Cancer Research CR Surrogates  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welzel, N.
Right arrow Articles by Jaeger, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welzel, N.
Right arrow Articles by Jaeger, U.
[Cancer Research 61, 1629-1636, February 15, 2001]
© 2001 American Association for Cancer Research


Molecular Biology and Genetics

Templated Nucleotide Addition and Immunoglobulin JH-Gene Utilization in t(11;14) Junctions: Implications for the Mechanism of Translocation and the Origin of Mantle Cell Lymphoma1

Natascha Welzel, Trang Le, Rodrig Marculescu, Gerlinde Mitterbauer, Andreas Chott, Christiane Pott, Michael Kneba, Ming-Qing Du, Rajko Kusec, Johannes Drach, Markus Raderer, Christine Mannhalter, Klaus Lechner, Bertrand Nadel and Ulrich Jaeger2

Department of Internal Medicine I, Division of Hematology [N. W., T. L., R. M., K. L., B. N., U. J.], Department of Internal Medicine I, Division of Oncology [J. D., M. R.], Department of Clinical Chemistry and Laboratory Medicine [G. M., C. M.], and Department of Pathology [A. C.], University of Vienna, A-1090 Vienna, Austria; Department of Medicine II, University of Kiel, 24116 Kiel, Germany [C. P., M. K.]; Department of Histopathology, Royal Free and University College London Medical School, WC1E 6JJ London, United Kingdom [M-Q. D.]; and Department of Molecular Medicine, Ruder Boskovic Institute, HR-10000 Zagreb, Croatia [R. K.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The t(11;14)(q13;q32) between the BCL-1 and immunoglobulin heavy chain gene (IgH) loci in mantle cell lymphoma (MCL) are believed to be mediated by the mechanism of V(D)J recombination similar to the t(14;18) in follicular lymphoma (FL). We have recently shown that the t(14;18) event creates staggered double-strand breaks in the BCL-2 locus, and that the t(14;18) junctions contain templated nucleotide insertions (T-nucleotides; U. Jäger et al., Blood, 95: 3520–3529, 2000). Reasoning that the earlier (pregerminal center) B-cell origin of MCL might be reflected in a different molecular structure of the chromosomal breakpoints, we PCR-amplified diagnostic samples from 93 patients. Thirty-six samples (39%) were positive for the direct (BCL-1/JH) and 23 for both direct and reciprocal (DH/BCL-1) junctions. The breaks on chromosome 14 exhibited features of V(D)J-mediated recombination as shown by DH and JH coding end processing. However, duplications of BCL-1 sequences in 39% of the 23 patients indicate staggered double-strand breaks in the major translocation cluster region (MTC). This is incompatible with V(D)J recombination and indicates a different mechanism of cleavage. The use of JH6 in the junctions (39%) was similar to that in the immunoglobulin genes of normal B cells and B-CLL, but considerably less than in FL. Only 2 of 36 samples contained a BCL-1/DJH rearrangement, which was indicative of a previous DJH rearrangement. Most importantly, 19% of the BCL-1/IgH junctions with inserts of >=5 nucleotides contained error-prone copies (T-nucleotides) of 8–12 nucleotides originating from the surrounding BCL-1 or IgH regions, a lower rate than in FL. No correlation was found between the addition of T-nucleotides and the rate of somatic mutation in the immunoglobulin genes. We conclude that the t(11;14) and t(14;18) use the same basic mechanism of translocation including V(D)J-mediated recombination, double-strand staggered breaks, and template-dependent, error-prone DNA-synthesis. However, the distinct differences in the utilization of JH regions suggest that the t(11;14) occurs predominantly during an attempted primary DH-JH rearrangement in early B cells, whereas the t(14;18) mostly occurs during secondary rearrangement. This is in agreement with the pregerminal center B-cell origin of MCL.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MCL3 is a non-Hodgkin’s lymphoma arising from a subset of naive B cells localized in primary follicles or in the mantle region of secondary follicles (1 , 2) . The lymphoma cells are characterized by a CD19+, CD5+, CD23- phenotype. The majority of MCLs show little or no somatic mutation of their immunoglobulin genes, which suggests that they originate from pregerminal center B cells (3) . However, some cases exhibit signs of ongoing mutations, which suggests that MCLs represent a heterogeneous entity (4 , 5) . The specific hallmark of MCL is overexpression of the cyclin D1 protein caused by the chromosomal translocation t(11;14)(q13;q32) that juxtaposes the BCL-1 (PRAD-1) gene with the immunoglobulin heavy chain locus (6, 7, 8) . Thpp t(11;14) can be detected by fluorescence in situ hybridization in virtually all patients (9, 10, 11, 12) . At the molecular level, the translocation is reciprocal, creating a BCL-1/JH fusion on the der14 chromosome and a DH/BCL-1 fusion on the der11 chromosome (13) . Thirty to 55% of the breaks in BCL-1 occur within the 80- to 100-bp MTC and can be PCR-amplified (Refs. 14, 15, 16, 17, 18 ; Fig. 1Citation ).



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Primers used for the amplification of (A) BCL-1/JH (direct) and (B) DH/BCL-1 (reciprocal) breakpoints. Hatched box, the BCL-1 gene, including the MTC-region; broken lines (INSERTION), de novo insertions; numbered, DH/JH families; arrows, the different primers.

 
Recent evidence suggests that the process of translocation may be preceded by alterations affecting the genomic stability, such as deletions or mutations in the ATM gene (19, 20, 21, 22, 23) . The t(11;14) event itself is believed to occur at the time of an attempted DH-JH rearrangement in early B cells. The pattern of direct (BCL-1/JH) and reciprocal (DH/BCL-1) junctions as well as the presence of presumably non-templated nucleotides ("N-regions") added by Tdt suggested that the mechanism of V(D)J recombination is responsible for this illegitimate joining similar to the t(14;18) translocation in FL (24, 25, 26, 27, 28) . Some authors proposed the presence of cryptic immunoglobulins RSSs in the BCL-1 MTC (25) . However, these hypotheses are based on only a few observations in cloned or PCR-amplified DNA sequences.

