Cancer Research CR Helping Patients  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boudreau, M. D.
Right arrow Articles by Hwang, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boudreau, M. D.
Right arrow Articles by Hwang, D. H.
[Cancer Research 61, 1386-1391, February 15, 2001]
© 2001 American Association for Cancer Research


Carcinogenesis

Suppression of Tumor Cell Growth Both in Nude Mice and in Culture by n-3 Polyunsaturated Fatty Acids: Mediation through Cyclooxygenase-independent Pathways1

Mary D. Boudreau, Kyung Hee Sohn, Sang Hoon Rhee, Sam W. Lee, Jay D. Hunt and Daniel H. Hwang2

Pennington Biomedical Research Center, Louisiana State University, Baton Rouge, Louisiana 70808 [M. D. B., K. H. S., S. H. R., D. H. H.]; Stanley S. Scott Cancer Center, Louisiana State University Health Sciences Center, New Orleans, Louisiana 70112 [J. D. H.]; and Department of Medicine, Beth Israel Hospital, Harvard Medical School and Harvard Institute of Medicine, Boston, Massachusetts 02215 [S. W. L.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Dietary n-3 polyunsaturated fatty acids (PUFAs), as compared with n-6 PUFAs, suppress cellular production of prostaglandins and tumor cell growth both in vitro and in vivo. However, the mechanism by which n-3 PUFAs suppress tumor growth is not understood. We investigated whether the suppression of tumor cell growth by dietary n-3 PUFAs is mediated through inhibition of cyclooxygenase (COX). A colon tumor cell line, HCT-116, that does not express COX was stably transfected with the constitutively expressed COX-1 or the inducible COX-2 cDNA using a retroviral transfection and infection system. Athymic nude mice transplanted with the cells expressing enzymatically active COX were fed isocaloric diets containing either safflower oil or fish oil for 2 weeks before the start of the experiment and for an additional 21 days after transplantation. Both tumor volume and tumor burden (tumor volume/body weight) were significantly reduced in mice fed the fish oil diet as compared with safflower oil-fed mice. This reduction occurred even in control mice that received injections with cells infected with the retroviral vector without COX-1 or COX-2 cDNA. The growth of tumor cells expressing COX was not different from the growth of those transfected with the vector alone in the nude mice and in soft agar. N-3 PUFAs, as compared with linoleic acid, also inhibited the growth of these cells in culture. This growth inhibition by n-3 PUFAs was not affected by COX-1 or COX-2 overexpression. Contrary to general belief, these results indicate that the suppression of tumor growth by dietary n-3 PUFAs is mediated through COX-independent pathways.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The rates of cancer incidence are generally low in Eskimos of Alaska and Greenland as compared with North Americans and other Western population groups (1, 2, 3, 4, 5, 6) . Results from epidemiological studies (7, 8, 9, 10) demonstrated an inverse association of fish consumption with colon cancer. Results from clinical studies (11, 12) also demonstrated reduction of intestinal hyperproliferation in subjects at risk of colon cancer by consuming n-3 PUFAs3 derived from FO.

In many animal tumorigenesis studies (13, 14, 15, 16, 17, 18) , it has been shown that diets containing FO or n-3 PUFAs have a protective effect on chemically induced colon carcinogenesis. N-3 PUFAs, as compared with n-6 PUFAs, also suppress tumor cell growth both in vitro and in vivo (19, 20, 21, 22, 23, 24, 25) . The mechanism by which n-3 PUFAs suppress tumor cell growth is not understood.

Marine oils are rich in n-3 PUFAs, such as eicosapentaenoic acid (20:5n-3) and docosahexaenoic acid (22:6n-3). It is well documented that metabolic competition exists between n-3 and n-6 PUFAs (26, 27, 28, 29) . Increased intake of n-3 PUFAs leads to reduced levels of arachidonic acid (20:4n-6) in tissue lipids and, subsequently, to suppressed production of prostanoids derived from arachidonic acid. Numerous studies (30, 31, 32, 33, 34) have demonstrated that the levels of PGs in various tumors or the biosynthetic capacity of the tumor for PGs is greater when compared with normal tissues. COX, PG endoperoxide synthase, catalyzes the conversion of arachidonic acid to PG endoperoxides. This is the rate-limiting step in PG and thromboxane biosynthesis. Two isoforms of COX have been cloned from various animal cells: constitutively expressed COX-1 (35, 36, 37, 38, 39) and mitogen-inducible COX-2 (40, 41, 42, 43, 44, 45) . It has been shown that the inducible form of COX is overexpressed in colon and other tumor tissues (46, 47, 48, 49) . Many epidemiological studies (50, 51, 52, 53, 54, 55, 56, 57, 58) have demonstrated that aspirin and other NSAIDs can reduce the incidence of colon cancers. The well-documented pharmacological action of aspirin and other NSAIDs is inhibiting COX. Thus, it has been a prevailing hypothesis that the suppression of tumor cell growth by dietary n-3 PUFAs, as compared with n-6 PUFAs, is mediated through the inhibition of COX. However, experimental evidence to support this hypothesis has not been demonstrated.

To determine whether or not suppression of tumor cell growth by n-3 PUFAs is mediated through inhibition of COX, we selected a colon tumor cell line, HCT-116, which does not express COX, and transfected these cells with COX cDNAs to overexpress COX. If the suppression of tumor cell growth by n-3 PUFAs both in vitro and in vivo is primarily mediated through inhibition of COX, n-3 PUFAs should not affect the growth of cells that do not express COX. Results from these studies should provide a new insight into understanding the mechanism by which n-3 PUFAs mediate the suppressive action on tumor cell growth and other cellular effects that cannot be explained solely based on the inhibition of PG production.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Line
The human colon cancer cell line (HCT-116) was obtained from the American Type Culture Collection and cultured in McCoy’s 5A medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum (Intergen Co., Purchase, NY), 100 units/ml penicillin, and 100 µg/ml streptomycin.

