| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Department of Surgical Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
HRG, also named neu differentiation factor (17) , neuregulin (18) , AchR-inducing activity (19) , and glial growth factor (20) , is a member of the epidermal growth factor-like growth factor family. HRGs are ligands of ErbB3 and/or ErbB4, which belong to the ErbB family of receptor tyrosine kinases. The binding of HRG to its receptors induces either ErbB3 or ErbB4 to form homodimers or to form heterodimers with ErbB2, thus triggering diverse signaling cascades (21) . HRGs can induce a variety of cellular responses in different cell types, including proliferation, differentiation, survival, apoptosis, migration, and aggregation (22, 23, 24, 25, 26) . Data from HRG gene knockout mice demonstrated that HRG is essential for the early development of the heart and central nervous system (27) . HRG is also known to be involved in breast cancer metastasis and in ErbB2-related and hormone-independent breast cancer progression (28 , 29) . HRG has been shown to regulate invasive and metastasis-related properties in breast cancer cell lines (30) . However, the role of HRG in breast cancer metastasis remains elusive.
HRG has also been implicated in the regulation of gene expression. HRG
was reported to stimulate AchR and utrophin gene expression in muscle
cells via GA-binding proteins by 2–3 fold compared with that in
the absence of HRG (31, 32, 33, 34, 35)
. HRG also up-regulated AchR
gene expression about 3-fold in p-19 teratocarcinoma cells and breast
cancer cells through Sp1-containing complex (36)
. The
mechanisms of HRG-induced transcriptional regulation in these studies
remain unclear. After studying the role of HRG and ErbB2 in breast
cancer progression and metastasis, we found that HRG up-regulated VEGF
secretion from breast cancer cell lines through transcriptional
up-regulation and that it required activation of the p38 MAPK signaling
pathway. Furthermore, HRG-ß1-induced VEGF secretion enhanced mouse
endothelial cell migration. Thus, transcriptional up-regulation of VEGF
via activation of the p38 MAPK pathway may be one of the mechanisms
that contribute to HRG-induced breast cancer metastasis.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Luciferase Reporter and HRE Mutants.
VEGF promoter luciferase reporter constructs were prepared as described
previously (16)
. The uHRE mutant was generated by PCR
mutation. The upstream primers for the uHRE mutant were as follows: WT,
AAGGTACCGCTTATGGGGGTGGGGGGTGCCT; uHRE mutant,
AAGGTACCGCTTATGGGGGTAAGGGGTGCCT. The
downstream primer was TGCACTAGTCCTGTCTCCACCAC. The PCR product was
recovered and cloned back to full-length VEGF promoter reporter plasmid
via Acc65I/SpeI sites. The mutation was confirmed by
sequence analysis.
Generation of Stable Cell Lines Expressing EGFld of HRG.
The cDNA fragment of the EGFld (37)
was generated by PCR
using the following primers: 5' primer,
CGGGATCCGGGGACAAGCCATCTTGTAAAAT; 3' primer,
AGCGGCCGCCTTCTGGTACAGCTCCTCCG. The EGFld was cloned in pSecTag2B vector
(Invitrogen, Carlsbad, CA). Both the EGFld expression plasmid and the
pSecTag2B vector were transfected into MCF7 cells. The stable
transfectants were selected by Zeocin (Invitrogen).
Western Blot Analysis.
Cells were starved in serum-free medium overnight before HRG treatment.
Cells were then incubated either with 10 ng/ml HRG for different times
(12, 24, or 48 h) or for 24 h with various concentrations of
HRG (1, 2, 5, or 10 ng/ml). The CM were collected and concentrated by
Centricon (Amicon, Inc., Beverly, MA). To examine signaling pathway
involvement, cells were treated with 10 ng/ml HRG for 10, 30, or 60
min, and cell lysates were prepared as described previously
(25)
. The proteins from the CM or cell lysates were then
separated by 10% SDS-PAGE, transferred to a nitrocellulose membrane
(Bio-Rad, Hercules, CA), and probed by monoclonal VEGF antibody (R&D
Systems, Minneapolis, MN) or specific antibodies against phosphorylated
ERK, Akt, and p38 MAPK (New England Biolabs, Inc., Beverly, MA).
