| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Department of Internal Medicine I, Division of Hematology [N. W., T. L., R. M., K. L., B. N., U. J.], Department of Internal Medicine I, Division of Oncology [J. D., M. R.], Department of Clinical Chemistry and Laboratory Medicine [G. M., C. M.], and Department of Pathology [A. C.], University of Vienna, A-1090 Vienna, Austria; Department of Medicine II, University of Kiel, 24116 Kiel, Germany [C. P., M. K.]; Department of Histopathology, Royal Free and University College London Medical School, WC1E 6JJ London, United Kingdom [M-Q. D.]; and Department of Molecular Medicine, Ruder Boskovic Institute, HR-10000 Zagreb, Croatia [R. K.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
5 nucleotides contained error-prone copies (T-nucleotides)
of 8–12 nucleotides originating from the surrounding
BCL-1 or IgH regions, a lower rate than
in FL. No correlation was found between the addition of T-nucleotides
and the rate of somatic mutation in the immunoglobulin genes. We
conclude that the t(11;14) and t(14;18) use the same basic mechanism of
translocation including V(D)J-mediated recombination, double-strand
staggered breaks, and template-dependent, error-prone DNA-synthesis.
However, the distinct differences in the utilization of
JH regions suggest that the t(11;14) occurs
predominantly during an attempted primary
DH-JH rearrangement in early B
cells, whereas the t(14;18) mostly occurs during secondary
rearrangement. This is in agreement with the pregerminal center B-cell
origin of MCL. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
|
We have recently shown that the t(14;18) in FL involves at least two distinct mechanisms: V(D)J recombination mediating the breaks on chromosome 14, and an additional mechanism, distinct from V(D)J recombination and yet unidentified, creating the breaks on chromosome 18. In addition, this analysis revealed the insertion of T-nucleotides in the junctions between the BCL-2 and JH or DH genes (29 , 30) . T-nucleotides are copied from the regions surrounding the breakpoints and contain point mutations and/or insertions/deletions suggesting the presence of error-prone template-dependent DNA synthesis at the time of illegitimate joining. Moreover, in the t(14;18), we found a marked skew toward the most 5'-DH and most 3'-JH regions, which suggested that the t(14;18) in FL could occur during an attempted secondary rearrangement.
This prompted us to investigate the direct and reciprocal t(11;14) junctions in a large sampling of MCL. This should enable us to compare the t(14;18) and t(11;14) and to test the hypothesis that they are generated by a similar mechanism of translocation despite their different cellular origin: germinal (FL) versus pregerminal center (MCL). We analyzed diagnostic material from 93 MCLs by PCR and obtained sequence information on 36 BCL-1/JH (direct) junctions (39%). These 36 samples were further amplified with primers for the DH/BCL-1 (reciprocal) junctions giving a final number of 23 direct as well as reciprocal positive samples. Analysis of this library revealed that the t(11;14) uses the same mechanism as t(14;18) involving RSS-mediated breaks at the IgH locus, but a different mechanism of cleavage at the oncogene breakpoint region. MCLs also show the presence of T-nucleotides in their t(11;14) junctions. However, the number of T-nucleotides as well as the usage of JH segments show distinct differences from FL which are consistent with the earlier B-cell origin of MCL.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
PCR Amplification of the Direct and Reciprocal Breakpoints.
Genomic DNA (100 ng) was amplified for the direct
(BCL-1/JH) breakpoints with BCL-Cn and JHex-B
(29)
primers (Fig. 1)
for 30 cycles with the following
conditions: 1 min at 94°C and 1 min at 58°C. The BCL-Cn primer is
located 184 bp 3' of the BCL-1 sequence (GenBank accession
no. S77049). One µl of the primary PCR was used for secondary nested
amplifications with BCL-An and JHco-B (29)
primers for 25
cycles with the same conditions as above except for the annealing
temperature, 61°C.
