| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Departments of Medicine [X. Y. L., Mi. M., B. K., F. A., Ma. M.] and Molecular and Cellular Biology [Ma. M.], Baylor College of Medicine; Veterans Affairs Medical Center [X. Y. L., Mi. M., B. K., Ma. M.], Houston, Texas 77030; Institute of Internal Medicine and Oncologic Sciences, Perugia University Medical School, I-06100 Perugia, Italy [R. M., I. N.]; and Department of Molecular and Cellular Biology, Texas Biotechnology Corporation, Houston, Texas 77030 [L. D.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A major shortcoming of current cancer chemotherapy is that many types of cancers acquire resistance to the apoptotic effect of various cytotoxic agents and become progressively incurable. Prostate cancer, which is resistant to hormone withdrawal treatment, is a particularly good example. Most prostate cancer cells respond initially to androgen ablation treatment (orchiectomy, diethylstilbestrol, luteinizing-hormone releasing-hormone analogues, and androgen receptor antagonists given alone or in combination) by undergoing apoptosis (25) . However, after 12 to 18 months most prostate cancer cells become androgen-independent and apoptosis-resistant (26) , and this eventually leads to overwhelming disease and death.
Unraveling the mechanisms protecting prostate cancer cells from undergoing apoptosis after androgen ablation would facilitate comprehension of the basic cellular mechanisms leading to prostate cancer cell survival after this form of treatment. It would also facilitate identification of new therapeutic targets and development of new treatments. Unfortunately, reproducible models of prostate cancer cell lines developing progressive resistance to androgen ablation-induced apoptosis are not available. Nevertheless, differences in sensitivity to apoptotic agents other than androgen-ablation have been identified among various prostate cancer cell lines. For instance, among the various prostate cancer cell lines, we and others have observed that PC-3 cells are more resistant to apoptosis than LNCaP cells (27, 28, 29) . Our group has characterized previously in detail how PC-3 and LNCaP cells respond to the apoptotic agent STS. In the presence of this protein kinase inhibitor, LNCaP cells undergo massive apoptosis after as little as 3 to 6 h because of the activation of the mitochondrial pathway (5 , 27 , 30) . In contrast, STS does not activate the mitochondrial pathway in PC-3 cells, which are still largely viable after as long as 72 h of treatment (27) . Hypothesizing that elucidating the mechanism causing STS resistance in PC-3 cells would shed light on the major survival pathways active in androgen-independent prostate cancer cells and in other cancer cells resistant to chemotherapy, we performed a careful dissection of the events occurring (and not occurring) in LNCaP and PC-3 cells after STS treatment. Our analysis finds that overexpression of the antiapoptotic factor Bcl-XL is one of the mediators of resistance to STS in PC-3 cells in that it protects the mitochondria from undergoing functional incapacitation.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Plasmids.
Plasmid GFP-Bax was a gift of R. Youle (31)
. Plasmid
GFP-Bad was constructed using a Bad cDNA obtained by PCR from a LNCaP
cDNA library. The following primers containing the restriction sites
XhoI and XbaI were used: Bad-S,
CAAGATCTCATCTTGTCCTCACAGCCCAGAGC; Bad-AS,
CATCTAGATCACTGGGAGGGGGCGGAGCTTCCCCT. The product of the amplification
was cut with the two restriction endonucleases XhoI and
XbaI and subcloned in a pEGFP-C1 plasmid (Clontech
Laboratories, Inc., Palo Alto, CA) cut with the same enzymes. Sequence
analysis was performed to ensure that the two constructs were in-frame
and that no artifacts were added to the Bad sequence by the
amplification process. A VDAC cDNA inserted in the expression plasmid
pRc/RSV (Invitrogen, San Diego, CA) was a gift of M. Forte (Vollum
Institute, Portland, OR).
Cell Lines and Experimental Design.