We have recently shown that the t(14;18) in FL involves at least two distinct mechanisms: V(D)J recombination mediating the breaks on chromosome 14, and an additional mechanism, distinct from V(D)J recombination and yet unidentified, creating the breaks on chromosome 18. In addition, this analysis revealed the insertion of T-nucleotides in the junctions between the BCL-2 and JH or DH genes (29 , 30) . T-nucleotides are copied from the regions surrounding the breakpoints and contain point mutations and/or insertions/deletions suggesting the presence of error-prone template-dependent DNA synthesis at the time of illegitimate joining. Moreover, in the t(14;18), we found a marked skew toward the most 5'-DH and most 3'-JH regions, which suggested that the t(14;18) in FL could occur during an attempted secondary rearrangement.

This prompted us to investigate the direct and reciprocal t(11;14) junctions in a large sampling of MCL. This should enable us to compare the t(14;18) and t(11;14) and to test the hypothesis that they are generated by a similar mechanism of translocation despite their different cellular origin: germinal (FL) versus pregerminal center (MCL). We analyzed diagnostic material from 93 MCLs by PCR and obtained sequence information on 36 BCL-1/JH (direct) junctions (39%). These 36 samples were further amplified with primers for the DH/BCL-1 (reciprocal) junctions giving a final number of 23 direct as well as reciprocal positive samples. Analysis of this library revealed that the t(11;14) uses the same mechanism as t(14;18) involving RSS-mediated breaks at the IgH locus, but a different mechanism of cleavage at the oncogene breakpoint region. MCLs also show the presence of T-nucleotides in their t(11;14) junctions. However, the number of T-nucleotides as well as the usage of JH segments show distinct differences from FL which are consistent with the earlier B-cell origin of MCL.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients and DNA Samples.
We analyzed samples from 93 patients diagnosed to have MCL according to the Revised European-American Lymphoma classification after informed consent was obtained (1) . DNA was prepared from various diagnostic tissues including peripheral blood (n = 16), bone marrow (n = 27), and fresh (n = 7) or paraffin-embedded (n = 43) lymph nodes, according to standard procedures. Two different materials were analyzed from four direct and reciprocal PCR-positive patients to confirm intrasample fidelity.

PCR Amplification of the Direct and Reciprocal Breakpoints.
Genomic DNA (100 ng) was amplified for the direct (BCL-1/JH) breakpoints with BCL-Cn and JHex-B (29) primers (Fig. 1)Citation for 30 cycles with the following conditions: 1 min at 94°C and 1 min at 58°C. The BCL-Cn primer is located 184 bp 3' of the BCL-1 sequence (GenBank accession no. S77049). One µl of the primary PCR was used for secondary nested amplifications with BCL-An and JHco-B (29) primers for 25 cycles with the same conditions as above except for the annealing temperature, 61°C.

For the reciprocal breakpoints (DH/BCL-1) a set of seven DH primers (29) mapping all of the members of each family was used. Again, 100 ng of genomic DNA were amplified with one of the D1 to D7 primers and the REV 1B primer for 30 cycles (30 s at 94°C, 30 s at 58°C, and 30 s at 72°C). One µl of each of the seven amplifications was taken for the double-nested PCR with the corresponding D1N1 to D7N1 primer (29) and the REV 2B primer, with the same conditions as for the primary PCR except for the annealing temperature, 61°C. REV 1B/2B primers are located at the end of the known BCL-1 sequence (GenBank accession no. S77049). All PCRs were amplified with a (4:1) mix of Taq and Vent polymerase. From the 36 samples that were positive for the direct breakpoint, 13 remained negative for the reciprocal PCR.

PCR Amplification of the V(D)J Idiotype.
Vex 1–7 primers constitute a set of primers designed to amplify most members of the seven human VH families. Genomic DNA (100 ng) was taken with one of the Vex 1 to Vex 7 primers and the JHex-B primer for 30 cycles (30 s at 94°C, 30 s at 60°C, and 30 s at 72°C). One µl of each of the seven amplifications was taken for the double nested secondary PCR with the corresponding VH-1 to VH-6 primer and the JHco-B primer, with the same conditions as for the primary PCR except for the annealing temperature, 63°C, and the cycles, 25 instead of 30.

Sequencing.
For the direct and reciprocal breakpoints, the PCR product was directly sequenced with an IRD-800-labeled BCL-AM and REV-2M primer as described previously (29) . For the V(D)J segments, the PCR product was subcloned and then sequenced with an M13 Forward (-20) primer (Invitrogen, Groningen, The Netherlands) All of the mutations detected were verified by repeating PCR and DNA sequence analyses. One nucleotide difference with the published sequence (additional C in position 492) was noted (Segal et al.; Ref. 31 ).

BclI primers (5' to 3') were as follows: BCL-Cn, CTACTGAAGGACTTGTGGGTTG; BCL-An/BCL-AM, CGAGGAGCATAATTGCTGCACTG; REV-1B, GGAAGTCTCACCTAGTGGAGC; REV-2B, GGAGCAGTGAACACCAGTGC; and REV-2 M, CAGTGAACACCAGTGCCCCA.

VH primers (5' to 3') were as follows: VH-1, CCTCAGTGAAGGTCTCCTGCAAGG; VH-2, TCCTGCGCTGGTGAAAGCCACACA; VH-3, GGTCCCTGAGACTCTCCTGTGCA; VH-4A, TCGGAGACCCTGTCCCTCACCTGCA; VH-4B, CGCTGTCTCTGGTTACTCCATCAG; VH-5, GAAAAAGCCCGGGGAGTCTCTGAA; and VH-6, CCTGTGCCATCTCCGGGGACAGTG.

