| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Imperial Cancer Research Fund Medical Oncology Unit, Western General Hospital, Edinburgh EH4 2XU [L. M. R. G., K. G. M., A. M., J. F. S., S. P. L.], and Imperial Cancer Research Fund Oncology Unit, Imperial College School of Medicine, London W12 ONN [W. J. G.], United Kingdom
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Previous studies have demonstrated that overexpression of both the EGF receptor and erbB2 are associated with poor prognosis in ovarian cancer (7, 8, 9, 10) . The erbB3 receptor is also present in the majority of ovarian cancers (11 , 12) , but similar to erbB4, little is known of its expression and function in this disease. erbB4 has been shown to be expressed in many adult and fetal tissues, including the lining epithelia of the gastrointestinal, urinary, reproductive, and respiratory tracts as well as the skin, skeletal muscle, circulatory, endocrine, and nervous systems (13) . The adult ovarian surface epithelium is weakly positive, whereas the stroma is nonreactive (13) .
Recently, splice variants of erbB4 have been identified that encode sequence differences in the juxtamembrane and cytoplasmic regions of the protein, and these are likely to possess differing functions (14, 15, 16, 17, 18, 19) . Sequencing of full-length erbB4 cDNAs revealed the existence of two isoforms that differed by insertion of either 23 or 12 alternative amino acids in the extracellular JM region (14) . Although both isoforms (JM-a and JM-b) are activated by erbB4 ligands, they are variably expressed in human tissues and are differentially processed in response to phorbol ester, consistent with representing protein kinase C-activated cleavable and noncleavable forms (14 , 15) . In addition, two novel JM splice variants (JM-c and JM-d) have been identified in medulloblastoma cells, and these represent isoforms lacking and including, respectively, both the a and b sequences (16) . A second modification has been identified in the cytoplasmic portion of the receptor representing a deletion of 48 bp (17, 18, 19) . Within this region, a PI3-K binding site is found, indicating the possibility of a loss of signaling via this pathway where the deletion was present. Isoforms that either possess or lack this deletion have been shown recently to be capable of mediating a growth response, but only the isoform containing the PI3-K binding site could mediate cell survival and chemotaxis (19) .
Although ovarian carcinoma cells have occasionally been used in studies examining the function of the erbB4 protein (20, 21, 22) , no systematic study has yet described the expression of this receptor in this disease or obtained information on its function. To address this, we have explored the expression of erbB4 protein in primary cancers and cell lines and have then examined which splice variants are present. The availability of blocking antibodies now allows some testing of its function.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Tumor Samples.
Fresh primary ovarian tumor tissue was obtained from 53 patients with epithelial ovarian cancer at initial debulking surgery, transferred to liquid nitrogen, and then formalin fixed and embedded in paraffin. Tumor histology was assessed on paraffin-embedded sections and classified according to WHO criteria. Tumor histologies were classified as follows: serous adenocarcinoma (29 tumors), endometrioid adenocarcinoma (18 tumors), and clear cell carcinomas (6 tumors). Information on stage was available for 48 patients and on grade of differentiation for 49 patients.
Immunohistochemistry.
Sections (3 µm) were deparaffinized and rehydrated. Endogenous peroxidase activity was blocked by incubating sections in 3% H2O2 for 30 min. Sections were immersed in citric acid buffer (0.005 M, pH 6.0) and microwaved for 3 x 5 min. Slides were washed in 0.05 M Tris/NaCl buffer (pH 7.6) and then incubated in 20% FCS for 10 min. Primary antibodies were added for 1.5–2 h. For the detection of erbB4, two antibodies were used, HFR-1 and H4.77.16. The immunogen for the HFR-1 antibody was the synthetic peptide corresponding to amino acids 1249–1264 (RSTLQIIDYLQEYST; Ref. 13
), whereas the immunogen for H4.77.16 was the extracellular fragment corresponding to amino acids 1–625 (24)
. H4.77.16 (Ab-1) was obtained from Neomarkers, Inc. (Fremont, CA). To detect erbB2, CB-11 (1:40 dilution; Neomarkers) was used. After primary antibody incubation, sections were washed in Tris/NaCl buffer. A streptavidin-biotin multilink method (StrAviGen Multilink kit; Biogenex, San Ramon, CA) was used for detection of reactivity. Sections were stained with secondary multilink antibody (1:20 dilution for 30 min), followed by horseradish peroxidase-labeled streptavidin complex (1:20 dilution for 30 min). Diaminobenzidine tetrachloride was used as chromagen and applied for 5 min. Sections were lightly counterstained in hematoxylin, dehydrated, and mounted. A section of human skin was used as a positive control because this tissue has reported previously to show a characteristic pattern of erbB-4 reactivity (13)
. Negative controls for each tumor section were included in all runs by replacing the primary antibody with Tris buffer. Reactivity was measured using a semiquantitative scale of 0 (negative), 1 (weak), 2 (moderate), and 3 (strong), relative to the positive control section. Slides were assessed by two observers independently, and assessment was concordant in 90% of readings. Where there were differences in the magnitude, these were reviewed by the two observers to obtain an agreed score.
