttranslational modifications to the versican molecule, such as changes in the length and composition of the CS side chains, our results indicate that prostate cancer cells, as a minimum, induce an increase in the amount of versican molecules detected in fibroblast-conditioned medium.

In conclusion, neoplastic remodeling of the ECM through modulation of stromal cell secretion of macromolecules such as versican may be one mechanism by which prostate tumor cells control their microenvironment to facilitate local invasion and metastasis.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the National Health and Medical Research Council of Australia, the Anti-Cancer Foundation of South Australia, the Flinders Medical Centre Foundation, and NIH Grant GM08194. Back

2 To whom requests for reprints should be addressed, at Flinders Cancer Centre, Department of Surgery, Flinders Medical Centre, Bedford Park, Adelaide, South Australia 5042, Australia. Phone: (618) 8204–4389; Fax: (618) 8204–5899; E-mail: david.horsfall{at}flinders.edu.au Back

3 The abbreviations used are: CS, chondroitin sulfate; ECF, enhanced chemifluorescence; ECM, extracellular matrix; FBS, fetal bovine serum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ITS, insulin, transferrin, and sodium selenite medium supplement; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; RT-PCR, reverse transcription-PCR; TGF, transforming growth factor; cRPMI, complete RPMI. Back

Received 9/25/00. Accepted 12/ 8/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Olumi A. F., Grossfeld G. D., Hayward S. W., Carroll P. R., Tlsty T. D., Cunha G. R. Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium.. Cancer Res., 59: 5002-5011, 1999.[Abstract/Free Full Text]
  2. Ricciardelli C., Mayne K., Sykes P. J., Raymond W. A., McCaul K., Marshall V. R., Horsfall D. J. Elevated levels of versican but not decorin predict disease progression in early-stage prostate cancer.. Clin. Cancer Res., 4: 963-971, 1998.[Abstract]
  3. Ricciardelli C., Quinn D. I., Raymond W. A., McCaul K., Sutherland P. D., Stricker P. D., Grygiel J. J., Sutherland R. L., Marshall V. R., Tilley W. D., Horsfall D. J. Elevated levels of peritumoral chondroitin sulfate are predictive of poor prognosis in patients treated by radical prostatectomy for early-stage prostate cancer.. Cancer Res., 59: 2324-2328, 1999.[Abstract/Free Full Text]
  4. Evanko S. P., Raines E. W., Ross R., Gold L. I., Wight T. N. Proteoglycan distribution in lesions of atherosclerosis depends on lesion severity, structural characteristics, and the proximity of platelet-derived growth factor and transforming growth factor-ß.. Am. J. Pathol., 152: 533-546, 1998.[Abstract]
  5. Kahari V. M., Larjava H., Uitto J. Differential regulation of extracellular matrix proteoglycan (PG) gene expression. Transforming growth factor-ß 1 up-regulates biglycan (PGI), and versican (large fibroblast PG) but down-regulates decorin (PGII) mRNA levels in human fibroblasts in culture. J. Biol. Chem., 266: 10608-10615, 1991.[Abstract/Free Full Text]
  6. Ricciardelli C., Horsfall D. J., Sykes P. J., Marshall V. R., Tilley W. D. Effects of oestradiol-17ß and 5{alpha}-dihydrotestosterone on guinea-pig prostate smooth muscle cell proliferation and steroid receptor expression in vitro.. J. Endocrinol., 140: 373-383, 1994.[Abstract/Free Full Text]
  7. Dours-Zimmermann M. T., Zimmermann D. R. A novel glycosaminoglycan attachment domain identified in two alternative splice variants of human versican.. J. Biol. Chem., 269: 32992-32998, 1994.[Abstract/Free Full Text]
  8. du Cros D. L., LeBaron R. G., Couchman J. R. Association of versican with dermal matrices and its potential role in hair follicle development and cycling.. J. Invest. Dermatol., 105: 426-431, 1995.[Medline]
  9. Iozzo R. V. Neoplastic modulation of extracellular matrix.. J. Biol. Chem., 260: 7464-7473, 1985.[Abstract/Free Full Text]
  10. van Moorselaar R. J., van Stratum P., Borm G., Debruyne F. M., Schalken J. A. Differential antiproliferative activities of {alpha}- and {gamma}-interferon and tumor necrosis factor alone or in combinations against two prostate cancer xenografts transplanted in nude mice.. Prostate, 18: 331-344, 1991.[Medline]
  11. Schonherr E., Jarvelainen H. T., Sandell L. J., Wight T. N. Effects of platelet-derived growth factor and transforming growth factor-ß1 on the synthesis of a large versican-like chondroitin sulfate proteoglycan by arterial smooth muscle cells.. J. Biol. Chem., 266: 17640-17647, 1991.[Abstract/Free Full Text]
  12. Wilding G., Valverius E., Knabbe C., Flanders K., Gelman E. Differential effects of transforming growth factor ß on human prostate cancer cells in vitro.. Mol. Cell. Endocrinol., 62: 79-87, 1989.[Medline]
  13. Kim I. Y., Kim J. H., Zelner D. J., Ahn H. J., Sensibar J. A., Lee C. Transforming growth factor-ß1 is a mediator of androgen-regulated growth arrest in an androgen-responsive prostatic cancer cell line, LNCaP.. Endocrinology, 137: 991-999, 1996.[Abstract]
  14. Steiner M. S., Zhou Z. Z., Tonb D. C., Barrack E. R. Expression of transforming growth factor-ß 1 in prostate cancer.. Endocrinology, 135: 2240-2247, 1994.[Abstract]
  15. Wikstrom P., Stattin P., Franck-Lissbrant I., Damber J. E., Bergh A. Transforming growth factor ß1 is associated with angiogenesis, metastasis and poor clinical outcome in prostate cancer.. Prostate, 15: 19-29, 1998.
  16. Evanko S. P., Angello J. C., Wight T. N. Formation of hyaluronan- and versican-rich pericellular matrix is required for proliferation and migration of vascular smooth muscle cells.. Arterioscler. Thromb. Vasc. Biol., 19: 1004-1013, 1999.[Abstract/Free Full Text]
  17. Ang L. C., Zhang Y., Cao L., Yang B. L., Young B., Kiani C., Lee V., Allan K., Yang B. B. Versican enhances locomotion of astrocytoma cells and reduces cell adhesion through its G1 domain.. J. Neuropathol. Exp. Neurol., 58: 597-605, 1999.[Medline]
  18. LeBaron R. G., Zimmermann D. R., Ruoslahti E. Hyaluronate binding properties of versican.. J. Biol. Chem., 267: 10003-10010, 1992.[Abstract/Free Full Text]
  19. Braunewell K. H., Pesheva P., McCarthy J. B., Furcht L. T., Schmitz B., Schachner M. Functional involvement of sciatic nerve-derived versican- and decorin-like molecules and other chondroitin sulphate proteoglycans in ECM-mediated cell adhesion and neurite outgrowth.. Eur. J. Neurosci., 7: 805-814, 1995.[Medline]