Protein signals were detected using the enhanced chemiluminescence
detection system (Amersham, Corp., Arlington Heights, IL). Horseradish
peroxidase-conjugated antibody against mouse or rabbit IgG (Jackson
ImmunoResearch Laboratories) was used as a secondary antibody.
Northern Blot Analysis.
SKBr3 and MCF7 cells were starved overnight and incubated with 10 ng/ml
HRG for 2, 6, or 24 h. For chemical inhibitor treatment assays,
cells were incubated for 1 h with 5 µg/ml ActD, 50 µg/ml CMX,
20 µM PD98059, 100 nM Wortmannin, or 10
µM SB203580 (Calbiochem, San Diego, CA) and then treated
with HRG (10 ng/ml) for 6 h. Total RNA was extracted from cells
using Ultraspec RNA reagent (Biotecx Laboratories, Inc., Houston, TX)
and separated by electrophoresis in 1% denaturing formaldehyde-agarose
gel. The RNA was transferred to Hybond-N+ nylon
membrane (Amersham) overnight. The membrane was UV cross-linked with a
UV Stratalinker 1800 (Stratagene, San Diego, CA). The membranes were
prehybridized and hybridized with VEGF-specific and
glyceraldehyde-3-phosphate dehydrogenase-specific cDNA probes
(16)
at 68°C in PerfectHyb plus hybridization buffer
(Sigma Chemical Co., St. Louis, MO), washed, and analyzed using a
PhosphoImager (Molecular Dynamics, Sunnyvale, CA).
Endothelial Cell Migration Assay.
Endothelial cell migration was assayed in 24-well,
6.5-mm-internal-diameter Transwell cluster plates (8.0-µm pores;
Costar Corp., Cambridge, MA) using MluE cells (American Type Culture
Collection, Rockville, MD) and CM of HRG-treated and untreated SKBr3
cells. The CM were prepared by incubating SKBr3 cells with 10 ng/ml HRG
in the presence or absence of 0.5 µM SB203580. Three
thousand MluE cells were suspended in 0.1 ml of serum-free DMEM/F12
with 0.1% BSA and loaded into the 0.1 mg/ml gelatin-coated upper
chamber of a Transwell cluster plate. The lower chamber of the
Transwell plate was filled with the 600-µl CM or CM neutralized with
anti-VEGF polyclonal antibody (50 pg/ml, mixed and stored at 4°C
overnight; Santa Cruz Biotechnology, Santa Cruz, CA). A solution of
DMEM/F12 plus 0.1% BSA was used as a negative control. The assay was
allowed to proceed for 5.5 h at 37°C, after which the Transwell
filters were fixed with methanol and stained with Giemsa (LabChem Inc.,
Pittsburgh, PA). The cells on the upper surface of the filter were
removed by wiping with a cotton swab, and cell migration was determined
by counting the number of cells/high-power field (x200) that had
migrated to the lower side of the filter. Five high-power fields/filter
and triplicate filters/sample were counted. Assays were repeated at
least twice. The difference in migration rates was analyzed using the
two-tailed Student t test.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. However, MDA-MB-453 and BT-483 cell lines did not show
significant VEGF induction by HRG-ß1 (Fig. 1A)
. Further
study of MCF-7 and SKBr3 cells indicated that the VEGF secretion
induced by HRG-ß1 was dosage- and time-dependent (Fig. 1B)
. The HRG-ß1-mediated VEGF induction appeared with 1
ng/ml HRG and occurred as early as 12 h at the 10 ng/ml HRG
concentration. Similar data were obtained from MCF7 cells, but the
induction was greater in the SKBr3 cell line than in the MCF7 cell
line. The VEGF signal was detectable in both MCF7 and SKBr3 cells
without HRG-ß1 treatment, suggesting that both cell lines secreted
basal levels of VEGF (Fig. 1B
, Lane 1).
|
, the VEGF mRNA level increased in a time-dependent manner
in both the SKBr3 and the MCF7 cell lines after 10 ng/ml of HRG-ß1
treatment. The VEGF mRNA induction appeared as soon as 2 h after
HRG-ß1 treatment, continuously increased up to 6 h, and then
decreased at the 24-h time point. Compared with levels in untreated
cells, the level of VEGF mRNA induction by HRG-ß1 at 6 h were
2.4 and 2.7 times higher in MCF7 and SKBr3 cell lines, respectively.