LNCaP (32)
and PC-3 (33)
cells have been
described previously (5
, 27)
. Two days before the
subcellular localization experiments, 1 x 105
cells were seeded in a 6-well plate. At the
time point 0, cells were treated with 4 µM STS from a 4
mM stock dissolved in DMSO. Adherent and floating cells
were recovered 6 h (LNCaP) or 24 h (PC-3) after STS
stimulation.
Genistein was given to PC-3 cells at a concentration of 300 µM (from a stock of 300 mM dissolved in DMSO) for 24 h. Vehicle-treated controls were given the same amount of DMSO. Adherent and floating cells were harvested at 24 h after genistein and analyzed for the presence of various markers of apoptosis (see below).
In other experiments, PC-3 cells were treated with sodium butyrate. Cells received 2 mM sodium butyrate (dissolved in water) for 24 or 48 h. Parallel dishes were treated with the same amount of sodium butyrate plus 4 µM STS during the final 24 h of the experiment. Control dishes were treated with vehicle or STS alone. Cells were then collected and studied for various markers of apoptosis (see below).
Cell-free Assay of Apoptosis.
As a diagnostic test for the postmitochondrial phase of apoptosis, we
used the cell-free assay described by Liu et al.
(20)
. The cell line of interest was harvested and washed
twice at 4°C in PBS by centrifugation at 1500 rpm. The resulting
pellet was resuspended in one volume of buffer A [HEPES-KOH (pH
7.5), 10 mM KCl, 1.5
mM MgCl2, 1 mM EDTA, 1
mM EGTA, 1 mM DTT, 0.1
mM phenylmethylsulfonyl fluoride, and protease
inhibitors; Sigma Chemical Co.] and incubated at 4°C for 20 min.
Cells were then disrupted through passage in a 26-gauge needle
15 times, spun at 1,000 x g at 4°C for 10
min. This supernatant was spun at 100,000 x g for 30 min at 4°C, used for protein determination,
aliquoted, and stored at -80°C. Aliquots of 50 µg of protein were
incubated for 30 min at 30°C alone, in the presence of dATP (1
mM), or in presence of both dATP (1
mM) and cytochrome c (10
µM). Aliquots containing 10 µg of protein
were then sized in a polyacrylamide gel, and Western analysis for
caspase-3, caspase-7, and DFF was performed.
Stable and Transient Transfections.
Stable and transient transfections were performed using the
LipofectAMINE-plus kit (Life Technologies, Inc.) according to the
instructions of the manufacturer, unless stated otherwise. G418 (Life
Technologies, Inc.) was used at a final concentration of 400 µg/ml to
obtain stable transfectants when necessary.
Western Analysis and Subcellular Fractionation.
Western analysis was performed as described previously (5
, 27 , 30)
. In each experiment, the same number of µg of cell lysate
was loaded, as specified in each case. When precise quantitation was
required, densitometric analysis was performed to correct expression of
the protein of interest with that of ß-actin or tubulin, which were
immunodetected in the same sample. Densitometry was done by importing
images to a Power Macintosh G3 personal computer using the Chemi Doc
Documentation System and the Quantity One quantitation software (both
from Bio-Rad, Hercules, CA). Arbitrary densitometric units of the
protein of interest were then corrected for the densitometric units of
ß-actin or tubulin.
Subcellular fractionation was performed using serial centrifugation steps as described by Gross et al. (34 , 35) with some modifications. Briefly, LNCaP and PC-3 cells were washed twice in ice-cold PBS, resuspended in five volumes of extraction buffer [containing 220 mM mannitol, 68 mM sucrose, 50 mM PIPES-KOH (pH 7.4), 50 mM KCl, 5 mM EGTA, 2 mM MgCl2, 1 mM DTT, and protease inhibitors; Sigma Chemical Co.; added at 1:100 dilution], and kept on ice for 15 min. Cells were then spun at 400 x g for 10 min at 4°C to separate out nuclei and unbroken cells. This supernatant was centrifuged at 10,000 x g for 10 min at 4°C to collect the heavy membrane, mitochondrial-enriched pellet. The new supernatant was then spun at 100,000 x g for 30 min at 4°C to separate the light membrane ER-enriched pellet (not used in these experiments) from the supernatant (containing the cytosol). Pilot experiments demonstrated the ability of this technique to yield subcellular fractions enriched with mitochondria or cytosol. For instance, cytochrome c was recovered uniquely from the mitochondrial fraction in cells not undergoing apoptosis and from both the cytosolic and mitochondrial fractions when cells were undergoing apoptosis. In contrast, the proteins VDAC and ANT (located on the outer and inner mitochondrial membrane, respectively) were recovered uniquely from the mitochondrial fraction, regardless of whether the cells were undergoing apoptosis or not.