Preparation of COX-1/2-Flag Expression Constructs in Tetracycline-regulated Retroviral Vector
Flag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) epitope tag sequence was added at COOH-terminal ends of human COX-1 and COX-2 cDNAs using overlapping extension PCR. For the COX-1-Flag construct, PCR was performed with the primer P1-F1 and P1-R1 first using human COX-1 cDNA as a template. Then, the PCR fragment was used as the template for the second PCR with P1-F2 and P1-R2. The final PCR product was subcloned into BamHI and NotI sites in pcDNA3.1/zeo(-) ( Invitrogen, Carlsbad, CA). For the COX-2-Flag expression construct, the primers P2-F and P2-R1 were used for the first PCR. The PCR product was then used as the template for the second PCR with the primers P2-F and P2-R2. The COX-2-Flag PCR fragment was inserted into BamHI site in pcDNA3.1/zeo(-). The Pme 1 restriction fragments of these constructs were subcloned into Hpa I site of the tetracycline-regulated retroviral vector, pLinx (59) . The integrity of these expression constructs was verified by sequencing the complete coding regions. The primers used for PCR are as follows: P1-F1, 5' AACCGCGCCATGAGCCGGAGTCTC 3'; P1-R1, 5' TTTATCATCATCATCTTTATAATCGAGCTCTGTGGATGG 3'; P1-F2, 5' ACTAAGGATCCAACCGCGCCATGAGC 3'; P1-R2, 5' GTGCTTGCGGCCGCTATCATTTATCATCATCATCTTTATAATC 3'; P2-F, 5' GGTAAGGATCCTCAGACAGCAAAGCCTAC 3'; P2-R1, 5' ATCATCATCTTTATAATCCAGTTCAGTCGAACGTTC 3'; P2-R2, 5'GGTAAGAGATCCCTATTTATCATCATCATCTTTATAATCCAG 3'.

Transfection, Infection, Selection, and Screening Procedures for the Preparation of Stable Clones (HCT-116) Overexpressing Enzymatically Active COX-1 or COX-2 in a Tetracycline-regulated Manner
Transfection of the amphotropic packaging cell line ({phi}NX; Dr. Garry Nolan, Stanford University, Stanford, California) was performed as described by Pear et al. (60) . Briefly, the packaging cells ({phi}NX cells) in a 60-mm dish were transfected with 5 µg of the retroviral plasmid DNA using SuperFect (Qiagen, Valencia, CA) reagent. Plasmid DNA was prepared using endofree plasmid Maxi kit (Qiagen). The medium containing the virus was removed 72 h after transfection and centrifuged at 1500 rpm for 5 min to pellet cell debris. Target cells (HCT-116) at a density of 5 x 105 cells/60-mm dish were infected in the presence of polybrene (5 µg/ml; Sigma Chemical Co.) with 4 ml of centrifuged medium containing the virus. Transfection and infection were carried out in the presence of tetracycline (8 µ g/ml). Infected cells were selected in the presence of geneticin (800 µg/ml). Individual positive clones were propagated, and the expression of enzymatically active COX-1 or COX-2 was determined. To detect COX protein derived from the plasmids, cell lysates were immunoprecipitated with polyclonal anti-Flag antibodies and immunoblotted with COX antibodies. COX enzyme activity was determined by RIA for PGE2 produced in these cells as described in our previous studies (61) .

Preparation of Cell Lysates, Immunoprecipitation, Immunoblot, and Assay for COX
These were carried out as described in our previous studies (61 , 62) . Polyclonal anti-Flag antibodies were prepared in rabbits with the Flag peptide (Cys-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) conjugated to keyhole lympet hemocyanin at the Core Laboratory, Louisiana State University Health Sciences Center, New Orleans, LA.

Nude Mice Studies
Animals.
Female athymic nude mice (NCr-nu/nu) were purchased from Harlan Sprague Dawley, Inc. (Indianapolis, Indiana) at 3 to 4 weeks of age and maintained in microisolator cages within a pathogen-free isolation facility. There were 51 mice in each of the two dietary groups. Mice were housed four animals/cage and one cage that housed three animals. All of the protocols were approved by the Institutional Animal Care and Use Committees of the Pennington Biomedical Research Center and the Louisiana State University Health Sciences Center.

Diets.
The experimental diets were prepared by BioServ (Frenchtown, NJ) and were based on the purified American Institute of Nutrition (AIN-93G) rodent diet. Two experimental diets were used: the SO diet or the FO diet, supplemented with SO (20%; w/w) or a mixture of SO (2%; w/w) and FO (18%; w/w), respectively. The SO was provided by BioServ, whereas the menhaden oil was provided gratis by Omega Protein (Reedsville, VA). The diets were isocaloric with 4.467 kcal/g for the AIN-93G-modified SO diet and 4.48 kcal/g for the AIN-93G-modified menhaden FO diet. The diets were sterilized by {gamma}-irradiation (2–4 mRAD) and stored at -20°C in heat-sealed maylar bags that were filled with nitrogen and packaged approximately 200 g/bag. Feeding the experimental diets was commenced 14 days before injection of the tumor cells so that the desired lipid environment was present during the initial stage of tumor proliferation and angiogenesis. Fresh diet was provided three times weekly.

Experimental Procedures.
Mice were fed the experimental diets for 2 weeks before tumor cell implantation to allow for dietary fatty acids to be incorporated into tissue lipids. A randomization method was used to assign one of two diets and one of three cell types to each mouse. Cell suspensions in HBSS were drawn into a sterile 1-ml disposable syringe using an 18GA needle, and the syringe was depleted of air. Mice received injections with 2 x 106 tumor cells (200 µ l of cell suspension) s.c. into the subscapular region using a 25GA needle. Selection of 2 x 106 cells for injection was based on pilot studies that showed 100% tumor development and a reasonable latency period for this cell line (data not shown). When tumors became palpable, their maximum length, width, and perpendicular diameters were measured with a digital vernier caliper three times weekly, and the tumor volumes, calculated as for a sphere using 1/2{pi} (W x L x H), were determined until completion of the study. The experiment was terminated 21 days after injection of tumor cells.

Fatty Acid Analyses.
Extraction of tumor tissue lipids and analysis of fatty acid composition were carried out as described previously (63) .

Statistical Analyses.
A two-way repeated measure analysis with an unstructured covariance structure incorporated into the model was used as the primary analysis design to test the main effects of diet, cell line, and their interaction. Comparisons were adjusted using the Bonferroni method. The measures of tumor burden and fatty acid profiles incorporated a two-way ANOVA. For all of the statistical analyses of this study, SAS System 6.12 software was used.