Vex primers (5' to 3') were as follows: Vex 1, TCTGGGGCTGAGGTGAAGAA; Vex 2, ACCTTGAAGGAGTCTGGTCC; Vex 3, GTCCCTGAGACTCTCCTGT; Vex 4: CAGGACTGGTGAAGCCTTC; Vex 5, GCTGGTGCAGTCTGGAGC; Vex 6, CAGCTGCAGCAGTCAGGTC; and Vex 7, CAGGTGCAGCTGGTGCAATC.

Statistical Analysis.
T-nucleotides are defined as short sequences of at least 5 nucleotides inserted in the breakpoints, with sufficient homology to the adjacent flanking sequences to exclude their concomitant presence by chance alone. The significance of identification of T-nucleotides in each sample was estimated using a binomial test, as described previously (29) . The P <= 0.05 was selected as the point of high statistical significance.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
IgH and BCL-1 MTC Breakpoints.
A positive PCR result for the BCL-1/JH (direct) junction was obtained in 36 (39%) of 93 patients, whereas only 23 patients (25%) were positive for the DH/BCL-1 (reciprocal) junction. The direct and reciprocal sequences from these 23 patients were analyzed regarding their breakpoints and junction regions (Tables 1Citation and 2)Citation . The DH and JH breakpoints show features of V(D)J-mediated recombination such as precise cleavage at the coding sequence/RSS border and nucleotide deletions at the coding end. This indicates that the breaks at the IgH locus occur during an attempted DH to JH rearrangement as described previously (25 , 29) .


View this table:
[in this window]
[in a new window]

 
Table 1 Sequence library of the direct (BCL-1/JH) junctions

 

View this table:
[in this window]
[in a new window]

 
Table 2 Sequence library of the reciprocal (DH/MTC) junctions

 
The BCL-1 MTC breakpoints are distributed between nucleotides 411 and 561 according to GenBank sequence S77049 published by Segal et al. (31) . Comparison of the BCL-1 sequences in the direct and reciprocal breakpoints revealed deletions (loss of MTC sequences) of 1–29 nucleotides in 13 (57%) of the samples. No gain or loss of nucleotides was found in one sample (4%). However, nine (39%) of the breakpoints showed MTC duplications of 1–27 nucleotides length. This indicates an initial staggered, double-strand break at the BCL-1 locus that is not compatible with RSS-mediated V(D)J recombination. Thus the t(11;14) and the t(14;18) use similar mechanisms of cleavage with V(D)J-mediated breaks at the IgH locus, but a different pathway at the oncogene breakpoint regions.

Utilization of JH and DH Segments.
The following JH regions were used in the 36 direct translocation samples (Table 1Citation ; sample 24 to 36 not shown): JH3 (n = 1; 3%); JH4 (n = 9; 25%); JH5 (n = 7; 19%); JH6 (n = 14; 39%); and unclassifiable JH4/5 (n = 5; 14%; Fig. 2Citation ). The use of JH in the t(11;14) junctions is similar to the distribution of JH in the idiotypes of normal B cells or B-CLL (32, 33, 34) cells with the exception of a shift from JH4 to JH5. Most importantly, there is no pronounced skew toward the most 3' segment (JH6) as in the t(14;18) in FL (70% JH6; Ref. 29 ). Various DH families were used: DH2 (26%); DH3 (48%); DH4 (13%); DH5 (9%); and DH6 (4%). We note the low number (n = 23) of PCR-detectable DH/BCL-1 breakpoints, which may simply be attributable to the location of primers or the length of the PCR-product. On the other hand, this may reflect thus-far-unidentified structural differences at the reciprocal breakpoint. Nevertheless, the fact that 23 (64%) of 36 BCL-1/JH-positive samples have a DH/BCL-1 reciprocal junction clearly indicates that the translocation occurs during an attempted DH-JH rearrangement.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Comparison of the JH usage in the reciprocal breakpoints between normal B-cell [n = 71; reported by Brezinschek et al. (32) ], MCL (n = 31), and FL [n = 37; reported by Jäger et al. (29) ].

 
T-Nucleotide Additions in BCL-1/IgH Junctions.
The direct and reciprocal joining regions contained insertions of up to 45 nucleotides (Tables 1Citation and 2)Citation . Because we had recently noted that the t(14;18) in FL contain T-nucleotide additions, we examined the BCL-1/IgH junctions for the presence of these T-nucleotides (29) . Indeed, statistically significant, nonrandom copies of the surrounding MTC, IgH or opposite junctional regions were found in 7 (30%) of 23 MCL samples or 7 (19%) of 37 junctions containing inserts of >=5 de novo nucleotides. These T-nucleotides were 8–12 nucleotides in length and exhibited mismatches with the germ-line sequence (point mutations or deletions) in six of seven cases (Table 3Citation ; Fig. 3Citation A–G). For instance, patient 1 has the 8-bp sequence ACTTCGCG in the reciprocal junction (Fig. 3A)Citation . The direct junction shows the same sequence in reverse complement form: CGCGAAGT. Patient 22 has the sequence GgGACGGGA in the direct junction. This is the reverse complement of the MTC sequence TCCCGTCAC with one A to G mutation (Fig. 3G)Citation . In contrast to the previous assumption that t(11;14) junctions contain only nontemplated N-nucleotides added by Tdt, these findings indicate the involvement of a template-dependent error-prone DNA polymerase in illegitimate recombination in at least 19% of the breakpoints. This rate is considerably less than in FL (34%; Ref. 29 ; Table 4Citation ).


View this table:
[in this window]
[in a new window]

 
Table 3 T-nucleotides with high significance found in the direct and reciprocal breakpoints

 


View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A–G, comparison of the nucleotide sequence between the germ-line chromosome 11 (MTC) and 14 (DH, JH) and direct (MTC/JH) and reciprocal (DH/MTC) breakpoints resulting from the translocation of the indicated sample. Vertical lines and dots, nucleotide identity; between dots, de novo nucleotide insertions in the breakpoints; lower case letters, the remaining DH and JH sequences; boxed, homologous regions; underlined bold letters, mismatches; *, deletions; arrows, the reverse complement orientation relative to the corresponding boxed sequence.