Immunoprecipitation.
Immunoprecipitation was performed according to standard procedures
(36)
. Cells were harvested under nondenaturing conditions
and washed in ice-cold PBS. The pellet was resuspended in 500 µl of
lysis buffer (PBS + 1% NP40) and 20 µl of protease
inhibitor cocktail and disrupted by sonication. Protein A-Sepharose
beads (10 µl; Sigma Chemical Co.) were added, and the resulting
suspension was gently rocked for 10 min at 4°C and microfuged for 10
min at 4°C. Protein concentration was measured in the resulting
supernatant. Supernatant (200 µl; adjusted to contain 200 µg of
proteins) was taken, and the antibody of interest (anti-VDAC) was added
at the ratio of 1 µg:100 µg/proteins. After overnight rocking at
4°C, 10 µl of protein A beads were added, and gentle rocking
continued for an additional 4 h. The solution was then microfuged
for 3 min at 4°C, and the resulting pellet was washed 2x with PBS
and diluted in 40 µl of lysis buffer and 20 µl of loading buffer
[62.5 Tris (pH 6.8), 10% glycerol, 2% SDS, 0.003% bromphenol blue,
and 5% ß-mercaptoethanol]. Twenty-µl aliquots were sized by
electrophoresis and transferred to nitrocellulose. Filters were
incubated with anti-Bax or -Bad antibodies, and immunoreactive bands
were visualized using the enhanced chemiluminescence detection
system.
Confocal Microscopy.
Confocal microscopy of the mitochondrial transmembrane potential was
performed using the fluorescent dye JC-1 (Molecular Probes) as reported
previously (5
, 27)
. In the presence of a negative
mitochondrial transmembrane potential, this dye dimerizes and produces
a red fluorescence. In contrast, when the transmembrane potential is
obliterated, JC-1 produces a green fluorescence.
Immunoflurescence of Bcl-XL and Bax was performed using PC-3 and LNCaP cells grown on coverslips. After 48 h, cells were washed, fixed with paraformaldehyde 3.7% in PBS for 10 min at room temperature, and permeabilized with 0.1% Triton X-100 for 5 min. Cells were then incubated with anti-Bax (mouse monoclonal; Santa Cruz Biotechnology) and anti-Bcl-xL (goat polyclonal; Santa Cruz Biotechnology) antibodies for 60 min at room temperature. After extensive washes in PBS, cells were stained with 568 Alexa Fluor-conjugated antigoat antibody and 488 Alexa-conjugated antimouse antibody (Molecular Probes). Nuclei were counterstained with TO-PRO 3 (Molecular Probes). Cells were examined using an Olympus IMT-2 microscope equipped with an MRC-1024 laserscan confocal system (Bio-Rad) using the 488-nm, 568-nm, and 647-nm excitation lines from an Argo-krypton laser. Green (Bax), red (Bcl-xL), and ultra-red emissions were collected and processed with the Lasersharp 1024 software (Bio-Rad).
Molecular Analysis of Bax and Bad in PC-3 Cells.
Each individual coding exon of Bax was amplified from genomic DNA
extracted from PC-3 cells using sets of primers derived from the
surrounding introns, as published by Chou et al.
(37)
. The resulting bands were sequenced directly using an
automated sequencer (Perkin-Elmer Sequencer 310).