Cell Viability Assay.
HCT-116 cells (0.75 x 104 cells/well) were plated to a 96-well plate. The cells were serum-starved for 24 h by replacing the culture media with McCoy’s 5A media containing 0.25% fetal bovine serum. Then, the media were removed, and fresh media containing fatty acids were added. The fatty acids were combined with fatty acid-free albumin at a molar ratio of 10:1 (fatty acid:albumin) in serum-poor medium. After culturing for 48 h, 20 µl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma Chemical Co.) solution (5 µg/ml) were added to each well and incubated for another 4 h. Insoluble formazan precipitates formed in media were solubilized with 100 µl of 10% SDS-0.01 N HCl solution. Absorbance at 595 nm was measured using a Bio-Rad plate reader.

Soft-agar Clonogenic Assay.
HCT-116 cells overexpressing COX-2 or cells transfected with the vector without COX-2 cDNA were plated (1 x 104) in triplicates in culture plates containing 0.33% top low-melt agarose/0.6% bottom low-melt agarose. Medium was replaced every 3 days. Colonies were measured after 3 weeks.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of Enzymatically Active COX Proteins in HCT-116 Cells Transfected with COX cDNAs.
HCT-116 cells were infected with retroviral particles harboring COX-1 or COX-2 cDNA. We selected the clones expressing enzymatically active COX-1 (Fig. 1, A and B)Citation or COX-2 protein in a tetracycline regulated manner (Fig. 1, C and D)Citation . Overexpression of COX can lead to significantly increased concentrations of PGs in the culture media. Cells may undergo adaptive change under high concentrations of PGs in the media. Thus, cells were cultured in the presence of tetracycline to suppress the expression of COX during the subcultivation, but tetracycline was removed from the culture media before in vitro and in vivo studies.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, expression of the epitope (Flag)-tagged COX-1 or COX-2 protein and regulation of its expression by tetracycline in colon cancer cell line (HCT-116). Stable clones of HCT-116 overexpressing Flag-tagged COX-1 or COX-2 in a tetracycline-regulated manner were prepared as described in "Materials and Methods." Cell lysates were immunoprecipitated (IP) with polyclonal Flag antibodies and immunoblotted with COX-1 (A) or COX-2 (C) antibodies. COX enzyme activity in cells overexpressing COX-1 (B) or cells overexpressing COX-2 (D) was determined by measuring the production of PGE2 from arachidonic acid as described in "Materials and Methods." Lane 1, no DNA; Lane 2, pLinx vector; Lane 3, pLinx-COX-1 or pLinx-COX-2 Flag with no tetracycline; Lane 4, pLinx-COX-1 or pLinx-COX-2 Flag with tetracycline (8 µg/ml). *, values for Lane 3 are significantly greater than those of other lanes (P < 0.01; n = 6).

 
Growth Suppression of Colon Tumor Cells (HCT-116) in Athymic Nude Mice by FO Diet as Compared with SO Diet.
Of the mice that received injections s.c. with 2 x 106 tumor cells, 100% developed detectable tumors, and there were no differences among the dietary groups when the percentage of tumor incidence was compared. Analysis of fatty acids indicated significant incorporation of n-3 PUFAs from diets into tumor tissue lipids (Table 1)Citation . All of the tumors derived from HCT-116 cells transfected with Flag-epitope-tagged COX-2 or COX-2 cDNA showed expression of respective COX protein (Fig. 2)Citation . The growth of tumor cells xenografted into athymic nude mice was suppressed by the FO diet as compared with SO diet regardless of whether COX is expressed or not in the cells (Fig. 3, A–C)Citation . Tumor growth was suppressed by the FO diet even in the animals xenografted with the cells that do not express COX (Fig. 3A)Citation . This suppression was not because of the difference in body weight, because the pattern of suppression by the FO diet was the same as the tumor volume if the data were expressed in terms of tumor burden (tumor weight/final body weight; Fig. 3DCitation ). The body weight gains among the various dietary treatment groups were not significantly different. Additionally, body weight gain was not affected by the cell line injected into the mice or by the interaction of diet and cell line.


View this table:
[in this window]
[in a new window]

 
Table 1 Fatty acid composition of dietary fat and mice tumor tissuea

 


View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Expression of the epitope (Flag)-tagged COX-1 or COX-2 protein in tumors from nude mice transplanted with HCT-116 cells. Solubilized proteins from tumor or normal tissues were immunoprecipitated (IP) with polyclonal Flag antibodies and immunoblotted with COX antibodies that recognize both COX-1 and COX-2. T, tumor tissue; N, normal tissue; SO, safflower diet; FO, fish oil diet.

 


View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Growth suppression of colon tumor cells (HCT-116) in athymic nude mice by FO diet as compared SO diet. The nude mice received injections with the control cells that do not express COX (A), cells expressing COX-1 (B), or cells expressing COX-2 (C). Tumor values were determined as described in "Materials and Methods." Values represent tumor volumes (mean ± SE; n = 15). D, tumor burden was expressed by tumor weight/final body weight. *, significantly reduced as compared with the group fed SO diet (P < 0.05).

 
Overexpression of COX-1 or COX-2 in HCT-116 Cells Does Not Affect Tumor Growth in Nude Mice.
The growth of the tumor cells overexpressing COX-1 or COX-2 was not different as compared with the control cells transfected with the control vector (Fig. 3, A–C)Citation . The growth of the tumor cells overexpressing COX-2 in the mice fed the FO diet ({circ} in Fig. 3CCitation ) or the cells overexpressing COX-1 in the mice fed the SO diet (• in Fig. 3BCitation ) appeared to be slower as compared with the respective control cells transfected with the vector (Fig. 3A)Citation . However, this difference was not statistically significant.

Inhibition of Cell Proliferation by n-3 PUFAs as Compared with Linoleic Acid.
Cell proliferation was inhibited by n-3 PUFAs, whereas it was not inhibited by linoleic acid (Fig. 4)Citation . This inhibition was more pronounced by docosahexaenoic acid as compared with eicosapentaenoic acid. In addition, the inhibition of cell proliferation by docosahexaenoic acid was more pronounced in the cells transfected with the vector as compared with the cells overexpressing COX-1 or COX-2 (Fig. 4)Citation . These in vitro results corroborate the in vivo results shown in the nude mice studies (Fig. 3, A–D)Citation .