This article has been cited by other articles:


Home page
J BiochemHome page
E. M. Kozma, K. Olczyk, G. Wisowski, A. Glowacki, and R. Bobinski
Alterations in the Extracellular Matrix Proteoglycan Profile in Dupuytren's Contracture Affect the Palmar Fascia
J. Biochem., April 1, 2005; 137(4): 463 - 476.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. L. Russell, S. A. Ochsner, M. Hsieh, S. Mulders, and J. S. Richards
Hormone-Regulated Expression and Localization of Versican in the Rodent Ovary
Endocrinology, March 1, 2003; 144(3): 1020 - 1031.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. A. Tuxhorn, G. E. Ayala, M. J. Smith, V. C. Smith, T. D. Dang, and D. R. Rowley
Reactive Stroma in Human Prostate Cancer: Induction of Myofibroblast Phenotype and Extracellular Matrix Remodeling
Clin. Cancer Res., September 1, 2002; 8(9): 2912 - 2923.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Ricciardelli, J. H. Brooks, S. Suwiwat, A. J. Sakko, K. Mayne, W. A. Raymond, R. Seshadri, R. G. LeBaron, and D. J. Horsfall
Regulation of Stromal Versican Expression by Breast Cancer Cells and Importance to Relapse-free Survival in Patients with Node-negative Primary Breast Cancer
Clin. Cancer Res., April 1, 2002; 8(4): 1054 - 1060.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Touab, J. Villena, C. Barranco, M. Arumi-Uria, and A. Bassols
Versican Is Differentially Expressed in Human Melanoma and May Play a Role in Tumor Development
Am. J. Pathol., February 1, 2002; 160(2): 549 - 557.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakko, A. J.
Right arrow Articles by Horsfall, D. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sakko, A. J.
Right arrow Articles by Horsfall, D. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online