This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Laurent, E. Articles by Kurzrock, R. Search for Related Content PubMed PubMed Citation Articles by Laurent, E. Articles by Kurzrock, R.

The BCR Gene and Philadelphia Chromosome-positive Leukemogenesis

Departments of Bioimmunotherapy [E. L., M. T., R. K.] and Leukemia [H. K., R. K.], University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030

	Introduction

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

 
Recent investigations have rapidly added crucial new insights into the complex functions of the normal BCR gene and of the BCR-ABL chimera and are yielding potential therapeutic breakthroughs in the treatment of Philadelphia (Ph) chromosome-positive leukemias. The term "breakpoint cluster region (bcr)" was first applied to a 5.8-kb span of DNA on the long arm of chromosome 22 (22q11), which is disrupted in patients with CML² bearing the Ph translocation [t(9;22)(q34;q11); Refs. 1, 2, 3 ]. Subsequent studies demonstrated that the 5.8-kb fragment resided within a central region of a gene designated BCR (4) . It is now well established that the breakpoint within BCR can be variable, and when joined with ABL, results in a hybrid M_r 210,000 (p210^Bcr-Abl) or a M_r 190,000 (p 190^Bcr-Ablprotein (p190^Bcr-Abl; Fig. 1 ; Refs. 5, 6, 7, 8, 9, 10, 11, 12, 13 ). Of interest, p190^Bcr-Abl characterizes a phenotypically acute, rather than chronic, leukemia that is often, but not always, of lymphoid (rather than of myeloid) derivation (Refs. 10 and 14 ; Table 1 ). Both p210^Bcr-Abl and p190^Bcr-Abl have constitutive tyrosine kinase activity. Furthermore, the presence of the hybrid proteins perturbs the multiple functions of their normal counterparts. Understanding the biological sequelae of the molecular aberrations in Ph-positive disease has led to development of novel tyrosine kinase inhibitor therapy that is showing remarkable success in clinical trials. Herein, we review the current state of knowledge on the role of BCR alone or when joined with ABL in normal and leukemic pathophysiology and the implications of this knowledge for therapy.

View larger version (35K): [in this window] [in a new window] [Download PPT slide]   Fig. 1. Schematic representation of BCR, ABL, and BCR-ABL genes and the proteins they encode. Numbers refer to exon number. In the BCR gene, exons 1' and 2' are alternative exons contained within the first intron. The ABL gene has two alternative first exons denoted 1b and 1a, respectively. A series of different protein products are described based on the fusion transcripts that have been identified. The predicted proteins are illustrated in the right-hand column. (However, not all these proteins have been demonstrated on gels and, therefore, not all of them are given a size.)

	Genomic Structure of the BCR Gene

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

View larger version (18K): [in this window] [in a new window] [Download PPT slide]   Fig. 2. Schematic representation of the Bcr protein. Functional sites include a serine/threonine kinase domain in exon 1, a central GEF domain, and a COOH-terminal GAP domain. SH2-binding sites are also present in exon 1. The two Abl SH2-binding sites are noted in the figure and stretch from amino acids 192–242 and 293–413. Interaction at these sites is mediated via phosphoserine and phosphothreonine. The 14-3-3 protein (Bap-1) also interacts with the latter site. Grb2 associates with an additional proximal SH2-binding site containing a phosphotyrosine at position 177. The GEF domain interacts with the XPB DNA repair protein.

There is an additional BCR-related gene located on chromosome 17p13.3 (35 , 38 , 39) . This gene is functionally active and has been designated ABR or active BCR-related gene (35) . There is 68% homology between ABR and the central and COOH-terminal regions of BCR (35 , 39) .

The BCR Promoter
The 5' untranslated region of the BCR gene is important because the fusion gene created by the Ph translocation is placed under the regulation of the BCR promoter (31 , 40, 41, 42) . A region 1-kb upstream of the transcription start site was demonstrated to be the principle site of promoter activity (41 , 42) . Within this region, a CAAT box (conserved sequence upstream of start point of transcription, which is recognized by transcription factors) at position -644 as well as an inverted CAAT sequence at position -718 have been localized. However, neither in vitro nor in vivo studies suggest that these sequences are key factors for transcriptional regulation of the BCR gene (41) . There is also a TATA box [conserved sequences in the promoter that specify the position at which transcription is initiated (43) ] 120 bp downstream of the CAAT box. This TATA box, TTTAA, is also accompanied by the consensus sequence TCATCG, required for 5' capping of the transcript (41) .