RT-PCR.
Total cellular RNA was extracted from cells in log phase growth using TRI reagent (Sigma, Poole, United Kingdom). Samples were treated with 20 units/50 µl of DNase 1 (Boehringer Mannheim, East Sussex, United Kingdom) to remove genomic DNA contamination. RNA was then re-extracted using a phenol/chloroform protocol. Reverse transcription was performed with a first-strand cDNA synthesis kit (Boehringer Mannheim) using the oligo dT primer provided. One µg of RNA yielded 20 µl of cDNA, of which 2.5 µl was used for each subsequent PCR reaction with each primer pair. PCR reactions were performed in a final volume of 25 µl containing the following: 1x PCR buffer, 1.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphate mixture, 1.25 units of Taq polymerase (Imperial Cancer Research Fund Clare Hall, South Mimms, United Kingdom), 400 mM of each primer (Imperial Cancer Research Fund). The PCR conditions for actin were as follows: step 1, 94°C for 2 min; step 2 consisted of 35 cycles of 94°C for 30 s, 57°C for 45 s, and 72°C for 45 s; and step 3, 72°C for 5 min. The annealing temperature was modified for each primer pair to optimize final yield: for erbB4-JM and erbB4-CT primers, 52°C; for total erbB4, 61°C.
The following primers were used: total erbB4, AGTTTTCAAGGATGGCTCGAGACCCTC and AGCTTACACCACAGTATTCCGGTGTCT; 
-actin, ATGGCATCGTCACCAACTGG and ATGACAATGCCAGTGGTGCG; erbB4-JM, CAGTGTGAGAAGATGGAAGATG and CTTTTTGATGATCTTCCTTCTAAC; erbB4-CT, ATCTCTTGGATGAAGAGGATTTGG and GTCATCAAAAATCTCAGCAGTAGC. PCR products were visualized after electrophoresis on polyacrylamide gels by staining with ethidium bromide. Samples were scored as positive when a PCR product of the expected molecular size was amplified and identified after electrophoresis. PCR products were sized using a 100-bp ladder (Life Technologies, Paisley, United Kingdom), and diethyl pyrocarbonate-treated water was used as a control to detect the presence of contamination in reagents. RNA, which had not been reverse transcribed, was used in PCR reactions to check for genomic contamination of RNA samples. For the experiment where total erbB4 was examined in 24 primary tumors, integrated absorbance values were obtained using a gel scanner (UVP Life Sciences, Cambridge, United Kingdom) and analyzed by the Labworks gel analysis software (UVP).
Sequencing.
PCR products were purified on a Sea-plaque agarose gel, extracted, and purified by a Wizard PCR prep minicolumn (Promega, Southampton, United Kingdom). The cDNA product was ligated, inserted into a P-Gem-T Easy Vector (Promega), and grown in JM109 cells plated on agar. Transformed colonies were checked for product by PCR. PCR products were sequenced using a dRhodamine Terminator Cycle sequencing kit (Applied Biosystems, Warrington, United Kingdom) and run on a PE Biosystems 377 Automatic Sequencer.
Western Blotting.