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Suppression of cell proliferation by n-3 PUFAs in HCT-116 cells that express no COX (A; transfected with the empty pLinx vector), COX-1 (B), or COX-2 (C). Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay as described in "Materials and Methods." LA, linoleic acid; EPA, eicosapentaenoic acid; DHA, docosahexaenoic acid. Values are mean ± SE (n = 6).

 
Overexpression of COX-2 in HCT-116 Cells Does Not Affect Anchorage-independent Cell Growth.
We next evaluated whether the inhibition of COX-2 expression had an effect on the in vitro transformed phenotype using soft-agar colony-forming assay. As shown in Fig. 5Citation , colony sizes of COX-2-transfected cells grown in the absence of tetracycline were similar to those grown in the presence of tetracycline. In addition, control vector-transfected cells also formed similar size colonies in soft agarose.



View larger version (75K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effects of COX-2 overexpression on anchorage-independent growth of HCT-116 cells. Colony formation in soft agarose was determined in the presence or absence of tetracycline (tet) as described in "Materials and Methods."

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The inhibitory effects of dietary n-3 PUFAs on the growth of tumor cells, both in culture and as solid tumors in nude mice, were demonstrated in many tumor cell lines and transformed cells (14, 15, 16, 17, 18, 19, 20, 21, 22) . It was suggested that these inhibitory effects are attributed to the inhibition of prostanoid synthesis from arachidonic acid. However, experimental evidence supporting the proposition has not been demonstrated.

In our studies, the diet containing n-3 PUFAs suppressed the growth of the colon tumor cell line (HCT-116), which does not express COX, both in culture and in nude mice as solid tumors (Fig. 3Citation and Fig. 4Citation ). Overexpression of COX in this cell line did not affect the cell growth in culture or in nude mice. In addition, overexpression of COX-2 in this cell line did not affect anchorage-independent growth in soft agar (Fig. 5)Citation . Together, these results suggest that the inhibitory effects of n-3 PUFAs on tumor cell growth are not mediated through inhibition of COX activity.

Sheng et al. (64) showed that administration of a COX-2 specific inhibitor to the nude mice resulted in growth suppression of the tumors derived from HCA-7 cells that express endogenous COX but not the tumors derived from HCT-116 cells that do not express COX. These results were interpreted as evidence that COX-2 expression is linked to tumor cell growth. However, the two colon cancer cell lines may differ from each other not only in regards to the status of endogenous COX expression but also in mutations of different genes (65) . Thus, the difference in the rate of tumor growth in response to the COX-2 inhibitor in nude mice for these cell lines may not be entirely because of the status of COX expression. If the expression of COX is linked to tumor growth, overexpression of COX in HCT-116 should enhance growth of tumor cells. However, our results showed that the growth of HCT-116 cells both in culture or in nude mice was not affected by overexpression of COX-1 or COX-2. Anchorage-independent growth of HCT-116 cells in soft agar was also not affected by overexpression of COX-2. These results suggest that COX expression is not linked to tumor cell growth in this cell line.

It was demonstrated that crossbreeding of APC{Delta}716 knockout mice with COX-2 knockout mice or administration of COX-2 inhibitor to APC {Delta}716 knockouts resulted in a reduction of the number and size of the intestinal polyps (66) . In addition, overexpression of COX-2 was shown to enhance tumorigenic phenotypes, metastatic potential, and angiogenesis (67, 68, 69) . On the other hand, it was shown that overexpression of COX-2 induces cell cycle arrest in many cell types (70) and that the anti-inflammatory drug sulindac causes rapid regression of intestinal tumors in Min/+ mice independent of PG biosynthesis (71) .

Demonstrated beneficial effects of NSAIDs in reducing the risk of colon cancer (50, 51, 52, 53, 54, 55, 56, 57, 58) and the results showing that COX-2 is overexpressed in colon tumors (46, 47, 48, 49) have been considered as indirect evidence for involvement of COX in tumorigenesis in colon cancer. However, recent evidence indicates that NSAIDs have diverse biological actions in addition to their inhibitory effect on COX enzyme activity.

Many NSAIDs bind and activate PPARs, which regulate the expression of a broad array of gene products (72 , 73) . Some NSAIDs and other PPAR activators inhibit cell proliferation and induce apoptosis in many cell lines, including HCT-116 (74, 75, 76, 77, 78, 79) . Results from our previous study (80) indicated that some NSAIDs suppress the expression of mitogen-inducible COX-2 and other inflammatory marker genes. Therefore, it is likely that the beneficial effect of NSAIDs in reducing the risk of colon cancer is mediated through not only inhibition of COX enzyme activity but also COX-independent pathways.

It has been well documented that fatty acids and their metabolites also bind and activate PPARs (81, 82, 83, 84, 85, 86) . Xu et al. (81) reported the crystal structure demonstrating that eicosapentaenoic acid binds to the ligand-binding domain of the PPARs. Many ligands for PPARs, including NSAIDs, are known to inhibit tumor cell growth both in vitro and in vivo (74, 75, 76, 77, 78, 79) . Therefore, whether suppression of tumor cell growth by n-3 PUFAs is mediated through differential activation of PPARs would be an appealing hypothesis to be tested.


    ACKNOWLEDGMENTS
 
We thank Ji Hye Paik and Dr. Nebojsa Skrepnik for technical assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grants from the NIH (CA-75613 and DK-41868), United States Department of Agriculture (9700918), and American Institute for Cancer Research (98A0978). Back

2 To whom requests for reprints should be addressed, at Pennington Biomedical Research Center, Louisiana State University, 6400 Perkins Road, Baton Rouge, LA 70808. Phone: (225) 763-2518; Fax: (225) 763-3030; E-mail: hwangdh{at}pbrc.edu Back

3 The abbreviations used are: PUFAs, polyunsaturated fatty acids; COX, cyclooxygenase; FO, fish oil; NSAIDs, nonsteroidal anti-inflammatory drugs; PG, prostaglandin; PPARs, peroxisome proliferator-activated receptors; SO, safflower oil. Back