DNA footprinting and gel retardation assays have also been used to discover potential sites for DNA/protein interaction, which might reflect transcription factor activity. Several sites were found including ones containing the consensus sequence GGGCCGG (as well as the inverted sequence) for the SP1 transcription factor (41 , 42) . A unique sequence TAGGGCCTCAGTTTCCCAAAAGGCA, for which no binding protein is known, was also detected (41) . Deletion of that site (versus other potential binding sites) resulted in a significant decrease of promoter activity in BCR-ABL-transfected cells (41) .

The 5' untranslated region of the BCR gene is also very rich in GC content, which makes up 80% of the nucleotides with"in this stretch of the DNA (31 , 36) . Within this GC-rich region is a segment 18 nucleotides long at sites -376 to -393, containing the sequence GCGGCGGCGGCGGCGGCG with its inverted repeat 363 bp downstream. These sequences are apt to form secondary stem and loop structures, with a possible role in translational regulation (36) , and are common to many housekeeping genes (43) . Other possible start sites upstream of the normal AUG codon have been found; however, these have short open reading frames because there are stop codons downstream of these sites (31 , 40) . It has been suggested that these short transcripts could also play a role in regulating protein translation (40) .

Bcr Protein(s)
Currently, the normal BCR gene is known to code for two major proteins that are M_r 160,000 and M_r 130,000 in size (17 , 25 , 30) . It is possible that these proteins are derived from the 7.0- and 4.5-kb BCR transcripts, respectively (15 , 17 , 26) . In addition, Li et al. (44) have described putative Bcr proteins of M_r 190,000/M_r 185,000, M_r 155,000, M_r 135,000, M_r 125,000, and M_r 108,000.

Bcr-related Protein(s)
The ABR gene encodes for a M_r 98,000 protein that contains both the GEF and GAP domains of Bcr (respectively, the central and COOH-terminal regions) but lacks the serine/threonine kinase domain found at the NH₂-terminus (39 , 45) . Analysis of GAP activity showed that both Bcr and Abr acted similarly toward different G proteins, especially members of the Rho subfamily, which includes Cdc42 and Rac (39 , 46) .

BCR Expression
The BCR gene is expressed ubiquitously (4 , 31 , 32) . In chick embryos, as well as in mouse and human tissues, mRNA levels were found to be highest in the brain and hematopoietic cells (32 , 41) . Similarly, ABR transcripts are also most prominent in hematopoietic tissue and brain, with the highest levels in the latter (39 , 45) . To date, however, the aberrant BCR-ABL gene appears to affect hematopoietic cells. Of interest, Bcr protein is expressed primarily in the early stages of myeloid differentiation, and levels are reduced significantly as cells mature to polymorphonuclear leukocytes (33) . Because p210^Bcr-Abl is expressed off the BCR promoter, it is not surprising that this protein shows a similar correlation between expression pattern and myeloid differentiation (33) .

Bcr Subcellular Localization
The Bcr-Abl protein is known to be cytoplasmic (36) . In addition, the normal product of the BCR gene was initially demonstrated to be a cytoplasmic protein by immunofluorescence staining and cell fractionation studies (17 , 33 , 47) . A wealth of studies implicate this protein in cellular signal transduction pathways, especially those regulated by G proteins (discussed below; Ref. 48 ). Subsequent investigations have, however, shown that the Bcr product can also associate with condensed DNA (49) . According to electron microscopic examination of immunogold-labeled cells, Bcr interacts with mitotic DNA as well as the highly condensed heterochromatin in interphase cells (49) . In some cell lines, the M_r 130,000 Bcr protein predominates in the nucleus, and the M_r 160,000 form predominates in the cytoplasm (50) . Of interest in this regard, Bcr was found recently to be associated with the XPB protein (51 , 52) . XPB plays a role in DNA repair, general transcription initiation, and cell cycle regulation (53) .

	Functional Domains of BCR

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

 
The BCR gene is now known to be a complex molecule with many different functional domains (Ref. 48 ; Table 3 ; Fig. 2 ). Within the first exon of BCR resides a structurally novel protein kinase domain (25 , 54) . At the COOH-terminus, a GAP domain, which demonstrates activity for the Ras-related GTP-binding protein p21^Rac, has been described (65) . In addition, the central part of the BCR gene contains sequences homologous to various GEFs (63 , 64 , 68) . These data implicate the participation of BCR in two major intracellular signaling mechanisms in eukaryotic cells (phosphorylation and GTP-binding).