For the reciprocal breakpoints (DH/BCL-1) a set of seven DH primers (29) mapping all of the members of each family was used. Again, 100 ng of genomic DNA were amplified with one of the D1 to D7 primers and the REV 1B primer for 30 cycles (30 s at 94°C, 30 s at 58°C, and 30 s at 72°C). One µl of each of the seven amplifications was taken for the double-nested PCR with the corresponding D1N1 to D7N1 primer (29) and the REV 2B primer, with the same conditions as for the primary PCR except for the annealing temperature, 61°C. REV 1B/2B primers are located at the end of the known BCL-1 sequence (GenBank accession no. S77049). All PCRs were amplified with a (4:1) mix of Taq and Vent polymerase. From the 36 samples that were positive for the direct breakpoint, 13 remained negative for the reciprocal PCR.
PCR Amplification of the V(D)J Idiotype.
Vex 1–7 primers constitute a set of primers designed to amplify most
members of the seven human VH families. Genomic
DNA (100 ng) was taken with one of the Vex 1 to Vex 7 primers and the
JHex-B primer for 30 cycles (30 s at 94°C, 30 s at 60°C, and
30 s at 72°C). One µl of each of the seven amplifications was
taken for the double nested secondary PCR with the corresponding VH-1
to VH-6 primer and the JHco-B primer, with the same conditions as for
the primary PCR except for the annealing temperature, 63°C, and the
cycles, 25 instead of 30.
Sequencing.
For the direct and reciprocal breakpoints, the PCR product was directly
sequenced with an IRD-800-labeled BCL-AM and REV-2M primer as
described previously (29)
. For the V(D)J segments, the PCR
product was subcloned and then sequenced with an M13 Forward (-20)
primer (Invitrogen, Groningen, The Netherlands) All of the
mutations detected were verified by repeating PCR and DNA sequence
analyses. One nucleotide difference with the published sequence
(additional C in position 492) was noted (Segal et al.; Ref.
31
).
BclI primers (5' to 3') were as follows: BCL-Cn, CTACTGAAGGACTTGTGGGTTG; BCL-An/BCL-AM, CGAGGAGCATAATTGCTGCACTG; REV-1B, GGAAGTCTCACCTAGTGGAGC; REV-2B, GGAGCAGTGAACACCAGTGC; and REV-2 M, CAGTGAACACCAGTGCCCCA.
VH primers (5' to 3') were as follows: VH-1, CCTCAGTGAAGGTCTCCTGCAAGG; VH-2, TCCTGCGCTGGTGAAAGCCACACA; VH-3, GGTCCCTGAGACTCTCCTGTGCA; VH-4A, TCGGAGACCCTGTCCCTCACCTGCA; VH-4B, CGCTGTCTCTGGTTACTCCATCAG; VH-5, GAAAAAGCCCGGGGAGTCTCTGAA; and VH-6, CCTGTGCCATCTCCGGGGACAGTG.
Vex primers (5' to 3') were as follows: Vex 1, TCTGGGGCTGAGGTGAAGAA; Vex 2, ACCTTGAAGGAGTCTGGTCC; Vex 3, GTCCCTGAGACTCTCCTGT; Vex 4: CAGGACTGGTGAAGCCTTC; Vex 5, GCTGGTGCAGTCTGGAGC; Vex 6, CAGCTGCAGCAGTCAGGTC; and Vex 7, CAGGTGCAGCTGGTGCAATC.
Statistical Analysis.
T-nucleotides are defined as short sequences of at least 5 nucleotides
inserted in the breakpoints, with sufficient homology to the adjacent
flanking sequences to exclude their concomitant presence by chance
alone. The significance of identification of T-nucleotides in each
sample was estimated using a binomial test, as described
previously (29)
. The P 
0.05
was selected as the point of high statistical significance.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and 2)
. The DH and JH
breakpoints show features of V(D)J-mediated recombination such as
precise cleavage at the coding sequence/RSS border and nucleotide
deletions at the coding end. This indicates that the breaks at the
IgH locus occur during an attempted
DH to JH rearrangement as
described previously (25
, 29)
.
|
|
Utilization of JH and
DH Segments.