The HT1080 cell line, which was used as a positive control, showed a
much higher level of basal VEGF signal. VEGF mRNA expression was
further induced by 12-O-tetradecanoyl-phorbol-13-acetate
about 3-fold more than the level in untreated cells.
|
. This finding suggests that
HRG-induced VEGF up-regulation requires new RNA synthesis but not new
protein synthesis. Because the induction of VEGF by HRG-ß1 requires
new RNA synthesis, it most likely occurs through transcriptional
up-regulation. Furthermore, because VEGF induction by HRG-ß1 is
independent of protein synthesis, it is probably mediated by the
activation of existing transcription factor(s) through translocation or
modification, such as phosphorylation of transcription factor(s).
To further determine whether HRG-ß1-mediated VEGF up-regulation
occurs through transactivation of the VEGF promoter, the full-length
VEGF promoter was fused to the luciferase reporter gene, which was
transfected into SKBr3 cells. HRG-ß1 treatment increased the
luciferase activity driven by full-length VEGF promoter by
approximately 2-fold. In addition, the CMV-driven EGFld of HRG was
transfected into MCF7 cells from which stable transfectants that
constitutively expressed and secreted EGFld of HRG were generated. When
the full-length VEGF promoter-luciferase reporter gene was transfected
into these HRG EGFld stable transfectants, the luciferase activity was
2.4 times higher than that in the control cells (Fig. 2C)
.
The fold of induction of promoter activity is comparable with the fold
of induction of VEGF mRNA observed in Northern blot analysis (Fig. 2, A and B)
and is consistent with HRG-ß1-mediated
transcriptional up-regulation of other target genes reported previously
(31, 32, 33, 34, 35, 36)
. These data demonstrate that VEGF up-regulation
by HRG-ß1 occurs through transcriptional up-regulation of VEGF
promoter activity. Because the VEGF promoter was activated both by the
recombinant full-length extracellular domain of HRG-ß1 and by the
EGFld of HRG-ß1 in MCF7 cells, the posttranslational modification of
HRG-ß1 may not be required for VEGF up-regulation in SKBr3 and MCF7
cell lines, and the EGFld of HRG-ß1 must be sufficient to induce VEGF
transcriptional up-regulation.
Activation of VEGF Promoter Activity by HRG-ß1 via Upstream
CA-rich HRE.
To determine the HRE in the VEGF promoter, 5'-VEGF promoter deletion
constructs were fused to the luciferase reporter gene and were
transfected into either HRG-ß1-treated SKBr3 cells or MCF7 HRG-ß1
EGFld stable transfectants. Luciferase assays showed that the
functional HRE responsible for VEGF up-regulation was located in the
region between nt -2352 and -780 (uHRE; Fig. 3A
). Two types of HREs have been reported in muscle cells
(31, 32, 33, 34, 35)
and in T47D breast cancer cells
(36)
, and both types of HRE sequences are in the nt -2352
to -780 region of the VEGF promoter. On the basis of the previous
report on T47D breast cancer cells (36)
, we reasoned that
CA-rich HRE may mediate VEGF up-regulation in breast cancer cells. When
the CA-rich uHRE sequence within the nt -2352 to -780 region was
mutated from CCACCCCC to TTACCCCC, the VEGF
promoter activation in SKBr3 by HRG-ß1 was reduced to an
almost basal level (Fig. 3B
, Lane 6). Similar
data were also obtained when the WT and MUT constructs were transfected
into MCF7 cells expressing HRG EGFld (data not shown). Thus, this
CA-rich uHRE was functionally required for VEGF up-regulation by
HRG-ß1 in both MCF7 and SKBr3 breast cancer cells. Although two
additional CA-rich consensus HRE sequences, middle HRE and downstream
HRE, are located downstream of uHRE, they do not seem to mediate VEGF
up-regulation by HRG-ß1. Thus, although HRE consensus sequence is
required, the HRE consensus sequence alone might not be sufficient to
mediate induction of VEGF in SKBr3 cells by HRG-ß1. HRE function
probably requires neighboring sequences and may be cell-type dependent.