Cell lines were grown to 80% confluence in 25-cm2 flasks (Falcon) in the presence of RPMI 1640 containing 10% FCS. The cells were washed twice in ice-cold PBS, lysed, detached from the flasks, and spun at 15,000 rpm at 4°C. The protein content of the resulting supernatant was determined by Bradford assay (25)
and stored at -80°C prior to Western blotting. After PAGE, proteins were transferred onto an Immobilon membrane (Millipore, Watford, United Kingdom) using a Bio-Rad Semi-Dry blotting apparatus (30 V overnight). Membranes were blocked in Tris-buffered saline (pH 7.4) containing 0.05% Tween (TBST), 5% ovalbumin, and 10% normal sheep serum. Antibodies were incubated for 1 h at room temperature. The following antibodies were used: anti-erbB4, Ab-2 (1:400 dilution; Neomarkers), which was targeted to amino acids 1285–1308 in erbB4, anti-phosphotyrosine, PY 20 (1 µg/ml; Santa Cruz); and anti-phosphoERK (1:1000 dilution; New England Biolabs, Hitchin, United Kingdom). Detection made use of a chemiluminescence Western blotting kit (Boehringer Mannheim). Integrated absorbance values were obtained as described above. In PE01 experiments using NRG1ß and the anti-erbB4 H4.72.8 antibody, conditions used were as described for the growth assays.
Growth Assays.
Exponentially growing cells were harvested by trypsinization and plated in 24-well plates at a density of 5 x 104 cells/well in RPMI 1640 containing 10% FCS. After 24 h to allow for attachment, the medium was removed and replaced with RPMI 1640 without phenol red but containing 5% double charcoal-stripped FCS. After a further 24 h, NRG1ß (10-9 M) was added to cells, and this was designated day 0. In groups where the anti-erbB4 H4.72.8 antibody (10 µg ml-1; Ab-3; Neomarkers; Ref. 24
) was included, it was added 30 min prior to addition of NRG1ß. Medium with or without NRG1ß and/or antibody was changed on day 2. Cells were harvested from wells on day 5 and counted on a Coulter counter.
Statistics.
Differences between groups were tested using Students’ t test, Mann Whitney, Fisher’s, and 
2 tests as appropriate.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Positive cytoplasmic staining was observed in 93% of the tumors using the HFR-1 antibody, 19% of which stained strongly, 42% moderately, and 32% weakly (Table 1)
. Using the H4.77.16 antibody, 89% of tumors were positive with 13% demonstrating strong staining, 27% moderate staining, and 49% weak staining (Table 1)
. In all cases, staining was relatively homogeneous throughout the tumor, with virtually all (>90%) tumor cells showing a similar intensity of staining. Both antibodies gave very similar staining results for individual tumors (P < 0.003 by paired t test), and examples are shown in Fig. 2
.
|
|
|
2 for trend; Table 1
). Neither stage nor grade of differentiation could be associated with the erbB4 expression level (Table 1)
. Using semiquantitative RT-PCR to measure total erbB4 and -actin, a ratio of erbB4:-actin mRNA was obtained, and the difference in erbB4 expression between serous and endometrioid tumors was again apparent (P = 0.017, Mann-Whitney; Fig. 3
).
|
erbB4 Expression in Ovarian Carcinoma Cell Lines.
Western blot analysis using the Ab-2 antibody indicated variation of erbB4 expression within a series of 16 ovarian carcinoma cell lines, with the PE04, PE06, OVCAR-3, and OVCAR-4 cell lines expressing high levels of erbB4; OAW42 and A2780 expressing moderate levels of erbB4; and SKOV-3 and PE014 cells expressing low levels of erbB4 (Fig. 4)
. The other 8 cells lines (PE01, PE01CDDP, PE016, OVCAR-5, SW626, 41 M, 59 M, and CAOV3) expressed levels that were undetectable by this method.
|
RT-PCR Analysis of erbB4 Isoforms in Ovarian Cancers and Cell Lines.
Several splice variants of erbB4 have been reported recently, which are predicted to initiate different signaling events and may have differing functionality. It was therefore of interest to define which forms were present in ovarian cancers and cell lines. mRNA from these tissues was isolated, subjected to reverse transcription, and analyzed by primers flanking the variable regions.