	First Exon

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

Serine/Threonine Kinase Domain.
The Bcr protein has serine/threonine kinase activity within its first exon (25 , 30 , 54 , 71) . A consensus sequence homologous to the ATP-binding site of other kinases as well as a likely phosphotransferase domain has been identified (36 , 44) . Bcr can autophosphorylate on serine and threonine residues, as well as transphosphorylate casein and histones in vitro (54) . (The latter are known substrates for serine/threonine kinases.)

In Ph-positive disease, phosphotyrosines are present on both Bcr and Bcr-Abl (mutually p210^Bcr-Abl and p190^Bcr-Abl) because of the tyrosine kinase activity of Bcr-Abl (72) . The first exon of the Bcr component of Bcr-Abl is also phosphorylated on serine/threonine residues (54 , 72) . Indeed, the majority of autophosphorylation of Bcr-Abl occurs within the Bcr rather than the Abl portion of the protein (72) .

SH2-binding Domain.
There are several SH2-binding domains in the first exon of BCR (60) . [SH2 domains are highly conserved, noncatalytic regions of 100 amino acids that bind SH2-binding sites consisting of three to five amino acids including a phosphotyrosine. This interaction is important in the assembly of signal transduction complexes (73, 74, 75) .] Bcr is unique in that SH2 domains of other proteins can bind to the phosphoamino acid serine, threonine, or tyrosine (rather than only tyrosine) in two of its SH2-binding sites (60 , 61) . One SH2 domain that binds to Bcr is that of Abl, and this interaction is mediated via phosphorylated serines and threonines (60) . Bcr sequences involved in this interaction lie between amino acids 192–242 and 298–413 and are essential for the oncogenic activation of Bcr-Abl (60) . A third Bcr SH2-binding region has also been found. It interacts through a phosphorylated tyrosine with the adaptor protein Grb2 (59) . The latter is an essential protein in the Ras signal transduction pathway (Fig. 2) .

Oligomerization Domain.
A third functional domain found within exon 1 of BCR is an oligomerization domain that is characterized by a heptad repeat of hydrophobic residues between amino acids 28 and 68 (57) . Bcr and Bcr-Abl have been found to coimmunoprecipitate through this domain (76 , 77) . Mutations within the oligomerization domain attenuate the tyrosine kinase enzymatic activity of Bcr-Abl and abolish the interaction between Bcr and Bcr-Abl (57) . Of interest, TEL (an ETS family gene) can also partner with ABL [t(9;12) translocation of acute leukemia] and activate Abl tyrosine kinase activity (78) . It has been postulated that, similar to the situation with Bcr, the Tel helix-loop-helix domain facilitates dimerization or oligomerization of the fusion partner to activate its function.

The oligomerization domain also affects Bcr-Abl localization. Abl contains both a nuclear localization and an F-actin-binding (cytoplasmic) motif (70 , 79) . Although normal Abl can be found both in the nucleus and in the cytoplasm (Refs. 33 and 80 ; Table 4 ), Bcr-Abl is found to be cytoplasmic and partially associated with the cytoskeleton (33 , 70 , 106) . Deletion of the oligomerization domain results in decreased binding of Bcr-Abl to F-actin, suggesting that this domain of Bcr enhances the F-actin binding capacity of Bcr-Abl and is at least partially responsible for the cytoplasmic localization of Bcr-Abl (57) .

	Central Domain

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

GEF-related Domain.
The central region of the BCR gene shows homology to the hematopoietically expressed VAV proto-oncogene (a GEF) as well as with a CDC25 mouse homologue termed CDC25 Mm (64 , 109) . [CDC25 Mm is homologous to the Ras activator CDC25 of Saccharomyces cerevisiae (64 , 109) .] In addition, central BCR sequences demonstrate homology to the yeast cell division cycle gene CDC24, as well as its human counterpart, the DBL oncogene, which codes for a GEF (63 , 68) . The CDC24 gene codes for a cell division cycle control protein and also plays a role in cytoskeletal and cytoplasmic organization, bud formation in yeast, cell polarity, and acts as a GDP-GTP exchange factor for Ras-like G proteins (68 , 110, 111, 112) . Cdc24 interacts with the product (a GTP-binding protein) of the bud assembly gene CDC42 and is a member of the Ras superfamily of GTPases (113 , 114) . To add to the complexity of the BCR gene, the GAP domain at the COOH-terminus contains activity toward the product of CDC42Hs, the human homologue of CDC42 (68) . Taken together, these observations indicate that Bcr has both GAP and GEF functions and hence suggests a dual role for this molecule in G protein-associated signaling pathways.