|
. HRG-ß1 effectively activated the MAP/ERK kinase
pathway, the PI-3K/Akt pathway, and the p38 MAPK pathway in SKBr3
cells. Interestingly, the p38 MAPK pathway was only transiently
activated by HRG-ß1. Considering that the VEGF mRNA signal was
induced by HRG-ß1 as early as 2 h after treatment, further
increasing up to 6 h, and later decreasing at 24 h, it would
be intriguing to determine whether HRG-ß1-induced VEGF up-regulation
requires the p38 MAPK pathway. Addition of the p38 MAPK
pathway-specific inhibitor SB203580 to SKBr3 and MCF7 cells before
HRG-ß1 treatment completely abolished the induction of VEGF secretion
from these two cell lines (Fig. 4B
, Lanes 7 and
8). In contrast, neither the MAP/ERK kinase pathway
inhibitor (PD98059) nor the PI-3K/Akt pathway inhibitor (Wortmannin)
effectively inhibited HRG-ß1-mediated VEGF induction (Fig. 4B
, Lanes 3–6), although PD98059 and Wortmannin
effectively inhibited ERK1/2 activation and Akt activation,
respectively (data not shown). Additionally, HRG-ß1-mediated
up-regulation of VEGF mRNA was also blocked by SB203580 (Fig. 4C
, Lanes 7 and 8), whereas neither
PD98059 nor Wortmannin abolished VEGF mRNA up-regulation by HRG-ß1
(Fig. 4C
, Lanes 3–6). Therefore, both Western
and Northern blot analyses demonstrated that HRG-ß1-mediated
activation of the p38 MAPK pathway is required for VEGF up-regulation.
|
, Lanes 1 and 2). Because VEGF antibody (50 pg/ml)
inhibited the migration of MluE cells in CM from HRG-ß1-treated SKBr3
cells, whereas nonspecific IgG had no effect (Fig. 5
, Lanes
3–6), this HRG-ß1-mediated increase of migration is most likely
because of VEGF in the CM. Notably, VEGF antibody reduced the basal
level of cell migration by inhibiting the basal level of VEGF in the CM
(Fig. 5
, Lanes 1, 3, and 5). MluE cell
migration was reduced in CM collected from SKBr3 cells that were
pretreated with 0.5 µM SB203580, an inhibitor
of the p38 MAPK pathway, before the cells were activated by HRG-ß1
(Fig. 5
, compare Lanes 2 and 8), although
SB203580 had no effect on MluE basal level migration (Fig. 5
,
Lanes 1 and 7). Furthermore, addition of VEGF
antibody (50 ng/ml) to CM from SKBr3 cells that were pretreated with
SB203580 and then stimulated with HRG-ß1 further decreased
migration of MluE cells to below the basal level (Fig. 5
,
Lanes 1, 9, and 10), whereas the
control IgG had no similar effect (Fig. 5
, Lane 11 and
12). The data suggest that combination of VEGF antibody and
SB203580 has an additive inhibitory effect to block endothelial
migration induced by HRG-ß1-mediated VEGF secretion.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
HRG-ß1-induced VEGF up-regulation does not require protein synthesis,
suggesting that it may be mediated by activation of certain existing
transcription factor(s) by posttranslational modification or
relocation. Previous reports indicated that protein phosphorylation is
required for HRG-induced transcriptional up-regulation of AchR
(36)
and that protein-tyrosine phosphatase has the same
response element as neuregulin (a member of the HRG family) response
element (33)
. These findings are reasonable given that
HRGs can bind to ErbB3 or ErbB4 to activate signal cascades, at least
partly, by inducing protein phosphorylations that lead to various
cellular responses. Consistent with this notion, HRG-ß1-activated p38
MAPK signal pathway is shown here to be required for up-regulation of
VEGF in SKBr3 and MCF7 cells, although HRG-ß1 activated multiple
pathways in these cells. Currently, we are trying to identify the
transcription factor(s) that are phosphorylated by HRG-ß1-activated
p38 MAPK and to decipher the regulatory mechanisms of the VEGF promoter
(direct or indirect activation or derepression) by phosphorylated
transcription factor(s). It is likely that the transcription factor(s)
mediating induction by HRG may vary for different promoters in
different cell types. Because HRG function is mediated by signaling
pathways, it is possible that different signal pathways can be
activated in different cell types in response to the HRG signal.