A full-length Bad cDNA was obtained from PC-3 cells by RT-PCR of total RNA, using random examers for the reverse transcription, and the primers Bad-S and Bad-AS were used for the amplification of Bad from LNCaP cells (see above). RT-PCR conditions were as suggested by the manufacturer of the Gene Amp kit (Roche, Brandburg, NJ.).
Identification of Apoptotic Cells after Transient Transfection of
PC-3 Cells with GFP-Bad and GFP-Bax.
PC-3 cells growing on coverslips were transiently transfected with GFP,
GFP-Bad, and GFP-Bax using the calcium precipitation kit from 5 prime-3
prime, Inc. (Boulder, CO). After 12 h, cells were fixed for 30 min
at 4°C in 4% formaldehyde dissolved in PEM buffer [400
mM Potassium PIPES, 0.5 M EGTA (pH 7.0), 1
M MgCl2], washed x3 with PEM
buffer, treated in 0.1 M NH4Cl (to
quench autofluorescence), incubated for 30 min at room
temperature in PEM + 0.5% Triton X-100, and washed
again in PEM x3. 4',6-Diamidino-2-phenylindole dihydrochloride
(Molecular Probes) staining was then performed using a 1 mg/ml stock
diluted 2000-fold for 1 min. After mounting the coverslip, cells were
observed under a fluorescence microscope. Cells showing green
fluorescence were then observed at higher magnification, and
visualization of polyfragmented nuclei was interpreted as presence of
apoptosis. A total of 300 cells in six different fields were scored for
the presence (or absence) of apoptosis in each transfection.
Antisense Experiments.
To create a PC-3 cell line expressing a reduced amount of
Bcl-XL, two phosphorothioate oligonucleotides
were synthesized as described in the paper of Ackermann et
al. (38)
. Oligonucleotide
Bcl-XL-AS
(5'CTACGCTTTCCACGCACAGT3')
consists of nucleotides 581 to 601 of the Bcl-XL
coding sequence (39)
in the antisense orientation. The
mismatch oligonucleotide Bcl-XL-MS
(5'CGACACGTACCTCTCGCATT3')
has 60% homology to Bcl-XL-AS. Oligos were
transfected overnight at increasing concentrations (1 to 500
nM) using LipofectAMINE plus (25 µl in 100 µl
of OptiMEM). Cells were harvested 48 h after transfection,
and the expression of Bcl-XL was evaluated using
the quantitative Western analysis described above. Once conditions
causing reproducible decrease of Bcl-XL were
identified, cells were grown and transfected with oligos
Bcl-XL-AS or Bcl-XL-MS in
duplicate dishes. At 48 h after transfection, one dish was
harvested, and Western analysis of Bcl-XL was
performed to control its down-regulation. The other dishes were treated
with 4 µM STS for 24 h. The presence of
apoptosis was verified using the Cellular DNA Fragmentation ELISA kit
from Boehringer.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. These results indicated that the postmitochondrial phase of the
mitochondrial pathway of apoptosis was intact and functional in the two
cell lines and that the locus of resistance to STS-induced apoptosis in
PC-3 cells was at the premitochondrial or mitochondrial level.
|
, the proapoptotic Bid was in the cytoplasm in the basal state and
nearly completely proteolyzed in response to STS, most likely after
caspase-dependent cleavage at one of its aspartate residues (40
, 41)
. In PC-3 cells, Bid was unaffected by STS. In both lines,
Bad and Bax translocated from the cytoplasm to the mitochondria with
STS. Although Bcl-XL was insensitive to STS in
both lines, it was almost exclusively mitochondrial in LNCaP cells but
equally distributed in PC-3 mitochondria and cytoplasm. As we reported
previously (5
, 27)
, cytochrome c translocated
from the mitochondria to the cytoplasm in LNCaP cells, leading to
cleavage of caspases-9, -3, and -7, independent of their subcellular
localization. Conversely, these postmitochondrial mediators were
STS-insensitive in PC-3 cells.