 

View this table:
[in this window]
[in a new window]

 
Table 4 Comparison of molecular characteristics in MCL and FL

 
DH Gene Segments in the t(11;14) Junctions.
As described previously, the t(11;14) junctions may contain DH segments indicative of a preceding primary DH-JH rearrangement (25 , 35) . Applying the criteria in which sequences of 10-nucleotide lengths with a maximum of two mismatches are accepted as a DH region (36) , we could identify only two such segments [DH1–26, patient 2 (Table 1)Citation ; DH3–3, not shown] in 36 junctions (5.6%).

Idiotypic IgH Sequences and T-nucleotides.
The presence of T-nucleotides with their pattern of mutations and/or deletions prompted us to examine direct and reciprocal PCR-positive cases for somatic mutations in their IgH genes. An unequivocally monoclonal result was obtained in 11 of the 23 samples. There was a preponderance of VH1 (4 times VH1–02,-08,-18) and VH4 (5 times VH4–34 and one VH4–39). One sample contained a VH3–21. The rate of VH mutations was low as expected, with an average of 1.8% (range, 0–4.8%). Only five samples had more than 2% mutations (2.4–4.8%), a rate that may be attributed to somatic hypermutation (37) . T-nucleotides in the t(11;14) junctions were present in 2 of the 11 patients. Both of them had T-nucleotide mutations (patient 22) or deletions (patient 7), at VH-mutation frequencies of 0.4 or 2.4%, respectively. On the other hand, the patient with the highest mutation frequency (patient 2; 4.8%) did not have T-nucleotides. Thus, there is no obvious association between the rate of somatic mutation and the presence of T-nucleotides at present.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The generation of a large library of direct and reciprocal t(11;14) junctions in MCLs allowed us to systematically test several hypotheses induced by a number of sporadic observations. Moreover, we are now able to put these data into the context of other B-cell lymphomas, in particular FL.

t(11;14) Breaks Are Caused by Different Mechanisms at the IgH and BCL-1 Loci.
The major dogma regarding the mechanism of the t(11;14) is that V(D)J-recombination is responsible for the breaks at both the IgH and BCL-1 loci (24) . Some authors have postulated the presence of irregular or cryptic RSS in the BCL-1 that could guide V(D)J-like recombination (38) . The duplications of BCL-1 sequences found in this study suggest that the breaks are attributable to an initial staggered double-strand break in at least 39% of MCLs. This is incompatible with the mechanism of V(D)J recombination, but very similar to the t(14;18), in which duplications of BCL-2 are found in 30% of the cases (Ref. 29 ; Table 4Citation ). Speculation as to the mechanism of cleavage may include the transpositional activity of RAG-1/RAG-2, pathways of nonhomologous DNA end rejoining and others (39, 40, 41) .

BCL-1/IgH Junctions Contain T-nucleotides.
As in the t(14;18), we also found the addition of T-nucleotides in the BCL-1/IgH junctions. This is in contrast to previous reports on the mechanism of t(11;14), which assumed the nontemplated addition of N-nucleotides by Tdt. The presence of T-nucleotides indicates that a template-dependent, error-prone mechanism is active during illegitimate recombination, which could be involved in the repair of the ends. The recently discovered DNA polymerase µ represents an attractive canwdidate for an enzyme responsible for this phenomenon in t(11;14) as well as in t(14;18) (42) . Polymerase µ is preferentially expressed in secondary lymphoid organs. Its has a template-dependent polymerase activity with a high error-rate and possesses Tdt-like activity. It is important to note that the number of T-nucleotides is considerably lower in t(11;14) than in t(14;18), as follow: 30 versus 42% of the samples and 19 versus 34% of the breakpoints with de novo nucleotide insertions >=5 (Table 4)Citation . Even if it is taken into account that the T-nucleotides described here are restricted by statistical considerations, this clearly indicates differences between t(11;14) and t(14;18). These may simply be attributable to differences in the structure, location, or conformational or transcriptional status of the BCL-1 and BCL-2 genes at the time of translocation. Alternatively, timing of the illegitimate recombination during B-cell differentiation may be important.

Lack of Evidence for an Association between the Process of Somatic Hypermutation and the t(11;14) Mechanism.
FLs have a high rate of somatic hypermutation [average, 9.9% (43) ], whereas some cases of MCLs show more than 2% mutations in their IgH genes. However, the pattern of deletions, duplications, mutations, and T-nucleotide additions in the t(14;18) and t(11;14) junctions is strongly reminiscent of the mechanism of somatic hypermutation (44 , 45) . Because there may be two populations of MCLs with or without SHM, we investigated a possible association between somatic mutations in the idiotype and T-nucleotides. The patient with the highest mutation rate (patient 2) had no T-nucleotides, whereas one of two cases with T-nucleotides had a low mutation rate. Thus, there is no obvious association between the mechanism of T-nucleotide addition and the process of SHM. This is reminiscent of B-CLL, in which it has recently been shown that somatic VH-mutations are not directly linked to the frequency of mutations in the BCL-6 gene (46) .