Therefore, the downstream transcription factor(s) activated by HRG-ß1
may vary in different cell types for different target genes.
HRG induction of gene up-regulation is generally weak in that all of the previous reports and our current study showed only 2–3-fold induction of promoter activities for every induced promoter examined in stable transfectants or under transient transfection conditions. Notably, the p38 MAPK pathway was only transiently activated by HRG-ß1 for less than 30 min, whereas ERK1/2 and PI-3K/Akt activations were prolonged. This transient activation of p38 MAPK may be one of the reasons for weak induction of VEGF promoter activities. Because previous reports did not identify the signal pathway(s) mediating HRG-induced gene up-regulation, it is not clear whether the p38 MAPK pathway may be a common pathway for gene up-regulation by HRG-ß1. Although HRG-induced gene regulation is relatively weak, HRG-mediated transcriptional up-regulation is essential for development and normal cellular functions (27 , 37) . In addition, HRG-ß1 was shown to increase motility of MCF7 cells by 2–3-fold through up-regulation of autocrine motility factor (40) . In particular, VEGF induction by HRG-ß1 reported here may contribute to breast cancer angiogenesis, given that the VEGF expression level is tightly controlled (1, 2, 3) . In support of this notion, our data from endothelial cell migration assays demonstrated that the HRG-ß1-mediated increase of VEGF secretion leads to increased migration ability of endothelial cells, which is an important indicator of angiogenic response.
Our study shows for the first time that activation of the p38 MAPK pathway by HRG-ß1 leads to transcriptional up-regulation of VEGF in breast cancer cells via uHRE in the VEGF promoter. In addition, we have demonstrated that VEGF antibody and p38 MAPK inhibitor SB203580 each can inhibit endothelial cell migration induced by HRG-ß1-mediated VEGF secretion. Furthermore, the combination of VEGF antibody and SB203580 has an additive inhibitory effect to block endothelial cell migration induced by HRG-ß1-mediated VEGF secretion. These promising results reveal the potential of using VEGF antibody in combination with chemical inhibitors of the p38 MAPK to inhibit HRG-ß1-mediated tumor angiogenesis in breast cancers.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by Grants P30-CA16672 (Cancer Center
Core Grant) and 2RO1-CA60448 (to D. Y.) from the NIH; DAMD17-98-2-8338
and DAMD17-99-1-9271 (both to D. Y.) from the United States Army
Research and Material Command; and The University of Texas M. D.
Anderson Breast Cancer Basic Research Program Fund (to D. Y.). 
2 To whom requests for reprints should be
addressed, at Department of Surgical Oncology, Box 107, The University
of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston,
TX 77030. Phone: (713) 792-3636; Fax: (713) 794-4830.
3 The abbreviations used are: VEGF, vascular
endothelial growth factor; HRG, heregulin; nt, nucleotide; AchR,
acetylcholine receptor; MAPK, mitogen-activated protein kinase;
DMEM/F12, 1:1 mixture of Dulbecco’s modified essential medium and
Ham’s F12 nutrient mixture; CMV, cytomegalovirus; HRE, heregulin
response element; uHRE, upstream heregulin response element; WT,
wild-type; MUT, mutant; EGFld, epidermal growth factor-like domain; CM,
conditioned media; ERK, extracellular signal-regulated kinase; ActD,
actinomycin D; CMX, cycloheximide; MluE, murine lung endothelial;
PI-3K, phosphatidylinositol 3-kinase.