The following JH regions were used in the 36
direct translocation samples (Table 1
; sample 24 to 36 not shown):
JH3 (n = 1; 3%);
JH4 (n = 9; 25%);
JH5 (n = 7; 19%);
JH6 (n = 14; 39%);
and unclassifiable JH4/5 (n = 5; 14%; Fig. 2
). The use of JH in the t(11;14) junctions is
similar to the distribution of JH in the
idiotypes of normal B cells or B-CLL (32, 33, 34)
cells with
the exception of a shift from JH4 to
JH5. Most importantly, there is no pronounced
skew toward the most 3' segment (JH6) as in the
t(14;18) in FL (70% JH6; Ref. 29
).
Various DH families were used:
DH2 (26%); DH3 (48%);
DH4 (13%); DH5 (9%);
and DH6 (4%). We note the low number
(n = 23) of PCR-detectable
DH/BCL-1 breakpoints, which may simply be
attributable to the location of primers or the length of the
PCR-product. On the other hand, this may reflect thus-far-unidentified
structural differences at the reciprocal breakpoint. Nevertheless, the
fact that 23 (64%) of 36 BCL-1/JH-positive
samples have a DH/BCL-1 reciprocal junction
clearly indicates that the translocation occurs during an attempted
DH-JH rearrangement.
|
and 2)
. Because we had recently noted that the
t(14;18) in FL contain T-nucleotide additions, we examined the
BCL-1/IgH junctions for the presence of these
T-nucleotides (29)
. Indeed, statistically significant,
nonrandom copies of the surrounding MTC, IgH or opposite
junctional regions were found in 7 (30%) of 23 MCL samples or 7 (19%)
of 37 junctions containing inserts of 5 de novo
nucleotides. These T-nucleotides were 8–12 nucleotides in length and
exhibited mismatches with the germ-line sequence (point mutations or
deletions) in six of seven cases (Table 3
; Fig. 3
A–G). For instance, patient 1 has the 8-bp sequence ACTTCGCG
in the reciprocal junction (Fig. 3A)
. The direct junction
shows the same sequence in reverse complement form: CGCGAAGT. Patient
22 has the sequence GgGACGGGA in the direct junction. This is the
reverse complement of the MTC sequence TCCCGTCAC with one A to G
mutation (Fig. 3G)
. In contrast to the previous assumption
that t(11;14) junctions contain only nontemplated N-nucleotides added
by Tdt, these findings indicate the involvement of a template-dependent
error-prone DNA polymerase in illegitimate recombination in at least
19% of the breakpoints. This rate is considerably less than in FL
(34%; Ref. 29
; Table 4
).
|
|
|
; DH3–3, not shown] in 36
junctions (5.6%).
Idiotypic IgH Sequences and T-nucleotides.
The presence of T-nucleotides with their pattern of mutations and/or
deletions prompted us to examine direct and reciprocal PCR-positive
cases for somatic mutations in their IgH genes. An
unequivocally monoclonal result was obtained in 11 of the 23 samples.
There was a preponderance of VH1 (4 times
VH1–02,-08,-18) and VH4
(5 times VH4–34 and one
VH4–39). One sample contained a
VH3–21. The rate of VH
mutations was low as expected, with an average of 1.8% (range,
0–4.8%). Only five samples had more than 2% mutations (2.4–4.8%),
a rate that may be attributed to somatic hypermutation
(37)
. T-nucleotides in the t(11;14) junctions were present
in 2 of the 11 patients. Both of them had T-nucleotide mutations
(patient 22) or deletions (patient 7), at
VH-mutation frequencies of 0.4 or 2.4%,
respectively. On the other hand, the patient with the highest mutation
frequency (patient 2; 4.8%) did not have T-nucleotides. Thus,
there is no obvious association between the rate of somatic mutation
and the presence of T-nucleotides at present.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
t(11;14) Breaks Are Caused by Different Mechanisms at the
IgH and BCL-1 Loci.