|
Pro). Thus, to identify the precise
molecular defect, we investigated the expression and functional
integrity of the VDAC (42)
and the ANT (43)
,
key mediators of the mitochondrial permeability transition pore. In
both cell lines, VDAC (Fig. 3, A and B)
and ANT (data not shown) were of the
appropriate molecular weight and uniquely localized to the mitochondria
(Fig. 3, A and B)
. VDAC coimmunoprecipitated with
Bax and Bad, indicating normal functional interactions (Fig. 3C)
. Further, overexpression of VDAC had no effect on PC-3
cell sensitivity to STS (data not shown).
|
and were found to be apoptotic in 90
and 92% of the cases after transfection with either GFP-Bax or GFP-Bad
(Fig. 4)
. In contrast, only 6% of the cells transfected with the control
plasmid expressing only the GFP protein were apoptotic (Fig. 4)
. These
results confirmed that in PC-3 cells the mitochondrial apoptotic
program could be activated if properly stimulated by proapoptotic Bcl-2
family members. In addition, these data suggested that the components
of the mitochondrial permeability transition pore were able to mediate
mitochondrial incapacitation after the interaction with proapoptotic
Bcl-2 family members such as Bax and Bad. Subsequently, a systematic
analysis of Bcl-XL, Bcl-2, Bcl-w, mcl-1, and A1,
molecules known to prevent apoptosis by protecting the mitochondria,
was initiated in several prostate cancer cell lines. Most notably,
Bcl-XL expression was 45-fold greater in PC-3
compared with LNCaP cells (Fig. 5A)
. Overexpression of Bcl-XL was also
confirmed in experiments of immunofluorescence as shown in Fig. 5, B and C
, where Bcl-XL (red
fluorescence) is significantly more expressed in PC-3 (Fig. 5C)
compared with LNCaP cells (Fig. 5B)
.
|
|
. Further, genistein alone induced apoptosis by causing loss of
mitochondrial transmembrane potential, release of cytochrome
c to the cytosol, activation of the caspase pathway, and
cleavage of the caspase target PARP (Fig. 7)
.
|
|
. However, this was associated with only minimal cytochrome
c translocation to the cytosol (compare Fig. 8B
[baseline] versus Fig. 8C
[after 48 h of
butyric acid]) and minor cleavage of caspase-9 and caspase-7 or DFF
(Fig. 8E)
. Nonetheless, significant cleavage of caspase-3
(Fig. 8E)
was accompanied by a 15-fold induction of DEVDase
(data not shown) and 37% TUNEL positivity (Fig. 8, H and I)
. Most importantly, butyric acid treatment conferred STS
sensitivity to PC-3 cells as evidenced by additional down-regulation of
Bcl-XL (Fig. 8A)
, cytochrome
c translocation from mitochondria to cytoplasm (compare Fig. 8B
[baseline] with Fig. 8D
[after 48 h of
butyric acid + STS from 24 to 48 h]), complete cleavage of
caspases-9, -3, and -7 as well as DFF (Fig. 8E)
, 18.5-fold
increased DEVDase activity (data not shown), and massive (96%)
induction of TUNEL positivity (Fig. 8, F and G)
.
|
4-fold compared with a mismatched control oligo and resulted in a
6-fold increase in apoptosis (Fig. 9)
.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
On the basis of these observations, we focused on the mitochondrial phase as the locus of apoptosis resistance in PC-3 cells. Sequence analysis indicated that Bax and Bad did not contain any defective mutations and overexpression of either of these proapoptotic molecules induced apoptosis. Further, VDAC and ANT, key components of the mitochondrial permeability transition pore, were of the correct size and in the appropriate mitochondrial subfraction. VDAC overexpression in stably transfected PC-3 cells also failed to increase sensitivity to STS-induced apoptosis. These observations confirmed that the components of the permeability transition pore were functionally normal and suggested that an antiapoptotic factor with the ability to protect the mitochondria was overexpressed in PC-3 cells. Four lines of evidence support the hypothesis that Bcl-XL overexpression is responsible for the resistance of the PC-3 cells to STS-induced apoptosis: a.) Bcl-XL was overexpressed in PC-3 cells relative to several apoptosis-sensitive prostate cell lines; b.) genistein, a tyrosine kinase inhibitor, down-regulated Bcl-XL and induced spontaneous apoptosis; c.) sodium butyrate down-regulated Bcl-XL expression and, most importantly, conferred STS sensitivity; and d.) antisense down-regulation of Bcl-XL restored STS-induced apoptosis. These results indicated that elevated Bcl-XL was responsible for protecting PC-3 cells from apoptosis.