Received 8/24/00. Accepted 12/13/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wargovich M. J. Fish oil and colon cancer.. Gastroenterology, 103: 1096-1101, 1992.[Medline]
  2. Blot W. J., Lanier A., Fraumeni J. F., Jr., Bender T. R. Cancer mortality among Alaskan natives. J. Natl. Cancer Inst. (Bethesda), 55: 547-554, 1975.
  3. Nielsen N. H., Hansen J. P. Breast cancer in Greenland-selected epidemiological, clinical, and histological features.. J. Cancer Res. Clin. Oncol., 98: 287-299, 1980.[Medline]
  4. Waterhouse, J., Muir, C., Correa, P., and Powell, J. (eds.). Cancer Incidence in Five Countries. III. Lyon, France: IARC (15), 1976.
  5. Berg J. W. Can nutrition explain the pattern of international epidemiology of hormone-dependent cancers?. Cancer Res., 35: 3345-3350, 1975.[Abstract/Free Full Text]
  6. Giovannucci E., Goldin B. The role of fat, fatty acids, and total energy intake in the etiology of human colon cancer.. Am. J. Clin. Nutr., 66(Suppl.): 1564s-1571s, 1997.
  7. Willet W. C., Stampfer M. J., Colditz G. A., Rosner B. A., Speizer F. E. Relation of meat, fat, and fiber intake to the risk of colon cancer in a prospective study among women.. N. Engl. J. Med., 323: 1664-1672, 1990.[Abstract]
  8. Bostick R. M., Potter J. D., Kushi L. H., Steinmetz K. A., McKenzie D. R., Gapstur S. M., Folsom A. R. Sugar, meat, and fat intake and non-dietary risk factors for colon cancer incidence in Iowa women (United States).. Cancer Causes & Control, 5: 38-52, 1994.[Medline]
  9. Hill M. J., Caygill C. P. J. Fish n-3 fatty acids and human colorectal and breast cancer mortality.. Eur. J. Cancer, 4: 329-332, 1995.
  10. Giovannucci E., Willett W. C. Dietary lipids and colon cancer. Ann Med, 26: 443-452, 1994.[Medline]
  11. Anti M., Armelao F., Marra G., Percesepe A., Bartoli G. M., Palozza P., Parrella P., Canetta C., Gentiloni N., De Vitis I. Effects of different doses of fish oil on rectal cell proliferation in patients with sporadic colon adenomas.. Gastroenterology, 107: 1709-1718, 1994.[Medline]
  12. Anti M., Marra G., Armelao F., Bartoli G. M., Ficarelli R., Percesepe A., De Vitis I., Maria G., Sofo L., Rapaccini G. Effect of {omega}-3 fatty acids on rectal mucosal cell proliferation in subjects at risk for colon cancer.. Gastroenterology, 103: 883-891, 1992.[Medline]
  13. Reddy B. S. Dietary fats and colon cancer: animal model studies.. Lipids, 27: 807-813, 1992.[Medline]
  14. Reddy B. S., Maruyama H. Effect of dietary fish oil on azoxymethane-induced colon carcinogenesis in male F344 rats.. Cancer Res., 46: 3367-3370, 1986.[Abstract/Free Full Text]
  15. Reddy B. S., Sugie S. Effect of different levels of {omega}-3 and {omega}-6 fatty acids on azoxymethane-induced colon carcinogenesis in F344 rats.. Cancer Res., 48: 6642-6647, 1988.[Abstract/Free Full Text]
  16. Reddy B. S., Burill C., Rigotty J. Effect of diets high in {omega}-3 and {omega}-6 fatty acids on initiation and post-initiation stages of colon carcinogenesis.. Cancer Res., 51: 487-491, 1991.[Abstract/Free Full Text]
  17. Lindner M. A. A fish oil diet inhibits colon cancer in mice.. Nutr. Cancer, 15: 1-11, 1991.[Medline]
  18. Deschner E. E., Lytle J. S., Wong G., Ruperto J. D., Newmark H. L. The effect of dietary {omega}-3 fatty acids (fish oil) on azoxymethanol-induced focal areas of dysplasia and colon tumor incidence.. Cancer (Phila.), 66: 2350-2356, 1990.[Medline]
  19. Karmali R. A., Marsh J., Fuchs C. Effect of {omega}-3 fatty acids on growth of a rat mammary tumor.. J. Natl. Cancer Inst. (Bethesda), 73: 457-461, 1984.
  20. Calder P. C., Davis J., Yaqoob P., Papa H., Thies F., Newsholme E. A. Dietary fish oil suppresses human colon tumor growth in athymic mice.. Clin. Sci. (Colch.), 94: 303-311, 1998.[Medline]
  21. Tsai W. S., Nagawa H., Kaizaki S., Tsuruo T., Muto T. Inhibitory effects of n-3 polyunsaturated fatty acids on sigmoid colon cancer transformants.. J. Gastroenterol., 33: 206-212, 1998.[Medline]
  22. Rose D. P., Connelly J. M. Dietary fat, fatty acids, and prostate cancer.. Lipids, 27: 798-803, 1992.[Medline]
  23. Rose D. P., Connelly J. M. Effects of dietary {omega}-3 fatty acids on human breast cancer growth and metastases in nude mice.. J. Natl. Cancer Inst. (Bethesda), 85: 1743-1747, 1993.[Abstract/Free Full Text]
  24. Rose D. P., Connelly J. M. Effects of fatty acids and eicosanoid synthesis inhibitors on the growth of two human prostate cancer cell lines.. Prostate, 18: 243-254, 1991.[Medline]
  25. Sakaguchi M., Imray C., David A., Rowley S., Jones C., Lawson N., Keighley M. R., Baker P. R., Neoptolemos J. P. Effects of dietary N-3 and saturated fats on growth rates of the human colonic cancer cell lines SW-620 and LS 174T in vivo in relation to tissue and plasma lipids.. Anticancer Res., 10: 1763-1768, 1990.[Medline]
  26. Lands W. E. M., Morris A., Liebelt A. Quantitative effects of dietary polyunsaturated fats on the composition of fatty acids in rat tissues.. Lipids, 25: 505-516, 1990.[Medline]
  27. Lands W. E. M., Morris A., Libelt A. Maintenance of lower proportions of (n-6) eicosanoid precursors in phospholipids of human plasma in response to added dietary (n-3) fatty acids.. Biochim. Biophys. Acta., 1180: 147-162, 1992.[Medline]