For the JM region, the expected product size for the JM-a-derived cDNA was 375 bp; for the JM-b cDNA, 345 bp; and for the JM-d cDNA, 414 bp. After separation on a 2.5% agarose gel, bands corresponding to JM-a and JM-d were observed in the cell line panel (Fig. 5A)
. As a control, the same reverse transcription products were probed with primers targeted to -actin, and a 250-bp product was identified in all samples (Fig. 5C)
. The identities of these amplified RT-PCR products (JM-a and JM-d) were confirmed by cloning the cDNA products into a P-Gem-T Easy vector and sequencing the inserts (Table 2)
.
|
|
. The cell lines PE06, OVCAR-3, and OAW42 expressed both JM-a and JM-d isoforms, whereas SKOV-3 and 41 M cells expressed the JM-a isoforms. The JM-d isoform was clearly a minority product (approximately 10–20% intensity) compared with the JM-a form. Neither isoform was observed under these PCR conditions in the PE01, PE01CDDP, PE016, OVCAR-5, or SW626 cell lines. No expression of the JM-b or JM-c isoforms was detected in any of the 10 lines.
A panel of 24 primary ovarian tumors was then examined, and JM-a was detected in 18 of 24 tumors (Fig. 6A)
. A band consistent with JM-d was also observed as a minor component in several of these tumors (Fig. 6A)
.
|
. The identities of these were confirmed by direct sequencing. The same 5 cell lines that had shown expression for the JM-a primers were positive for both the CT-a and CT-b isoforms, and for 4 of these cell lines (PE06, OVCAR-3, 41 M, and OAW42), the CT-a (full-length) isoform was predominant; however, for SKOV-3, the CT-b form was predominant. For the series of 24 carcinomas, the same 18 tumors demonstrating JM-a expression showed both CT-a and CT-b expression, and weak expression of both forms was observed in 4 additional tumors (Fig. 6B)
. Expression was predominant for CT-a in 7 tumors, for CT-b in 7 tumors, and was equivalent for both isoforms in 8 tumors.
Effect of erbB4 Blocking Antibody on Growth and Signaling.
To test whether the erbB4 receptor might mediate a growth function, the effects on the growth of cell lines of an antibody (H4.72.8) that blocks the binding of NRG1ß to the erbB4 receptor (24)
were investigated. Four cell lines were studied: PE01, PE06, PE01CDDP, and SKOV-3. Both PE01 (which expresses a low-to-undetectable level of erbB4) and PE06 (which expresses a high level of erbB4) are growth stimulated by NRG1ß, whereas PE01CDDP (which expresses a low level of erbB4) is growth inhibited by NRG1ß. Growth of SKOV-3 cells is unaffected by addition of NRG1ß.
NRG1ß alone stimulated growth of the PE01 cell line. In the presence of the antibody, this growth effect was not blocked but enhanced (Fig. 7)
. In the absence of NRG1ß, the addition of the blocking antibody also markedly enhanced growth of the PE01 cell line, perhaps consistent with growth inhibition exerted through the erbB4 receptor by NRG1ß present at low levels in the charcoal-stripped serum or generated via an autocrine route in the cells. For PE06 cells, the antibody produced a small increase in growth in the presence of NRG1ß but had no effect in the absence of added factor (Fig. 7)
.
|
. Addition of the antibody either in the presence or absence of added growth factor did not influence growth. The PE01CDDP cell line is growth inhibited by NRG1ß. This was enhanced slightly by addition of antibody (Fig. 7)
. In the absence of ligand, a small growth inhibition was produced. These results indicate that the growth-stimulatory effects of NRG1ß in PE01 and PE06 cells are not being mediated via erbB4, and indeed, action through erbB4 might be antagonistic. Similarly, the growth-inhibitory effect produced by NRG1ß in PE01CDDP cells was enhanced by the blocking antibody against erbB4, suggesting that action via erbB4 action is antagonistic.
To investigate whether the erbB4 receptor was mediating NRG1ß-induced signaling, the effects of the blocking antibody on tyrosine phosphorylation of the erbB2 receptor and ERK1/ERK2 were studied in PE01 cells. Treatment of PE01 cells with NRG1ß markedly increased tyrosine phosphorylation of both erbB2 (Fig. 8A)
and phosphorylation of both p44 (ERK1) and p42 (ERK2; Fig. 8B
). This was partially reversed (
50%) by coincubation with H4.72.8, demonstrating the involvement of erbB4 in NRG1ß signaling.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In a series of ovarian cancer cell lines, erbB4 expression was again variable, and increased expression appeared to be associated with prior platinum treatment and/or resistance. Increased expression of EGF receptor, erbB2, and erbB3 has been observed previously in drug-resistant breast cancer cell lines (34) , but we are not aware of any study finding an association between increased erbB4 and drug resistance. Further studies are required to assess whether and how this increased erbB4 expression influences platinum sensitivity.