Overexpression of Bcl-XL has already been described in PC-3 cells (46) and in cell lines manifesting multiple drug resistance (47 , 48) . In the latter, overexpression of Bcl-XL is associated with apoptosis-resistance because of abrogation of cytochrome c release to the cytosol. Bcl-XL overexpression does not functionally substitute for a mutagenic initiator or mitogenic promoter in tumorigenesis. However, there is an increased potential for benign tumors overexpressing Bcl-XL to undergo malignant degeneration possibly because of their prolonged survival (49) . The mechanism leading to apoptosis-resistance after Bcl-XL overexpression has to do with its ability to prevent cytochrome c translocation to the cytosol and to protect the mitochondria from undergoing functional incapacitation (50) . This is in part achieved through inactivation of proapoptotic Bcl-2 family members via heterodimerization (51 , 52) and in part by facilitating mitochondrial ATP/ADP exchange (53) .
The signaling pathway regulating Bcl-XL
expression is only partially understood. Using murine myeloid cell
lines, Bcl-XL expression was found to be
positively regulated by IFN-
(54)
and through a
Jak kinase-dependent interleukin 3 pathway (55)
.
Other investigators have identified a connection between induction of
Bcl-XL expression and the activity of tyrosine
kinase receptors such as HER2 (13
, 56) and a
tumor-specific mutant of epidermal growth factor receptor
(57)
. The fact that the tyrosine kinase inhibitor,
genistein, decreased Bcl-XL expression in PC-3
cells supports the conclusion that overexpression of
Bcl-XL could be mediated through this signaling
pathway. Another mechanism of Bcl-XL regulation
is by inactivation through posttranslational modifications. For
instance, in response to genotoxic agents, the stress-activated protein
kinase translocates to the mitochondria and phosphorylates
Bcl-XL, presumably leading to its inactivation
(58)
.
Upon demonstrating Bcl-XL overexpression in PC-3
cells, we wondered if this is a common occurrence in other prostate
cancer cell lines or in clinical specimens from patients with prostate
cancer. Other prostate cancer cell lines such as DU-145 and TSU-Pr
(1)
express higher concentrations of
Bcl-XL than LNCaP, although not to the same
extent as PC-3 (Fig. 5)
. Tissue from patients with prostate cancer has
not been investigated for its presence of Bcl-XL
overexpression, despite the fact that since 1992 an extensive
literature has identified a potential connection between the close
relative Bcl-2 and hormone-independent prostate cancer (59
, 60)
. In view of the observations reported in this study and of
the well-established role of Bcl-XL as one of the
most powerful antiapoptotic factors, studies addressing the correlation
between Bcl-XL expression and the various phases
of prostate cancer are now warranted. In addition, it will be important
to understand the details of the signaling pathway mediating
Bcl-XL overexpression in PC3. This will help with
the identification of new potential therapeutic targets to decrease the
threshold of apoptosis-sensitivity in prostate cancer.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by the VA Merit Review Program and the
Department of Defense Prostate Cancer Research Program (to
Ma. M.). 
2 Present address: Department of Medicine, McGill
University and Royal Victoria Hospital, Montreal, PQ H3A 1A1 Canada.
3 Present address: Imperial Cancer Research Fund,
Molecular Oncology, Imperial College School of Medicine, Hammersmith
Hospital, London W12 0HS, United Kingdom.
4 To whom requests for reprints should be
addressed, at Department of Medicine, Baylor College of Medicine and
Veterans Affairs Medical Center, 2002 Holcombe Blvd., Houston TX 77030.