Interaction with XPB Gene Product.
Recent studies using the yeast two-hybrid system were performed to identify proteins that could interact with the central Cdc24 homologous region of Bcr (51) . The results yielded one surprising candidate, the DNA repair XPB protein (51) . Xeroderma pigmentosum is an inherited disorder characterized by increased sensitivity to sunlight, coupled with a defect in the DNA repair machinery. The XPB protein is also a component of the transcription factor IIH core complex, which plays a role in initiation of transcription as well as in DNA repair (53) . The XPB protein was found to interact with both normal Bcr as well as with p210^Bcr-Abl (51 , 52) . Importantly, the Bcr Cdc24 homologous domain is present in p210^Bcr-Abl but absent in p190^Bcr-Abl. When XPB is coexpressed with p210^Bcr-Abl, XPB becomes phosphorylated and is unable to correct a DNA repair defect (51) . This phenomenon is not observed in the presence of p190^Bcr-Abl (51) . It is therefore conceivable that the presence of p210^Bcr-Abl interferes with the normal interaction between Bcr and XPB, thus leading to defective DNA repair and subsequent genomic instability in Bcr-Abl-positive CML. This mechanism may explain the clonal evolution that occurs in CML and drives the inevitable progression of this disease from an easily controlled "benign" phase to a fatal blast crisis.

	COOH-Terminal Domain

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

 
COOH-terminal sequences are also involved in G protein regulation. However, whereas the central sequences have GEF homology (activates G proteins), the COOH-terminal sequences have GAP homology (inactivates G proteins). One of the best-studied G proteins is the oncogene p21^RAS (115) . The RAS superfamily is known to have multiple members (116) . Members of the RHO subfamily are critical components of signaling pathways that link extracellular signals with reorganization of the cytoskeleton as well as with membrane ruffling (117) . A GAP protein specific for Rho family GTPases, termed RhoGAP, has structural similarity to the COOH-terminus of Bcr (118) . The BcrGAP domain accelerates the GTPase activity of Rac in vitro and specifically inhibits Rac-induced membrane ruffling in vivo (65 , 117) . In BCR knockout mice, Bcr regulates Rac-mediated superoxide production during neutrophil priming and activation (66) . A human brain protein, chimaerin, with GAP activity also has homology to COOH-terminal Bcr sequences (119) . Interestingly, another protein designated 3BP-1, which also has sequence homology to the COOH-terminus of Bcr as well as to RhoGAP, binds the SH3 region of Abl with high specificity (67) . The Abl SH3 region has an important negative regulatory function in transformation because its deletion activates the transforming potential of Abl.

	Bcr-associated Proteins

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

 
The Bcr protein has been found to complex with several proteins, which, as discussed previously, include Abl, Bcr-Abl, the adaptor protein Grb2, and the XPB protein (51 , 52 , 59 , 60 , 76 , 77) . Included among the Bcr-associated proteins are members of a family of acidic proteins termed 14-3-3. These proteins play a role in intracellular signaling pathways (120) , cell cycle/DNA damage checkpoint control, and trafficking of the mitotic inducer Cdc25C from the nucleus to the cytoplasm (121 , 122) . Thus far, Bcr is known to interact with two isoforms, ß and , of this protein family (55 , 56) . The latter is also known as Bap-1 (55) . Both of these proteins bind Bcr at a region within its first exon, which is rich in serine and threonine, as well as cysteine residues. Interaction between 14-3-3 proteins and other proteins occurs through phosphoserine association within a putative consensus sequence RSxSxP, a sequence present at the site in Bcr exon 1 where the 14-3-3 proteins bind (123) . When complexed with Bcr, Bap-1 is phosphorylated on its serine/threonine residues by the kinase domain of Bcr, thus making it a substrate for Bcr (55) . Interestingly, the ß isoform of 14-3-3 complexes not only with Bcr but also with the serine/threonine kinase Raf (an upstream regulator of the mitogen-activated protein kinase; Ref. 56 ). It was postulated that 14-3-3ß could act as a mediator between Bcr and Raf, possibly through formation of homodimers, a trait associated with 14-3-3 proteins (56 , 124) .