RT-PCR analysis indicated the presence of multiple isoforms of erbB4 within these ovarian cancer systems. The JM isoforms are differentially expressed in human tissues with, for example, the cerebellum expressing both forms, whereas the heart expresses only JM-b (14) . Only the JM-a form undergoes cleavage by phorbol ester, and this might result in another level of regulation of the activities of the different ligands for erbB4 (15) . All of the cell lines and tumors expressing erbB4 possessed the JM-a rather than the JM-b isoform. In addition, several cell lines and primary tumors expressed the JM-d form, which contains both exons. There has been no report on the expression or function of the JM-d molecule, other than it can also be found in medulloblastoma cells (16) . Although no other study has formally reported its presence in ovarian cancer cells, a recent GenBank entry (AI798478) describing the variable sequence found within the JM-d form was obtained from mRNA derived from a pool of five human ovarian cancers, confirming its presence in this disease.
We observed that all cell lines that expressed the "full-length" CT-a isoform contained the CT-b isoform also, and this is consistent with the initial report of this isoform (17) . The CT-b differs from CT-a in lacking 48 bp, which encode a PI3-K binding site. Both isoforms have been demonstrated recently to be functional NRG receptors, and consistent with expectation, CT-b does not bind or activate PI3-K in a ligand-dependent manner (18) . When the isoforms were transfected separately into NIH 3T3 cells, NRG1ß-stimulated cells contained either CT-a or CT-b, suggesting that the PI3-K site was not critical for a growth response, but the ability to induce survival and chemotaxis was markedly reduced in the CT-b transfect compared with the CT-a transfect (19) . Consistent with the involvement of the PI3-K site in the latter two processes, Akt was phosphorylated in the CT-a but not the CT-b transfect (19) .
The relative levels of the two isoforms varied among the cell lines and primary tumors that we studied, potentially allowing a variety of signaling options. In the initial report (17) of these isoforms were two ovarian cell lines, OVCAR-3 and SKOV-3. The former cell line was reported positive, and the latter was reported negative, by initial RT-PCR but positive by Southern blotting of the amplified cDNA. In the present study, we found both cell lines to be positive, but SKOV-3 cells differed thus far because they expressed more CT-b than CT-a. Because we identified erbB4 expression in SKOV-3 cells by two other sets of primers and also by Western analysis and because it has also been detected by others (21) , it is likely that our technique is more sensitive. Our study indicates that multiple transcripts of erbB4 exist in ovarian cancer cells, and just as alternate transcripts of erbB3 have been identified in ovarian cancer (35) , this adds further complexity to the signaling possibilities that might arise from erbB receptor interactions. The retention of these multiple forms in ovarian cancers and in other tissues (17 , 18) does suggest that they have functionally important roles.
The function of erbB4 appears to vary, depending on its context. Although erbB4 has been shown to have an important role in cardiac and neural development (36) , its role in different cancers is at present unclear. For example, in breast cancer, erbB4 has been proposed to mediate a proliferative function because down-regulation of erbB4 using a ribozyme hammerhead strategy inhibited colony formation of breast cancer cells in vitro and tumor formation in nude mice (37) . Similarly, in a granulosa cell line that expressed erbB4 but not erbB3, neuregulin stimulated growth, further supporting a link with proliferation (32) . In normal mammary epithelium, NRG can induce both proliferation and differentiation (38) , and in breast cancer cell lines, NRG induces several features of differentiation (39) . The nature of the activating ligand may also be important because activation of erbB4 by HB-EGF has been associated with chemotaxis (5) . Because the effects of neuregulin are mediated via both erbB4 and erbB3, it is feasible that each receptor induces different functions, and if both receptors are present, then the relative expression levels of each of these receptors, together with those of erbB2 to which they can heterodimerize, may determine response (22) . Within our study, use of an antibody that blocked the interaction of NRG1ß and erbB4 indicated that the antibody only produced an effect in situations where NRG1ß was active, and indeed, it enhanced the growth modulation produced by NRG1ß rather than blocked it (i.e., it stimulated growth of PE01 and PE06 cells and inhibited growth of PE01CDDP) and had no effect on SKOV-3 cells, the growth of which is unaffected by NRG1ß. Even in the absence of NRG1ß, the anti-erbB4 blocking antibody enhanced growth of PE01 cells, and this may be attributable to blockade of NRG1ß, either produced by these cells in an autocrine manner (which is detectable by RT-PCR; data not shown) or from the serum. Parallel studies have indicated that erbB3 is the prime mediator of the growth-modulatory effects of NRG1ß in these cell lines5 , and the data presented here suggest that signaling via erbB4 antagonizes this effect. Consistent with erbB4 mediating a growth inhibitory role in general, high coexpression of both erbB4 and erbB2 appear linked with improved survival.