The major dogma regarding the mechanism of the t(11;14) is that
V(D)J-recombination is responsible for the breaks at both the
IgH and BCL-1 loci (24)
. Some
authors have postulated the presence of irregular or cryptic RSS in the
BCL-1 that could guide V(D)J-like recombination
(38)
. The duplications of BCL-1 sequences found
in this study suggest that the breaks are attributable to an initial
staggered double-strand break in at least 39% of MCLs. This is
incompatible with the mechanism of V(D)J recombination, but very
similar to the t(14;18), in which duplications of BCL-2 are
found in 30% of the cases (Ref. 29
; Table 4
). Speculation
as to the mechanism of cleavage may include the transpositional
activity of RAG-1/RAG-2, pathways of nonhomologous DNA end rejoining
and others (39, 40, 41)
.
BCL-1/IgH Junctions Contain
T-nucleotides.
As in the t(14;18), we also found the addition of T-nucleotides in the
BCL-1/IgH junctions. This is in contrast to
previous reports on the mechanism of t(11;14), which assumed the
nontemplated addition of N-nucleotides by Tdt. The presence of
T-nucleotides indicates that a template-dependent, error-prone
mechanism is active during illegitimate recombination, which could be
involved in the repair of the ends. The recently discovered DNA
polymerase µ represents an attractive canwdidate for an enzyme
responsible for this phenomenon in t(11;14) as well as in t(14;18)
(42)
. Polymerase µ is preferentially expressed in
secondary lymphoid organs. Its has a template-dependent polymerase
activity with a high error-rate and possesses Tdt-like activity. It is
important to note that the number of T-nucleotides is considerably
lower in t(11;14) than in t(14;18), as follow: 30 versus
42% of the samples and 19 versus 34% of the breakpoints
with de novo nucleotide insertions 5 (Table 4)
. Even if it
is taken into account that the T-nucleotides described here are
restricted by statistical considerations, this clearly indicates
differences between t(11;14) and t(14;18). These may simply be
attributable to differences in the structure, location, or
conformational or transcriptional status of the BCL-1 and
BCL-2 genes at the time of translocation. Alternatively,
timing of the illegitimate recombination during B-cell differentiation
may be important.
Lack of Evidence for an Association between the Process of Somatic
Hypermutation and the t(11;14) Mechanism.
FLs have a high rate of somatic hypermutation [average, 9.9%
(43)
], whereas some cases of MCLs show more than 2%
mutations in their IgH genes. However, the pattern of
deletions, duplications, mutations, and T-nucleotide additions in the
t(14;18) and t(11;14) junctions is strongly reminiscent of the
mechanism of somatic hypermutation (44
, 45)
. Because there
may be two populations of MCLs with or without SHM, we
investigated a possible association between somatic mutations in the
idiotype and T-nucleotides. The patient with the highest mutation rate
(patient 2) had no T-nucleotides, whereas one of two cases with
T-nucleotides had a low mutation rate. Thus, there is no obvious
association between the mechanism of T-nucleotide addition and the
process of SHM. This is reminiscent of B-CLL, in which it has recently
been shown that somatic VH-mutations are not
directly linked to the frequency of mutations in the BCL-6
gene (46)
.
Stage of B-Cell Differentiation and Occurrence of t(11;14) and
t(14;18).
We have previously hypothesized that the t(14;18) could occur during an
attempted secondary DJH-rearrangement in B cells
that might take place in the bone marrow, but could also occur in the
germinal center of the B-cell follicle (29)
. This is based
on the observation that the t(14;18) in FL use the most
5'-DH and the most 3'-JH
(JH6, 71%) gene segments and has been further
supported by the detection of the corresponding primary
DJH-rearrangements in two cases of
FL.4
In contrast, the utilization of JH regions in
t(11;14)
(JH4:JH5:JH6,
25:19:39%) is not much different from that of normal B cells
(JH4:JH5:JH6,
41:7:38%; Ref. 32
) or CLL cells
(JH4:JH6, 42:37%; Ref.
34
). In particular, the use of JH6
is similar in MCL and normal B cells but is much higher in FL
(JH4:JH5:JH6,
15:8:70%; Ref. 29
; Table 4
), which suggests that the
t(11;14) happens predominantly during primary rearrangements in early B
cells, whereas the t(14;18) occurs mainly during an attempted secondary
DH to JH rearrangement.