  28. Mohrhauer H., Holman R. T. The effect of dose level of essential fatty acids upon fatty acid composition of the liver.. J. Lipid Res., 4: 151-159, 1963.[Abstract]
  29. Holman R. T., Mohrhauer H. A hypothesis involving competitive inhibitions in the metabolism of polyunsaturated fatty acids.. Acta Chem. Scand., 17: 584-590, 1963.
  30. Bennett A., Berstock D. A., Carroll M. A., Stamford L. F., Wilson A. J. Breast cancer, its recurrence, and patient survival in relation to tumor prostaglandins. Adv. Prostaglandin Thromboxane Leukot. Res., 12: 299-302, 1983.
  31. Bennett A., McDonald A. M., Stamford L. F., Charlier E. M., Simpson J. J., Zebro T. Prostaglandins and breast cancer.. Lancet, 2: 624-626, 1977.[Medline]
  32. Powles T. J., Dowsett M., Easty G. C., Easty D. M., Neville A. M. Breast-cancer osteolysis, bone metastases, and anti-osteolytic effect of aspirin.. Lancet, 1: 608-610, 1976.[Medline]
  33. Fulton A., Rios A., Loveless S., Heppner G. Prostaglandins in tumor-associated cells Powles T. J. Bockman R. S. Honn K. V. Ramwell P. eds. . Prostaglandins and Cancer: First International Conference, : 701-703, Alan R. Liss, Inc. New York 1982.
  34. Levine L. Arachidonic acid transformation and tumor production.. Adv. Cancer Res., 35: 49-79, 1981.[Medline]
  35. DeWitt D. L., Smith W. L. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.. Proc. Natl. Acad. Sci. USA, 85: 1412-1416, 1988.[Abstract/Free Full Text]
  36. Merlie J. P., Fagan D., Mudd J., Needleman P. Isolation and characterization of the complementary DNA for sheep seminal vesicle prostaglandin endoperoxide synthase (cyclooxygenase).. J. Biol. Chem., 263: 3550-3553, 1988.[Abstract/Free Full Text]
  37. Yokoyama C., Takai T., Tanabe T. Primary structure of sheep prostaglandin endoperoxide synthase deduced from cDNA sequence.. FEBS Lett., 231: 347-351, 1988.[Medline]
  38. DeWitt D. L., El-Harith E. A., Kraemer S. A., Andrews M. J., Yao E. F., Armstrong R. L., Smith W. L. The aspirin and heme-binding sites of ovine and murine prostaglandin endoperoxide synthases.. J. Biol. Chem., 265: 5192-5198, 1990.[Abstract/Free Full Text]
  39. Yokoyama C., Tanabe T. Cloning of human gene encoding prostaglandin endoperoxide synthase and primary structure of the enzyme.. Biochem. Biophys. Res. Commun., 165: 888-894, 1989.[Medline]
  40. Kujubu D. A., Fletcher B. S., Varnum B. C., Lim R. W., Herschman H. R. TIS10, a phorbol ester tumor promoter-inducible mRNA from Swiss 3T3 cells, encodes a novel prostaglandin synthase/cyclooxygenase homologue.. J. Biol. Chem., 266: 12866-12872, 1991.[Abstract/Free Full Text]
  41. Xie W., Chipman J. G., Robertson D. L., Erikson R. L., Simmons D. L. Expression of a mitogen-responsive gene encoding prostaglandin synthase is regulated by mRNA splicing.. Proc. Natl. Acad. Sci. USA, 88: 2692-2696, 1991.[Abstract/Free Full Text]
  42. O’Banion M. K., Sadowski H. B., Winn V., Young D. A. A serum- and glucocorticoid-regulated 4-kilobase mRNA encodes a cyclooxygenase-related protein.. J. Biol. Chem., 266: 23261-23267, 1991.[Abstract/Free Full Text]
  43. Hla T., Neilson K. Human cyclooxygenase-2 cDNA.. Proc. Natl. Acad. Sci. USA, 89: 7384-7388, 1992.[Abstract/Free Full Text]
  44. Jones D. A., Carlton D. P., McIntyre T. M., Zimmerman G. A., Prescott S. M. Molecular cloning of human prostaglandin endoperoxide synthase type II and demonstration of expression in response to cytokines.. J. Biol. Chem., 268: 9049-9054, 1993.[Abstract/Free Full Text]
  45. Feng L., Sun W., Xia Y., Tang W. W., Chanmugam P., Soyoola E., Wilson C. B., Hwang D. Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression.. Arch. Biochem. Biophys., 307: 361-368, 1993.[Medline]
  46. Kutchera W., Jones D. A., Matsunami N., Groden J., McIntyre T. M., Zimmerman G. A., White R., Prescott S. M. Prostaglandin H synthase 2 is expressed abnormally in human colon cancer: evidence for a transcriptional effect.. Proc. Natl. Acad. Sci. USA, 93: 4816-4820, 1996.[Abstract/Free Full Text]
  47. Eberhart C. E., Coffey R. J., Radhika A., Giardiello F. M., Ferrenbach S., Dubois R. N. Up-regulation of cyclooxygenase 2 gene expression in human colorectal adenomas and adenocarcinomas.. Gastroenterology, 107: 1183-1188, 1994.[Medline]
  48. Sano H., Kawahito Y., Wilder R. L., Hashiramoto A., Mukai S., Asai K., Kimura S., Kato H., Kondo M., Hla T. Expression of cyclooxygenase-1 and -2 in human colorectal cancer.. Cancer Res., 55: 3785-3789, 1995.[Abstract/Free Full Text]
  49. Kargmann S. L., O’Neill G. P., Vickers P. J., Evans J. F., Mancini J. A., Serge J. Expression of prostaglandin G/H synthase-1 and -2 protein in human colon cancer.. Cancer Res., 55: 2556-2559, 1995.[Abstract/Free Full Text]
  50. Thun M. J., Namboodiri M. M., Heath C. W. Aspirin use and reduced risk of fetal colon cancer.. N. Engl. J. Med., 325: 1593-1596, 1991.[Abstract]
  51. Giovannucci E., Egan K. M., Hunter D. J., Stampfer M. J., Colditz G. A., Willett W. C., Speizer F. E. Aspirin and the risk of colorectal cancer in women.. N. Engl. J. Med., 333: 609-614, 1995.[Abstract/Free Full Text]
  52. Schreinemachers D. M., Everson R. B. Aspirin use and lung, colon, and breast cancer incidence in a prospective study.. Epidemiology, 5: 138-146, 1994.[Medline]