Received 7/28/00. Accepted 12/13/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
/ß.. Mol. Biol. Cell, 10: 2075-2086, 1999.This article has been cited by other articles:
|
|
 |
|
  Z. Qu, S. Van Ginkel, A. M. Roy, L. Westbrook, M. Nasrin, Y. Maxuitenko, A. R. Frost, D. Carey, W. Wang, R. Li, et al. Vascular Endothelial Growth Factor Reduces Tamoxifen Efficacy and Promotes Metastatic Colonization and Desmoplasia in Breast Tumors Cancer Res., August 1, 2008; 68(15): 6232 - 6240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Zhang, J. A.F. Hannay, J. Liu, P. Das, M. Zhan, T. Nguyen, D. J. Hicklin, D. Yu, R. E. Pollock, and D. Lev Vascular Endothelial Growth Factor Overexpression by Soft Tissue Sarcoma Cells: Implications for Tumor Growth, Metastasis, and Chemoresistance. Cancer Res., September 1, 2006; 66(17): 8770 - 8778. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Albig and W. P. Schiemann Identification and Characterization of Regulator of G Protein Signaling 4 (RGS4) as a Novel Inhibitor of Tubulogenesis: RGS4 Inhibits Mitogen-activated Protein Kinases and Vascular Endothelial Growth Factor Signaling Mol. Biol. Cell, February 1, 2005; 16(2): 609 - 625. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yu, D. Bian, C. Mahanivong, R. K. Cheng, W. Zhou, and S. Huang p38 Mitogen-activated Protein Kinase Regulation of Endothelial Cell Migration Depends on Urokinase Plasminogen Activator Expression J. Biol. Chem., November 26, 2004; 279(48): 50446 - 50454. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Segrelles, S. Ruiz, M. Santos, J. Martinez-Palacio, M. F. Lara, and J. M. Paramio Akt mediates an angiogenic switch in transformed keratinocytes Carcinogenesis, July 1, 2004; 25(7): 1137 - 1147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-H. Tseng, S.-M. Lin, J.-C. Chen, Y.-H. Su, H.-Y. Huang, C.-K. Chen, P.-Y. Lin, and Y. Chen Resveratrol Suppresses the Angiogenesis and Tumor Growth of Gliomas in Rats Clin. Cancer Res., March 15, 2004; 10(6): 2190 - 2202. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Zhou, R.-R. Zhou, H. Guan, C. D. Bucana, and E. S. Kleinerman E1A gene therapy inhibits angiogenesis in a Ewing's sarcoma animal model Mol. Cancer Ther., December 1, 2003; 2(12): 1313 - 1319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kook, H. Itoh, B. S. Choi, N. Sawada, K. Doi, T. J. Hwang, K. K. Kim, H. Arai, Y. H. Baik, and K. Nakao Physiological concentration of atrial natriuretic peptide induces endothelial regeneration in vitro Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1388 - H1397. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Welsh, R. R. Williams, A. Birmingham, D. J. Newman, D. L. Kirkpatrick, and G. Powis The Thioredoxin Redox Inhibitors 1-Methylpropyl 2-Imidazolyl Disulfide and Pleurotin Inhibit Hypoxia-induced Factor 1{alpha} and Vascular Endothelial Growth Factor Formation Mol. Cancer Ther., March 1, 2003; 2(3): 235 - 243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P.-W. Tsai, S.-G. Shiah, M.-T. Lin, C.-W. Wu, and M.-L. Kuo Up-regulation of Vascular Endothelial Growth Factor C in Breast Cancer Cells by Heregulin-beta 1. A CRITICAL ROLE OF p38/NUCLEAR FACTOR-kappa B SIGNALING PATHWAY J. Biol. Chem., February 14, 2003; 278(8): 5750 - 5759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Reisinger, R. Kaufmann, and J. Gille Increased Sp1 phosphorylation as a mechanism of hepatocyte growth factor (HGF/SF)-induced vascular endothelial growth factor (VEGF/VPF) transcription J. Cell Sci., January 15, 2003; 116(2): 225 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Liu and J. A. Kern Neuregulin-1 Activates the JAK-STAT Pathway and Regulates Lung Epithelial Cell Proliferation Am. J. Respir. Cell Mol. Biol., September 1, 2002; 27(3): 306 - 313. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Welsh, W. T. Bellamy, M. M. Briehl, and G. Powis The Redox Protein Thioredoxin-1 (Trx-1) Increases Hypoxia-inducible Factor 1{alpha} Protein Expression: Trx-1 Overexpression Results in Increased Vascular Endothelial Growth Factor Production and Enhanced Tumor Angiogenesis Cancer Res., September 1, 2002; 62(17): 5089 - 5095. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