This fits well with the pregerminal origin of MCL and the germinal
center origin of FL. Nevertheless, the occurrence of SHM in some V(D)J
junctions, the presence of rare BCL-1/DJH
rearrangements, and the presence of T-nucleotides in some breakpoints
might indicate that a small fraction of the t(11;14) translocations
take place during an attempted secondary DH to
JH rearrangement in a later stage of B-cell
differentiation (Table 1
, patient 2). This is in agreement with
the previously postulated heterogeneous status of the MCL population
(47)
.
Error-prone, Template-dependent Repair and Genetic Instability in
MCL.
The majority of MCL contains known aberrations that may influence
genetic stability. The t(11;14) is accompanied by mutations and/or
deletions of p53, the CDK-inhibitor family, and of the
ATM gene (22)
. ATM deletions are
found in 
40% of MCL (19
, 21)
. Deletions or mutations
of these genes involved in cell cycle regulation and DNA repair could
potentially contribute to the mechanism of illegitimate recombination
as shown in ATM-deficient patients or mice (19
, 48)
. There is evidence that suggests that the ATM
deletion/mutation may be the primary defect (23
, 49)
. One
could envision that an alternative (more primitive?), error-prone
mechanism that allows illegitimate joining is activated in
repair-deficient B cells. This would explain the addition of
T-nucleotides in the junctions.
Altogether, our data indicate that the t(11;14) is generated by the same basic mechanism of translocation as the t(14;18) with V(D)J-mediated breaks in the IgH locus and double-strand, staggered breaks at the oncogene loci. MCL also shows error-prone template-dependent DNA synthesis during religation of the reciprocal chromosomes caused by an enzymatic machinery which is still unknown. However, there are distinct differences in the utilization of JH regions as well as in the number of T-nucleotides in the translocation junctions which could well reflect the earlier B-cell (pregerminal center) origin of MCL. Although there may still be some dichotomy within the origin of MCL, we propose that the BCL-1/IgH translocation is predominantly generated during an attempted primary rearrangement, whereas the BCL-2/IgH translocation in FL mostly occurs during a secondary rearrangement at a later stage of B-cell differentiation.
|
FOOTNOTES |
|---|
1 Supported by a grant from the Interdisciplinary
Cooperation Project (ICP) "Molecular Medicine" from the Austrian
Ministry of Science and the City of Vienna and by Grant P 13984-GEN
from the Austrian Fonds zur Foerderung der Wissenschaftlichen
Forschung. 
2 To whom requests for reprints should be
addressed, at Department of Internal Medicine I, Division of
Hematology, University of Vienna, Waehringer Gürtel 18–20,
A-1090 Vienna, Austria. Phone: 43-1-40400-4420; Fax: 43-1-4026930;
E-mail: ulrich.jaeger{at}akh-wien.ac.at
3 The abbreviations used are: MCL, mantle cell
lymphoma; MTC, major translocation cluster (region); ATM, ataxia
teleangiectasia mutated; Tdt, terminal deoxynucleotidyl
transferase; FL, follicular lymphoma; RSS, recombination signal
sequence; T-nucleotide, templated nucleotide; B-CLL, B-cell chronic
lymphocytic leukemia; SHM, somatic hypermutation mechanism.
4 R. Marculescu, T. Le, S. Böcskör, G.
Mitterbauer, A. Chott, C. Mannhalter, U. Jaeger, and B. Nadel.
Alternative end-joining in follicular lymphomas’ t(14;/18)
translocation, submitted for publication.