  53. Thun M. J., Namboodiri M. M., Calle E. E., Flanders W. D., Heath C. W., Jr. Aspirin use and risk of fatal cancer.. Cancer Res., 53: 1322-1327, 1993.[Abstract/Free Full Text]
  54. Kune G. A., Kune S., Watson L. F. Colorectal cancer risk, chronic illnesses, operations, and medications: case control results from the Melbourne Colorectal Cancer Study.. Cancer Res., 48: 4399-4404, 1988.[Abstract/Free Full Text]
  55. Rosenberg L., Palmer J. R., Zauber A. G., Warshauer M. E., Stolley P. D., Shapiro S. A hypothesis: nonsteroidal anti-inflammatory drugs reduce the incidence of large-bowel cancer.. J. Natl. Cancer Inst. (Bethesda), 83: 355-358, 1991.[Abstract/Free Full Text]
  56. Peleg I. I., Maibach H. T., Brown S. H., Wilcox C. M. Aspirin and nonsteroidal anti-inflammatory drug use and the risk of subsequent colorectal cancer.. Arch. Intern. Med., 154: 394-399, 1994.[Abstract/Free Full Text]
  57. Muscat J. E., Stellman S. D., Wynder E. L. Nonsteroidal anti-inflammatory drugs and colorectal cancer.. Cancer (Phila.), 74: 1847-1854, 1994.[Medline]
  58. Suh O., Mettlin C., Petrelli N. J. Aspirin use, cancer, and polyps of the large bowel.. Cancer (Phila.), 72: 1171-1177, 1993.[Medline]
  59. Hoshimaru M., Ray J., Sah D. W., Gage F. H. Differentiation of the immortalized adult neuronal progenitor cell line HC2S2 into neurons by regulatable suppression of the v-myc oncogene.. Proc. Natl. Acad. Sci. USA, 93: 1518-1523, 1996.[Abstract/Free Full Text]
  60. Pear W. S., Nolan G. P., Scott M. L., Baltimore D. Production of high-titer helper-free retroviruses by transient transfection.. Proc. Natl. Acad. Sci. USA, 90: 8392-8396, 1993.[Abstract/Free Full Text]
  61. Lee S. H., Soyoola E., Chanmugam P., Hart S., Sun W., Zhong H., Lieu S., Simmons D., Hwang D. Selective expression of mitogen-inducible cyclooxygenase in macrophages stimulated with lipopolysaccharide.. J. Biol. Chem., 267: 25934-25938, 1992.[Abstract/Free Full Text]
  62. Chanmugam P., Feng L., Lieu S., Jang B. C., Boudreau M., Yu G., Lee S. H., Kwon H. J., Beppu T., Yoshida M., et al Radicicol, a protein tyrosine kinase inhibitor, suppresses the expression of mitogen-inducible cyclooxygenase in macrophages stimulated with lipopolysaccharide and in experimental glomerulonephritis.. J. Biol. Chem., 270: 5418-5426, 1995.[Abstract/Free Full Text]
  63. Boudreau M. D., Chanmugam P. S., Hart S. B., Lee S. H., Hwang D. H. Lack of dose response by dietary n-3 fatty acids at a constant ratio of n-3 to n-6 fatty acids in suppressing eicosanoid biosynthesis from arachidonic acid.. Am. J. Clin. Nutr., 54: 111-117, 1991.[Abstract/Free Full Text]
  64. Sheng H., Shao J., Kirkland S. C., Isakson P., Coffey R. J., Morrow J., Beauchamp R. D., DuBois R. N. Inhibition of human colon cancer cell growth by selective inhibition of cyclooxygenase-2.. J. Clin. Investig., 99: 2254-2259, 1997.[Medline]
  65. He T. C., Sparks A. B., Rago C., Hermeking H., Zawel L., da Costa L. T., Marin P. J., Vogelstein B., Kinzler K. W. Identification of c-MYC as a target of the APC pathway.. Science (Washington DC), 281: 1509-1512, 1998.[Abstract/Free Full Text]
  66. Oshima M., Dinchuk J. E., Kargman S., Oshima H., Hancock B., Kwong E., Trzaskos J., Evans J. F., Taketo M. M. Suppression of intestinal polyposis in APC {Delta}716 knockout mice by inhibition of cyclooxygenase 2 (COX-2).. Cell, 87: 803-809, 1996.[Medline]
  67. Tsujii M., DuBois R. N. Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2.. Cell, 83: 493-501, 1995.[Medline]
  68. Tsujii M., Kawano S., DuBois R. N. Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential.. Proc. Natl. Acad. Sci. USA, 94: 3336-3340, 1997.[Abstract/Free Full Text]
  69. Tsujii M., Kawano S., Tsuji S., Takei Y., Sawaoka H., Omae A., Murata H., Kawai N., Lijima H., Hori M. Expression of COX-1 and COX-2 and gastrointestinal diseases. Nippon Naika Gakkai Zasshi, 87: 2114-2121, 1998.[Medline]
  70. Trifan O. C., Smith R. M., Thompson B. D., Hla T. Overexpression of cyclooxygenase-2 induces cell cycle arrest.. J. Biol. Chem., 274: 34141-34147, 1999.[Abstract/Free Full Text]
  71. Chiu C. H., McEntee M. F., Whelan J. Sulindac causes rapid regression of preexisting tumors in Min/+ mice independent of prostaglandin biosynthesis.. Cancer Res., 57: 4267-4273, 1997.[Abstract/Free Full Text]
  72. Lehmann J. M., Lenhard J. M., Oliver B. B., Ringold G. M., Kliewer S. A. Peroxisome proliferator-activated receptors {alpha} and {gamma} are activated by indomethacin and other nonsteroidal anti-inflammatory drugs.. J. Biol. Chem., 272: 3406-3410, 1997.[Abstract/Free Full Text]
  73. Meade E. A., McIntyre T. M., Zimmerman G. A., Prescott S. M. Peroxisome proliferators enhance cyclooxygenase-2 expression in epithelial cells.. J. Biol. Chem., 274: 8328-8334, 1999.[Abstract/Free Full Text]
  74. Sarraf P., Mueller E., Jones D., King F. J., DeAngelo D. J., Partridge J. B., Holden S. A., Chen L. G., Singer S., Fletcher C., Speigelman B. M. Differentiation and reversal of malignant changes in colon cancer through PPAR{gamma}.. Nat. Med., 4: 1046-1052, 1998.[Medline]
  75. Bishop-Bailey D., Hla T. Endothelial cell apoptosis induced by the peroxisome proliferator-activated receptor (PPAR) ligand 15-deoxy-{Delta} 2, 14-prostaglandin J2.. J. Biol. Chem., 274: 17042-17048, 1999.[Abstract/Free Full Text]