Stage of B-Cell Differentiation and Occurrence of t(11;14) and t(14;18).
We have previously hypothesized that the t(14;18) could occur during an attempted secondary DJH-rearrangement in B cells that might take place in the bone marrow, but could also occur in the germinal center of the B-cell follicle (29) . This is based on the observation that the t(14;18) in FL use the most 5'-DH and the most 3'-JH (JH6, 71%) gene segments and has been further supported by the detection of the corresponding primary DJH-rearrangements in two cases of FL.4 In contrast, the utilization of JH regions in t(11;14) (JH4:JH5:JH6, 25:19:39%) is not much different from that of normal B cells (JH4:JH5:JH6, 41:7:38%; Ref. 32 ) or CLL cells (JH4:JH6, 42:37%; Ref. 34 ). In particular, the use of JH6 is similar in MCL and normal B cells but is much higher in FL (JH4:JH5:JH6, 15:8:70%; Ref. 29 ; Table 4Citation ), which suggests that the t(11;14) happens predominantly during primary rearrangements in early B cells, whereas the t(14;18) occurs mainly during an attempted secondary DH to JH rearrangement. This fits well with the pregerminal origin of MCL and the germinal center origin of FL. Nevertheless, the occurrence of SHM in some V(D)J junctions, the presence of rare BCL-1/DJH rearrangements, and the presence of T-nucleotides in some breakpoints might indicate that a small fraction of the t(11;14) translocations take place during an attempted secondary DH to JH rearrangement in a later stage of B-cell differentiation (Table 1Citation , patient 2). This is in agreement with the previously postulated heterogeneous status of the MCL population (47) .

Error-prone, Template-dependent Repair and Genetic Instability in MCL.
The majority of MCL contains known aberrations that may influence genetic stability. The t(11;14) is accompanied by mutations and/or deletions of p53, the CDK-inhibitor family, and of the ATM gene (22) . ATM deletions are found in ~40% of MCL (19 , 21) . Deletions or mutations of these genes involved in cell cycle regulation and DNA repair could potentially contribute to the mechanism of illegitimate recombination as shown in ATM-deficient patients or mice (19 , 48) . There is evidence that suggests that the ATM deletion/mutation may be the primary defect (23 , 49) . One could envision that an alternative (more primitive?), error-prone mechanism that allows illegitimate joining is activated in repair-deficient B cells. This would explain the addition of T-nucleotides in the junctions.

Altogether, our data indicate that the t(11;14) is generated by the same basic mechanism of translocation as the t(14;18) with V(D)J-mediated breaks in the IgH locus and double-strand, staggered breaks at the oncogene loci. MCL also shows error-prone template-dependent DNA synthesis during religation of the reciprocal chromosomes caused by an enzymatic machinery which is still unknown. However, there are distinct differences in the utilization of JH regions as well as in the number of T-nucleotides in the translocation junctions which could well reflect the earlier B-cell (pregerminal center) origin of MCL. Although there may still be some dichotomy within the origin of MCL, we propose that the BCL-1/IgH translocation is predominantly generated during an attempted primary rearrangement, whereas the BCL-2/IgH translocation in FL mostly occurs during a secondary rearrangement at a later stage of B-cell differentiation.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a grant from the Interdisciplinary Cooperation Project (ICP) "Molecular Medicine" from the Austrian Ministry of Science and the City of Vienna and by Grant P 13984-GEN from the Austrian Fonds zur Foerderung der Wissenschaftlichen Forschung. Back

2 To whom requests for reprints should be addressed, at Department of Internal Medicine I, Division of Hematology, University of Vienna, Waehringer Gürtel 18–20, A-1090 Vienna, Austria. Phone: 43-1-40400-4420; Fax: 43-1-4026930; E-mail: ulrich.jaeger{at}akh-wien.ac.at Back

3 The abbreviations used are: MCL, mantle cell lymphoma; MTC, major translocation cluster (region); ATM, ataxia teleangiectasia mutated; Tdt, terminal deoxynucleotidyl transferase; FL, follicular lymphoma; RSS, recombination signal sequence; T-nucleotide, templated nucleotide; B-CLL, B-cell chronic lymphocytic leukemia; SHM, somatic hypermutation mechanism. Back

4 R. Marculescu, T. Le, S. Böcskör, G. Mitterbauer, A. Chott, C. Mannhalter, U. Jaeger, and B. Nadel. Alternative end-joining in follicular lymphomas’ t(14;/18) translocation, submitted for publication. Back