Received 8/ 7/00. Accepted 12/15/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
3'exonuclease-based PCR assay for detection of the t(11;14)(q13;q32). Am. J. Clin. Pathol., 112: 524-530, 1999.[Medline]
This article has been cited by other articles:
|
|
 |
|
  A. Bagg Malleable Immunoglobulin Genes and Hematopathology - The Good, the Bad, and the Ugly: A Paper from the 2007 William Beaumont Hospital Symposium on Molecular Pathology J. Mol. Diagn., September 1, 2008; 10(5): 396 - 410. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Murray, J. P. O'Neill, T. Messier, J. Rivers, V. E. Walker, B. McGonagle, L. Trombley, L. G. Cowell, G. Kelsoe, F. McBlane, et al. V(D)J Recombinase-Mediated Processing of Coding Junctions at Cryptic Recombination Signal Sequences in Peripheral T Cells during Human Development J. Immunol., October 15, 2006; 177(8): 5393 - 5404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. H. Sasso, M. Martinez, S. L. Yarfitz, P. Ghillani, L. Musset, J.-C. Piette, and P. Cacoub Frequent Joining of Bcl-2 to a JH6 Gene in Hepatitis C Virus-Associated t(14;18) J. Immunol., September 1, 2004; 173(5): 3549 - 3556. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Streubel, A. Chott, D. Huber, M. Exner, U. Jager, O. Wagner, and I. Schwarzinger Lymphoma-Specific Genetic Aberrations in Microvascular Endothelial Cells in B-Cell Lymphomas N. Engl. J. Med., July 15, 2004; 351(3): 250 - 259. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Babbage, R. Garand, N. Robillard, N. Zojer, F. K. Stevenson, and S. S. Sahota Mantle cell lymphoma with t(11;14) and unmutated or mutated VH genes expresses AID and undergoes isotype switch events Blood, April 1, 2004; 103(7): 2795 - 2798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Mangel, H. A. Leitch, J. M. Connors, R. Buckstein, K. Imrie, D. Spaner, M. Crump, N. Pennell, A. Boudreau, and N. L. Berinstein Intensive chemotherapy and autologous stem-cell transplantation plus rituximab is superior to conventional chemotherapy for newly diagnosed advanced stage mantle-cell lymphoma: a matched pair analysis Ann. Onc., February 1, 2004; 15(2): 283 - 290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Orchard, R. Garand, Z. Davis, G. Babbage, S. Sahota, E. Matutes, D. Catovsky, P. W. Thomas, H. Avet-Loiseau, and D. Oscier A subset of t(11;14) lymphoma with mantle cell features displays mutated IgVH genes and includes patients with good prognosis, nonnodal disease Blood, June 15, 2003; 101(12): 4975 - 4981. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Walsh, M. Thorselius, A. Johnson, O. Soderberg, M. Jerkeman, E. Bjorck, I. Eriksson, U. Thunberg, O. Landgren, M. Ehinger, et al. Mutated VH genes and preferential VH3-21 use define new subsets of mantle cell lymphoma Blood, May 15, 2003; 101(10): 4047 - 4054. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Roulland, P. Lebailly, P. Gauduchon, N. Welzel, B. Nadel, and U. Jaeger Correspondence re: Welzel et al., Cancer Res., 61: 1629-1636. Cancer Res., April 1, 2003; 63(7): 1722 - 1723. [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Adams, M. McVey, and J. J. Sekelsky Drosophila BLM in Double-Strand Break Repair by Synthesis-Dependent Strand Annealing Science, January 10, 2003; 299(5604): 265 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Wiemels, B. C. Leonard, Y. Wang, M. R. Segal, S. P. Hunger, M. T. Smith, V. Crouse, X. Ma, P. A. Buffler, and S. R. Pine Site-specific translocation and evidence of postnatal origin of the t(1;19) E2A-PBX1 fusion in childhood acute lymphoblastic leukemia PNAS, November 12, 2002; 99(23): 15101 - 15106. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Marculescu, T. Le, P. Simon, U. Jaeger, and B. Nadel V(D)J-mediated Translocations in Lymphoid Neoplasms: A Functional Assessment of Genomic Instability by Cryptic Sites J. Exp. Med., January 7, 2002; 195(1): 85 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. S. Dalton, P. L. Bergsagel, W. M. Kuehl, K. C. Anderson, and J. L. Harousseau Multiple Myeloma Hematology, January 1, 2001; 2001(1): 157 - 177. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