  76. Chinetti G., Griglio S., Antonucci M., Torra I. P., Delerive P., Majd Z., Fruchart J-C., Chapman J., Najib J., Staels B. Activation of proliferator-activated receptors {alpha} and {gamma} induces apoptosis of human monocyte-derived macrophages.. J. Biol. Chem., 273: 25573-25580, 1998.[Abstract/Free Full Text]
  77. Lu X., Xie W., Reed D., Bradshaw W. S., Simmons D. L. Nonsteroidal anti-inflammatory drugs cause apoptosis and induce cyclooxygenases in chicken embryo fibroblasts.. Proc. Natl. Acad. Sci. USA, 92: 7961-7965, 1995.[Abstract/Free Full Text]
  78. Shiff S. J., Oiao L., Tsai L. L., Rigas B. Sulindac sulfide, an aspirin-like compound, inhibits proliferation, causes cell cycle quiescence, and induces apoptosis in HT-29 colon adenocarcinoma cells.. J. Clin. Investig., 96: 491-503, 1995.
  79. Piazza G. A., Rahm A. L., Krutzsch M., Speri G., Paranka N. S., Gross P. H., Brendel K., Burt R. W., Alberts D. S., Pamucku R. Antineoplastic drugs sulindac sulfide and sulfone inhibit cell growth by inducing apoptosis.. Cancer Res., 55: 3110-3116, 1995.[Abstract/Free Full Text]
  80. Paik J. H., Ju J. H., Lee J. Y., Boudreau M. D., Hwang D. Two opposing effects of nonsteroidal anti-inflammatory drugs on the expression of the inducible cyclooxygenase-mediation through different signaling pathways.. J. Biol. Chem., 275: 28173-28179, 2000.[Abstract/Free Full Text]
  81. Xu H. E., Lambert M. H., Montana V. G., Park D. G., Blanchard S. G., Brown P. J., Sternbach D. D., Lehman J. M., Wisely G. B., Willson T. M., Kliewer S. A., Milburn M. V. Molecular recognition of fatty acids by peroxisome proliferator-activated receptors.. Mol. Cell, 3: 397-403, 1999.[Medline]
  82. Forman B. M., Chen J., Evans R. M. Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors {alpha} and {delta}.. Proc. Natl. Acad. Sci. USA, 94: 4312-4317, 1997.[Abstract/Free Full Text]
  83. Gottlicher M., Widmark E., Li Q., Gustafsson J. A. Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid reporter.. Proc. Natl. Acad. Sci. USA, 89: 4653-4657, 1992.[Abstract/Free Full Text]
  84. Kliewer S. A., Sundseth S. S., Jones S. A., Brown P. J., Wisely G. B., Koble C. S., Devchand P., Wahli W., Willson T. M., Lenhard J. M., Lehmann J. M. Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors {alpha} and {gamma}.. Proc. Natl. Acad. Sci. USA, 94: 4318-4323, 1997.[Abstract/Free Full Text]
  85. Krey G., Braissant O., L’ Horset F., Kalkhoven E., Perroud M., Parker M. G., Wahli W. Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol. Endocrinol., 11: 779-791, 1997.[Abstract/Free Full Text]
  86. Yu K., Bayona W., Kallen C. B., Harding H. P., Ravera C. P., McMahon G., Brown M., Lazar M. A. Differential activation of peroxisome proliferator-activated receptors by eicosanoids.. J. Biol. Chem., 270: 23975-23983, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Prevention ResearchHome page
S. E. Olivo-Marston, Y. Zhu, R. Y. Lee, A. Cabanes, G. Khan, A. Zwart, Y. Wang, R. Clarke, and L. Hilakivi-Clarke
Gene Signaling Pathways Mediating the Opposite Effects of Prepubertal Low-Fat and High-Fat n-3 Polyunsaturated Fatty Acid Diets on Mammary Cancer Risk
Cancer Prevention Research, December 1, 2008; 1(7): 532 - 545.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
L. A. Sauer, R. T. Dauchy, D. E. Blask, J. A. Krause, L. K. Davidson, and E. M. Dauchy
Eicosapentaenoic Acid Suppresses Cell Proliferation in MCF-7 Human Breast Cancer Xenografts in Nude Rats via a Pertussis Toxin-Sensitive Signal Transduction Pathway
J. Nutr., September 1, 2005; 135(9): 2124 - 2129.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
Y. Denkins, D. Kempf, M. Ferniz, S. Nileshwar, and D. Marchetti
Role of {omega}-3 polyunsaturated fatty acids on cyclooxygenase-2 metabolism in brain-metastatic melanoma
J. Lipid Res., June 1, 2005; 46(6): 1278 - 1284.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
G. Calviello, F. Di Nicuolo, S. Gragnoli, E. Piccioni, S. Serini, N. Maggiano, G. Tringali, P. Navarra, F. O. Ranelletti, and P. Palozza
n-3 PUFAs reduce VEGF expression in human colon cancer cells modulating the COX-2/PGE2 induced ERK-1 and -2 and HIF-1{alpha} induction pathway
Carcinogenesis, December 1, 2004; 25(12): 2303 - 2310.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
L. A. Sauer, R. T. Dauchy, D. E. Blask, J. A. Krause, L. K. Davidson, E. M. Dauchy, K. J. Welham, and K. Coupland
Conjugated Linoleic Acid Isomers and Trans Fatty Acids Inhibit Fatty Acid Transport in Hepatoma 7288CTC and Inguinal Fat Pads in Buffalo Rats
J. Nutr., August 1, 2004; 134(8): 1989 - 1997.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
S. C Larsson, M. Kumlin, M. Ingelman-Sundberg, and A. Wolk
Dietary long-chain n-3 fatty acids for the prevention of cancer: a review of potential mechanisms
Am. J. Clinical Nutrition, June 1, 2004; 79(6): 935 - 945.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
W. E. Hardman
Omega-3 Fatty Acids to Augment Cancer Therapy
J. Nutr., November 1, 2002; 132(11): 3508S - 3512.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boudreau, M. D.
Right arrow Articles by Hwang, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boudreau, M. D.
Right arrow Articles by Hwang, D. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online