Received 8/ 7/00. Accepted 12/15/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Harris N. L., Jaffe E. S., Stein H., Banks P. M., Chan J. K. C., Cleary M. L., Delsol G., De Wolf-Peeters C., Falini B., Gatter K. C., Grogan T. M., Isaacson P. G., Knowles D. M., Mason D. Y., Müller-Hermelink H. K., Pileri S. A., Piris M. A., Ralfkiaer E., Warnke R. A. A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood, 84: 1361-1392, 1994.[Free Full Text]
  2. Jaffe, E. S., Campo, E., and Raffeld, M. Mantle cell lymphoma: biology and diagnosis. American Society of Hematology, Education Program Book, pp. 319–325, Washington, DC, 1999.
  3. Hummel M., Tamaru J., Kalvelage B., Stein H. Mantle cell (previously centrocytic) lymphomas express VH genes with no or very little somatic mutations like the physiologic cells of the follicle mantle.. Blood, 84: 403-407, 1994.[Abstract/Free Full Text]
  4. Du M. Q., Diss T. C., Xu C. F., Wotherspoon A. C., Isaacson P. G., Pan L. X. Ongoing immunoglobulin gene mutations in mantle cell lymphomas.. Br. J. Haematol., 96: 124-131, 1997.[Medline]
  5. Andersen A. S., Donovan J. W., Borus J. S., Poor C. M., Neuberg D., Aster J. C., Nadler L. M., Freedman A. S., Gribben J. G. Failure of immunologic purging in mantle cell lymphoma assessed by polymerase chain reaction detection of minimal residual disease.. Blood, 90: 4212-4221, 1997.[Abstract/Free Full Text]
  6. Seto M., Yamamoto K., Iida S., Akao Y., Utsumi K. R., Kubonishi I., Miyoshi I., Ohtsuki T., Yawata T., Namba M. Gene rearrangement and overexpression of PRAD1 in lymphoid malignancy with t(11;14)(q13;q32) translocation.. Oncogene, 7: 1401-1406, 1992.[Medline]
  7. Nakamura S., Yatabe Y., Seto M. Cyclin D1 overexpression in malignant lymphomas.. Pathol. Int., 47: 421-429, 1997.[Medline]
  8. Bosch F., Jares P., Campo E., Lopez-Guillermo A., Piris M. A., Villamor N., Tassies D., Jaffe E. S., Montserrat E., Rozman C. PRAD-1/cyclin D1 gene overexpression in chronic lymphoproliferative disorders: a highly specific marker of mantle cell lymphoma.. Blood, 84: 2726-2732, 1994.[Abstract/Free Full Text]
  9. Monteil M., Callanan M., Dascalescu C., Sotto J. J., Leroux D. Molecular diagnosis of t(11;14) in mantle cell lymphoma using two-colour interphase fluorescence in situ hybridization.. Br. J. Haematol., 93: 656-660, 1996.[Medline]
  10. Vaandrager J. W., Schuuring E., Zwikstra E., de Boer C. J., Kleiverda K. K., van Krieken J. H., Kluin-Nelemans H. C., van Ommen G. J., Raap A. K., Kluin P. M. Direct visualization of dispersed 11q13 chromosomal translocations in mantle cell lymphoma by multicolor DNA fiber fluorescence in situ hybridization.. Blood, 88: 1177-1182, 1996.[Abstract/Free Full Text]
  11. Bigoni R., Negrini M., Veronese M. L., Cuneo A., Castoldi G. L., Croce C. M. Characterization of t(11;14) translocation in mantle cell lymphoma by fluorescent in situ hybridization.. Oncogene, 13: 797-802, 1996.[Medline]
  12. Bentz M., Plesch A., Bullinger L., Stilgenbauer S., Ott G., Müller-Hermelink H. K., Baudis M., Barth T. F., Moller P., Lichter P., Döhner H. t(11;14)-Positive mantle cell lymphomas exhibit complex karyotypes and share similarities with B-cell chronic lymphocytic leukemia. Genes Chromosomes Cancer, 27: 285-294, 2000.[Medline]
  13. Tsujimoto Y., Yunis J., Onorato-Showe L., Erikson J., Nowell P. C., Croce C. M. Molecular cloning of the chromosomal breakpoint of B-cell lymphomas and leukemias with the t(11;14) chromosome translation.. Science (Washington DC), 224: 1403-1406, 1984.[Abstract/Free Full Text]
  14. Williams M. E., Swerdlow S. H., Meeker T. C. Chromosome t(11;14)(q13;q32) breakpoints in centrocytic lymphoma are highly localized at the bcl-1 major translocation cluster. Leukemia, 7: 1437-1440, 1993.[Medline]
  15. Pott C., Tiemann M., Linke B., Ott M. M., von Hofen M., Hiddemann W., Parwaresch R., Kneba M. Structure of Bcl-1 and IgH-CD3 rearrangements as clonal markers in mantle cell lymphomas.. Leukemia (Baltimore), 12: 1630-1637, 1998.[Medline]
  16. Willis T. G., Jadayel D. M., Coignet L. J., Abdul-Rauf M., Treleaven J. G., Catovsky D., Dyer M. J. Rapid molecular cloning of rearrangement of the IGHJ locus using long-distance inverse polymerase chain reaction.. Blood, 90: 2456-2464, 1997.[Abstract/Free Full Text]
  17. Luthra R., Sarris A. H., Hai S., Paldugu A. V., Romaguera J. E., Cabanillas F. F., Medeiros L. J. Real-time 5'->3'exonuclease-based PCR assay for detection of the t(11;14)(q13;q32). Am. J. Clin. Pathol., 112: 524-530, 1999.[Medline]
  18. Rimokh R., Berger F., Delsol G., Digonnet I., Rouault J. P., Tigaud J. D., Gadoux M., Coiffier B., Bryon P. A., Magaud J. P. Detection of the chromosomal translocation t(11;14) by polymerase chain reaction in mantle cell lymphomas. Blood, 83: 1871-1875, 1994.[Abstract/Free Full Text]
  19. Bishop A. J., Barlow C., Wynshaw-Boris A. J., Schiestl R. H. Atm deficiency causes an increased frequency of intrachromosomal homologous recombination in mice.. Cancer Res., 60: 395-399, 2000.[Abstract/Free Full Text]
  20. Stilgenbauer S., Schaffner C., Winkler D., Ott G., Leupolt E., Bentz M., Möller P., Müller-Hermelink H. K., James M. R., Lichter P., Döhner H. The ATM gene in the pathogenesis of mantle-cell lymphoma. Ann. Oncology, 11: 127-130, 2000.
  21. Stilgenbauer S., Winkler D., Ott G., Schaffner C., Leupolt E., Bentz M., Möller P., Müller-Hermelink H. K., James M. R., Lichter P., Döhner H. Molecular characterization of 11q deletions points to a pathogenic role of the ATM gene in mantle cell lymphoma.. Blood, 94: 3262-3264, 1999.[Abstract/Free Full Text]
  22. Schaffner C., Stilgenbauer S., Rappold G. A., Döhner H., Lichter P. Somatic ATM mutations indicate a pathogenic role of ATM in B-cell chronic lymphocytic leukemia.. Blood, 94: 748-753, 1999.[Abstract/Free Full Text]
  23. Petiniot L. K., Weaver Z., Barlow C., Shen R., Eckhaus M., Steinberg S. M., Ried T., Wynshaw-Boris A., Hodes R. J. Recombinase-activating gene (RAG) 2-mediated V(D)J recombination is not essential for tumorigenesis in Atm-deficient mice.. Proc. Natl. Acad. Sci. USA, 97: 6664-6669, 2000.[Abstract/Free Full Text]
  24. Tsujimoto Y., Louie E., Bashir M. M., Croce C. M. The reciprocal partners of both the t(14;18) and the t(11;14) translocations involved in B-cell neoplasms are rearranged by the same mechanism.. Oncogene, 2: 347-351, 1988.[Medline]