Phone: (713) 794-7945; Fax: (713) 794-7714; E-mail: marcelli{at}bcm.tmc.edu
5 The abbreviations used are: STS, staurosporine;
VDAC, voltage-dependent anion channel; ANT, adenine nucleotide
transporter; DFF, DNA fragmentation factor; PARP, poly(ADP-ribose)
polymerase; RT-PCR, reverse transcription-PCR; GFP, green fluorescent
protein; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end
labeling.
Received 7/17/00. Accepted 12/14/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B that blocks TNF
-induced apoptosis.. Genes Dev., 13: 382-387, 1999.B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c- IAP2 to suppress caspase-8 activation.. Science (Washington DC), 281: 1680-1683, 1998. upregulates anti-apoptotic gene expression and inhibits apoptosis in IL-3-dependent hematopoietic cells.. Biochem. Biophys. Res. Commun., 239: 401-406, 1997.[Medline]
This article has been cited by other articles:
|
|
 |
|
  P. J. Malloy and D. Feldman Inactivation of the Human Vitamin D Receptor by Caspase-3 Endocrinology, February 1, 2009; 150(2): 679 - 686. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wang, D. T. Sloper, S. N. Addo, D. Tian, J. W. Slaton, and C. Xing WL-276, an Antagonist against Bcl-2 Proteins, Overcomes Drug Resistance and Suppresses Prostate Tumor Growth Cancer Res., June 1, 2008; 68(11): 4377 - 4383. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S. Schwartz, M. K. Manion, C. B. Emerson, J. S. Fry, C. M. Schulz, I. R. Sweet, and D. M. Hockenbery 2-Methoxy antimycin reveals a unique mechanism for Bcl-xL inhibition Mol. Cancer Ther., July 1, 2007; 6(7): 2073 - 2080. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Sarkar, I. V. Lebedeva, Z.-z. Su, E.-S. Park, L. Chatman, N. Vozhilla, P. Dent, D. T. Curiel, and P. B. Fisher Eradication of Therapy-Resistant Human Prostate Tumors Using a Cancer Terminator Virus Cancer Res., June 1, 2007; 67(11): 5434 - 5442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Castilla, B. Congregado, D. Chinchon, F. J. Torrubia, M. A. Japon, and C. Saez Bcl-xL Is Overexpressed in Hormone-Resistant Prostate Cancer and Promotes Survival of LNCaP Cells via Interaction with Proapoptotic Bak Endocrinology, October 1, 2006; 147(10): 4960 - 4967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-W. Shiau, J.-W. Huang, D.-S. Wang, J.-R. Weng, C.-C. Yang, C.-H. Lin, C. Li, and C.-S. Chen {alpha}-Tocopheryl Succinate Induces Apoptosis in Prostate Cancer Cells in Part through Inhibition of Bcl-xL/Bcl-2 Function J. Biol. Chem., April 28, 2006; 281(17): 11819 - 11825. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ma, V. Lakshmikanthan, R. W. Lewis, and M. V. Kumar Sensitization of TRAIL-resistant cells by inhibition of heat shock protein 90 with low-dose geldanamycin Mol. Cancer Ther., January 1, 2006; 5(1): 170 - 178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Pan, H. Huang, L. Sun, B. Fang, and S.-C. J. Yeung Bcl-2-Associated X Protein Is the Main Mediator of Manumycin A-Induced Apoptosis in Anaplastic Thyroid Cancer Cells J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3583 - 3591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Syrovets, J. E. Gschwend, B. Buchele, Y. Laumonnier, W. Zugmaier, F. Genze, and T. Simmet Inhibition of I{kappa}B Kinase Activity by Acetyl-boswellic Acids Promotes Apoptosis in Androgen-independent PC-3 Prostate Cancer Cells in Vitro and in Vivo J. Biol. Chem., February 18, 2005; 280(7): 6170 - 6180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Jiang, J. Wong, H. Fyrst, J. D. Saba, and B. N. Ames {gamma}-Tocopherol or combinations of vitamin E forms induce cell death in human prostate cancer cells by interrupting sphingolipid synthesis PNAS, December 21, 2004; 101(51): 17825 - 17830. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. E. Barton, J. G. Karras, T. F. Murphy, A. Barton, and H. F-S. Huang Signal transducer and activator of transcription 3 (STAT3) activation in prostate cancer: Direct STAT3 inhibition induces apoptosis in prostate cancer lines Mol. Cancer Ther., January 1, 2004; 3(1): 11 - 20. [Abstract] [Full Text]