In conclusion, this is the first systematic analysis of erbB4 protein expression in ovarian cancer, and we have demonstrated the presence of multiple mRNA isoforms of this receptor within this disease. Highest expression is associated with the serous subtype and with platinum resistance, and the receptor appears to program for minor growth effects. Further studies are required to explore its interaction with other members of the erbB receptor family.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Present address: Department of Haematology, U Floor, Belfast City Hospital, Belfast BT7 9AB, United Kingdom. 
2 Present address: Department of Biosciences, University of Kent at Canterbury, Canterbury, Kent CT2 7NJ, United Kingdom.
3 To whom requests for reprints should be addressed, at ICRF Medical Oncology Unit, Western General Hospital, Edinburgh EH4 2XU, United Kingdom. Phone: 131-467-8455; Fax: 131-332-8494; E-mail: s.langdon{at}icrf.icnet.uk
4 The abbreviations used are: EGF, epidermal growth factor; JM, juxtamembrane; CT, cytoplasm; PI3-K, phosphatidylinositol 3-kinase; RT-PCR, reverse transcription-PCR; NRG, neuregulin; ERK, extracellular signal-regulated kinase.
5 L. M. R. Gilmour and S. P. Langdon, unpublished results.
Received 6/26/00. Accepted 12/29/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  F. Zeng, M.-Z. Zhang, A. B. Singh, R. Zent, and R. C. Harris ErbB4 Isoforms Selectively Regulate Growth Factor induced Madin-Darby Canine Kidney Cell Tubulogenesis Mol. Biol. Cell, November 1, 2007; 18(11): 4446 - 4456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Y. W. Bourguignon, E. Gilad, and K. Peyrollier Heregulin-mediated ErbB2-ERK Signaling Activates Hyaluronan Synthases Leading to CD44-dependent Ovarian Tumor Cell Growth and Migration J. Biol. Chem., July 6, 2007; 282(27): 19426 - 19441. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Macleod, P. Mullen, J. Sewell, G. Rabiasz, S. Lawrie, E. Miller, J. F. Smyth, and S. P. Langdon Altered ErbB Receptor Signaling and Gene Expression in Cisplatin-Resistant Ovarian Cancer Cancer Res., August 1, 2005; 65(15): 6789 - 6800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Carter, L. Smith, and M. Ryan Identification and validation of cell surface antigens for antibody targeting in oncology Endocr. Relat. Cancer, December 1, 2004; 11(4): 659 - 687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Alaoui-Jamali, D. J. Song, N. Benlimame, L. Yen, X. Deng, M. Hernandez-Perez, and T. Wang Regulation of Multiple Tumor Microenvironment Markers by Overexpression of Single or Paired Combinations of ErbB Receptors Cancer Res., July 1, 2003; 63(13): 3764 - 3774. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lai, J. Chien, J. Staub, R. Avula, E. L. Greene, T. A. Matthews, D. I. Smith, S. H. Kaufmann, L. R. Roberts**, and V. Shridhar** Loss of HSulf-1 Up-regulates Heparin-binding Growth Factor Signaling in Cancer J. Biol. Chem., June 13, 2003; 278(25): 23107 - 23117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. R. Gilmour, K. G. Macleod, A. McCaig, J. M. Sewell, W. J. Gullick, J. F. Smyth, and S. P. Langdon Neuregulin Expression, Function, and Signaling in Human Ovarian Cancer Cells Clin. Cancer Res., December 1, 2002; 8(12): 3933 - 3942. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