  25. Stamatopoulos K., Kosmas C., Belessi C., Kyriazopoulos P., Papadaki T., Anagnostou D., Loukopoulos D. Molecular analysis of the bcl-1/IgH junctional sequences in mantle cell lymphoma: potential mechanism of the t(11;14) chromosomal translocation.. Br. J. Haematol., 105: 190-197, 1999.[Medline]
  26. Zucman-Rossi J., Legoix P., Victor J. M., Lopez B., Thomas G. Chromosome translocation based on illegitimate recombination in human tumors.. Proc. Natl. Acad. Sci. USA, 95: 11786-11791, 1998.[Abstract/Free Full Text]
  27. Erikson J., Finan J., Tsujimoto Y., Nowell P. C., Croce C. M. The chromosome 14 breakpoint in neoplastic B cells with the t(11;14) translocation involves the immunoglobulin heavy chain locus.. Proc. Natl. Acad. Sci. USA, 81: 4144-4148, 1984.[Abstract/Free Full Text]
  28. Cleary M. L., Sklar J. Nucleotide sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint cluster region near a transcriptionally active locus on chromosome 18.. Proc. Natl. Acad. Sci. USA, 82: 7439-7443, 1985.[Abstract/Free Full Text]
  29. Jäger U., Böcskör S., Le T., Mitterbauer G., Bolz I., Chott A., Kneba M., Mannhalter C., Nadel B. Follicular lymphomas’ BCL-2/IgH junctions contain templated nucleotide insertions. Novel insights into the mechanism of t(14;18) translocation. Blood, 95: 3520-3529, 2000.[Abstract/Free Full Text]
  30. Bakhshi A., Jensen J. P., Goldman P., Wright J. J., McBride O. W., Epstein A. L., Korsmeyer S. J. Cloning the chromosomal breakpoint of t(14;18) human lymphomas: clustering around JH on chromosome 14 and near a transcriptional unit on 18.. Cell, 41: 899-906, 1985.[Medline]
  31. Segal G. H., Masih A. S., Fox A. C., Jorgensen T., Scott M., Braylan R. C. CD5-expressing B-cell non-Hodgkin’s lymphomas with bcl-1 gene rearrangement have a relatively homogeneous immunophenotype and are associated with an overall poor prognosis.. Blood, 85: 1570-1579, 1995.[Abstract/Free Full Text]
  32. Brezinschek H. P., Brezinschek R. I., Lipsky P. E. Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction.. J. Immunol., 155: 190-202, 1995.[Abstract]
  33. Milili M., Schiff C., Fougereau M., Tonnelle C. The VDJ repertoire expressed in human preB cells reflects the selection of bona fide heavy chain.. Eur. J. Immunol., 26: 63-69, 1996.[Medline]
  34. Hamblin T. J., Davis Z., Gardiner A., Oscier D. G., Stevenson F. K. Unmutated Ig VH genes are associated with a more aggressive form of chronic lymphocytic leukemia.. Blood, 94: 1848-1854, 1999.[Abstract/Free Full Text]
  35. Kneba M., Eick S., Herbst H., Willigeroth S., Pott C., Bolz I., Bergholz M., Neumann C., Stein H., Krieger G. Frequency and structure of t(14;18) major breakpoint regions in non-Hodgkin’s lymphomas typed according to the Kiel classification: analysis by direct DNA sequencing.. Cancer Res., 51: 3243-3250, 1991.[Abstract/Free Full Text]
  36. Corbett S. J., Tomlinson I. M., Sonnhammer E. L., Buck D., Winter G. Sequence of the human immunoglobulin diversity (D) segment locus: a systematic analysis provides no evidence for the use of DIR segments, inverted D segments, "minor" D segments or D-D recombination.. J. Mol. Biol., 270: 587-597, 1997.[Medline]
  37. Damle R. N., Wasil T., Ghiotto F., Valetto A., Allen S. L., Buchbinder A., Budman D., Dittmar K., Kolitz J., Lichtman S. M., Schulman P., Vinciguerra V. P., Rai K. R., Ferrarini M., Chiorazzi N. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia.. Blood, 94: 1840-1847, 1999.[Abstract/Free Full Text]
  38. Stamatopoulos K., Kosmas C., Belessi C., Stavroyianni N., Kyriazopoulos P., Papadaki T. Molecular insights into the immunopathogenesis of follicular lymphoma.. Immunol. Today, 21: 298-305, 2000.[Medline]
  39. Agrawal A., Eastman Q. M., Schatz D. G. Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system.. Nature (Lond.), 394: 744-751, 1998.[Medline]
  40. Hiom K., Melek M., Gellert M. DNA transposition by RAG1 and RAG2 proteins: a possible source of oncogenic translocations.. Cell, 94: 463-470, 1998.[Medline]
  41. Ferguson D. O., Sekiguchi J. M., Chang S., Frank K. M., Gao Y., DePinho R. A., Alt F. W. The nonhomologous end-joining pathway of DNA repair is required for genomic stability and the suppression of translocations.. Proc. Natl. Acad. Sci. USA, 97: 6630-6633, 2000.[Abstract/Free Full Text]
  42. Dominguez O., Ruiz J. F., Lain de Lera T. L., Garcia-Diaz M., Gonzáles M. A., Kirchhoff T., Martinez-A C., Bernad A., Blanco L. DNA polymerase µ (Pol µ), homologous to TdT, could act as a DNA mutator in eukaryotic cells. EMBO J., 19: 1731-1742, 2000.[Medline]
  43. Aarts W. M., Bende R. J., Steenbergen E. J., Kluin P. M., Ooms E. C. M., Pals S. T., van Noesel C. J. M. Variable heavy chain gene analysis of follicular lymphomas: correlation between heavy chain isotype expression and somatic mutation load.. Blood, 95: 2922-2929, 2000.[Abstract/Free Full Text]
  44. Goossens T., Klein U., Küppers R. Frequent occurrence of deletions and duplications during somatic hypermutation: implications for oncogene translocations and heavy chain disease.. Proc. Natl. Acad. Sci. USA, 95: 2463-2468, 1998.[Abstract/Free Full Text]
  45. Klein U., Goosens T., Kanzler H., Braeuninger A., Rajewsky A., Küppers R. Somatic hypermutation in normal and transformed human B cells.. Immunol. Rev., 162: 261-280, 1998.[Medline]
  46. Sahota S. S., Davis Z., Hamblin T. J., Stevenson F. K. Somatic mutation of bcl-6 genes can occur in the absence of VH mutations in chronic lymphocytic leukemia.. Blood, 95: 3534-3540, 2000.[Abstract/Free Full Text]
  47. Làszlo T., Nagy M., Kelènyi G., Matolcsy A. Immunoglobulin VH gene mutational analysis suggests that blastic variant of mantle cell lymphoma derives from different stages of B-cell maturation.. Leuk. Res., 24: 27-31, 2000.[Medline]
  48. Starostik P., Manshouri T., O’Brian S., Freireich E., Kantarjian H., Haidar M., Lerner S., Keating M., Albitar M. Deficiency of ATM protein expression defines an aggressive subgroup of B-cell chronic lymphocytic leukemia.. Cancer Res., 58: 4552-4557, 1998.[Abstract/Free Full Text]
  49. Schaffner C., Stilgenbauer S., Idler I., Döhner H., Lichter P. Mantle cell lymphoma is characterized by inactivation of the ATM gene.. Blood, 94(Suppl.1): 624a 1999.