|
|
|
|
 |
|
 F. Zazzeroni, S. Papa, A. Algeciras-Schimnich, K. Alvarez, T. Melis, C. Bubici, N. Majewski, N. Hay, E. De Smaele, M. E. Peter, et al. Gadd45{beta} mediates the protective effects of CD40 costimulation against Fas-induced apoptosis Blood, November 1, 2003; 102(9): 3270 - 3279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Grzmil, P. Thelen, B. Hemmerlein, S. Schweyer, S. Voigt, D. Mury, and P. Burfeind Bax Inhibitor-1 Is Overexpressed in Prostate Cancer and Its Specific Down-Regulation by RNA Interference Leads to Cell Death in Human Prostate Carcinoma Cells Am. J. Pathol., August 1, 2003; 163(2): 543 - 552. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Strauss, I. Knape, I. Melzner, and K.-M. Debatin Constitutive Caspase Activation and Impaired Death-Inducing Signaling Complex Formation in CD95-Resistant, Long-Term Activated, Antigen-Specific T Cells J. Immunol., August 1, 2003; 171(3): 1172 - 1182. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-C. Yang, H.-P. Lin, C.-S. Chen, Y.-T. Yang, P.-H. Tseng, V. M. Rangnekar, and C.-S. Chen Bcl-xL Mediates a Survival Mechanism Independent of the Phosphoinositide 3-Kinase/Akt Pathway in Prostate Cancer Cells J. Biol. Chem., July 3, 2003; 278(28): 25872 - 25878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. E. Lamendola, Z. Duan, R. Z. Yusuf, and M. V. Seiden Molecular Description of Evolving Paclitaxel Resistance in the SKOV-3 Human Ovarian Carcinoma Cell Line Cancer Res., May 1, 2003; 63(9): 2200 - 2205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. C. Reinhold, H. Kouros-Mehr, K. W. Kohn, A. K. Maunakea, S. Lababidi, A. Roschke, K. Stover, J. Alexander, P. Pantazis, L. Miller, et al. Apoptotic Susceptibility of Cancer Cells Selected for Camptothecin Resistance: Gene Expression Profiling, Functional Analysis, and Molecular Interaction Mapping Cancer Res., March 1, 2003; 63(5): 1000 - 1011. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F M Ruemmele, S Schwartz, E G Seidman, S Dionne, E Levy, and M J Lentze Butyrate induced Caco-2 cell apoptosis is mediated via the mitochondrial pathway Gut, January 1, 2003; 52(1): 94 - 100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Eid, R. W. Lewis, and M. V. Kumar Mifepristone Pretreatment Overcomes Resistance of Prostate Cancer Cells to Tumor Necrosis Factor {alpha}-related Apoptosis-inducing Ligand (TRAIL) Mol. Cancer Ther., August 1, 2002; 1(10): 831 - 840. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Torok, H. Higuchi, S. Bronk, and G. J. Gores Nitric Oxide Inhibits Apoptosis Downstream of Cytochrome c Release by Nitrosylating Caspase 9 Cancer Res., March 1, 2002; 62(6): 1648 - 1653. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Andriani, B. Nan, J. Yu, X. Li, N. L. Weigel, M. J. McPhaul, S. Kasper, S. Kagawa, B. Fang, R. J. Matusik, et al. Use of the Probasin Promoter ARR2PB to Express Bax in Androgen Receptor-Positive Prostate Cancer Cells J Natl Cancer Inst, September 5, 2001; 93(17): 1314 - 1324. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