This article has been cited by other articles:


Home page
J. Mol. Diagn.Home page
A. Bagg
Malleable Immunoglobulin Genes and Hematopathology - The Good, the Bad, and the Ugly: A Paper from the 2007 William Beaumont Hospital Symposium on Molecular Pathology
J. Mol. Diagn., September 1, 2008; 10(5): 396 - 410.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Murray, J. P. O'Neill, T. Messier, J. Rivers, V. E. Walker, B. McGonagle, L. Trombley, L. G. Cowell, G. Kelsoe, F. McBlane, et al.
V(D)J Recombinase-Mediated Processing of Coding Junctions at Cryptic Recombination Signal Sequences in Peripheral T Cells during Human Development
J. Immunol., October 15, 2006; 177(8): 5393 - 5404.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. H. Sasso, M. Martinez, S. L. Yarfitz, P. Ghillani, L. Musset, J.-C. Piette, and P. Cacoub
Frequent Joining of Bcl-2 to a JH6 Gene in Hepatitis C Virus-Associated t(14;18)
J. Immunol., September 1, 2004; 173(5): 3549 - 3556.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
B. Streubel, A. Chott, D. Huber, M. Exner, U. Jager, O. Wagner, and I. Schwarzinger
Lymphoma-Specific Genetic Aberrations in Microvascular Endothelial Cells in B-Cell Lymphomas
N. Engl. J. Med., July 15, 2004; 351(3): 250 - 259.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Babbage, R. Garand, N. Robillard, N. Zojer, F. K. Stevenson, and S. S. Sahota
Mantle cell lymphoma with t(11;14) and unmutated or mutated VH genes expresses AID and undergoes isotype switch events
Blood, April 1, 2004; 103(7): 2795 - 2798.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
J. Mangel, H. A. Leitch, J. M. Connors, R. Buckstein, K. Imrie, D. Spaner, M. Crump, N. Pennell, A. Boudreau, and N. L. Berinstein
Intensive chemotherapy and autologous stem-cell transplantation plus rituximab is superior to conventional chemotherapy for newly diagnosed advanced stage mantle-cell lymphoma: a matched pair analysis
Ann. Onc., February 1, 2004; 15(2): 283 - 290.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Orchard, R. Garand, Z. Davis, G. Babbage, S. Sahota, E. Matutes, D. Catovsky, P. W. Thomas, H. Avet-Loiseau, and D. Oscier
A subset of t(11;14) lymphoma with mantle cell features displays mutated IgVH genes and includes patients with good prognosis, nonnodal disease
Blood, June 15, 2003; 101(12): 4975 - 4981.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. H. Walsh, M. Thorselius, A. Johnson, O. Soderberg, M. Jerkeman, E. Bjorck, I. Eriksson, U. Thunberg, O. Landgren, M. Ehinger, et al.
Mutated VH genes and preferential VH3-21 use define new subsets of mantle cell lymphoma
Blood, May 15, 2003; 101(10): 4047 - 4054.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Roulland, P. Lebailly, P. Gauduchon, N. Welzel, B. Nadel, and U. Jaeger
Correspondence re: Welzel et al., Cancer Res., 61: 1629-1636.
Cancer Res., April 1, 2003; 63(7): 1722 - 1723.
[Full Text] [PDF]


Home page
ScienceHome page
M. D. Adams, M. McVey, and J. J. Sekelsky
Drosophila BLM in Double-Strand Break Repair by Synthesis-Dependent Strand Annealing
Science, January 10, 2003; 299(5604): 265 - 267.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Wiemels, B. C. Leonard, Y. Wang, M. R. Segal, S. P. Hunger, M. T. Smith, V. Crouse, X. Ma, P. A. Buffler, and S. R. Pine
Site-specific translocation and evidence of postnatal origin of the t(1;19) E2A-PBX1 fusion in childhood acute lymphoblastic leukemia
PNAS, November 12, 2002; 99(23): 15101 - 15106.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. Marculescu, T. Le, P. Simon, U. Jaeger, and B. Nadel
V(D)J-mediated Translocations in Lymphoid Neoplasms: A Functional Assessment of Genomic Instability by Cryptic Sites
J. Exp. Med., January 7, 2002; 195(1): 85 - 98.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
W. S. Dalton, P. L. Bergsagel, W. M. Kuehl, K. C. Anderson, and J. L. Harousseau
Multiple Myeloma
Hematology, January 1, 2001; 2001(1): 157 - 177.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welzel, N.
Right arrow Articles by Jaeger, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welzel, N.
Right arrow Articles by Jaeger, U.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online