	Structure of the BCR-ABL Gene in CML and Acute Leukemia

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

 
BCR-ABL Genes and Proteins
The hallmark of CML is the Ph chromosome, which is a shortened chromosome 22 resulting from a translocation, t(9;22)(q34;q11), between chromosomes 9 and 22 (2 , 27) . A cytogenetically identical translocation also occurs in about 20% of adult ALL, 5% of pediatric ALL, and rare cases of AML (125 ; Table 5 ). The involvement of chromosome 9 is now known to disrupt the ABL gene (15 , 20 , 81 , 144) . The actual breakpoint on chromosome 9 may span a large distance. In some cases, the break is 5' to the two alternative first exons of the ABL gene (exons 1a and 1b), whereas in others, the break occurs within the first intron (1 , 126 , 145 , 146) , which extends over 200 kb (Ref. 82 ; Fig. 1 ). [Regardless, the fusion transcript almost always includes exon 2 of ABL (a2)]. In contrast, in CML, the break on chromosome 22 is restricted in most patients to an area of 5.8-kb termed the M-bcr (1) . M-bcr consists of five exons termed M-bcr exons b1–b5. These exons are actually located within the central region of the BCR gene and are equivalent to exons 11–15 (e11–e15) of this gene. Most breaks occur immediately downstream of exon 2 or 3 of the M-bcr region (4) and result in b2a2 or b3a2 fusion transcripts. In acute leukemia, however, the breakage can also occur outside M-bcr in about half the cases (8 , 9 , 22 , 135 , 136 , 139) , usually within the 3' end of intron 1 of the BCR gene (26 , 141) , resulting in an e1a2 fusion transcript. The breakpoint sites in both BCR and ABL appear to involve Alu sequences (transposable repeat elements found throughout the human genome; Refs. 141 and 147, 148, 149, 150 ).

The protein encoded by the 8.5-kb BCR-ABL mRNA is M_r 210,000 and designated p210^Bcr-Abl (5, 6, 7) . The two most common molecular variants of p210^Bcr-Abl are generated depending on whether the break in M-bcr is centromeric or telomeric to exon 3 of M-bcr (b2a2 versus b3a2; Ref. 8 ). Therefore, p210^Bcr-Abl may or may not contain the 25-amino acid sequence encoded by exon 3.

As mentioned above, in Ph-positive acute leukemia patients with breakpoints in the first intron of BCR, an abnormal BCR-ABL transcript of about 7.0-kb in size is found (10, 11, 12) . This encodes a protein M_r 190,000 in size (9, 10, 11, 12, 13 , 133) . p190^Bcr-Abl (also designated p185^Bcr-Abl by some investigators) was initially felt to be involved only in lymphoid lineage leukemia but was eventually also demonstrated in Ph-positive AML (9) . In acute leukemia patients with breakpoints in the M-bcr, the mRNA (8.5-kb), and protein (p210^Bcr-Abl) produced are identical to those in CML (10 , 136) .

In addition to the classic breakpoints found within the major (central 5.8-kb region) and minor (first intron of BCR) breakpoint cluster regions of BCR (respectively termed M-bcr and m-bcr), other unique breakpoint sites have been found. These include a micro 3' site termed µ-bcr [BCR exon 19 (c3) to BCR exon 20 (c4)], which can yield a M_r 230,000 protein (24 , 156 , 157) . Patients with the e19a2 fusion between BCR exon 19 (e19) and ABL exon 2 (a2) were classified as having neutrophilic CML (157) . Because these cases were viewed as being less aggressive than typical CML, it has been suggested that the amount of BCR sequences present in the fusion transcripts correlate with disease phenotype (23 , 157) . However, there have been reports of patients with classic CML and AML phenotypes who possess the e19a2 fusion transcript (158, 159, 160, 161) . Reports of other BCR-ABL variants include a b3a3, an e6a2, an e2/a1a, and more recently, e8/a2 and e13/a2 fusion transcripts/genes (Refs. 162, 163, 164, 165 ; Fig. 1 ; Table 5 ).

The differences in size of BCR-ABL transcripts is not only a reflection of variation in the sites of breakage/fusion but is also a result of alternative splicing between BCR and ABL and within BCR itself (19 , 166) . The normal ABL gene is composed of 11 exons, which include exons 1a and the more proximal exon 1b. These exons can be alternatively spliced, yielding two different mRNAs of 6- and 7-kb in size (19) . The distance between exon 2 and exon 1b is greater than 200 kb, demonstrating the ability of ABL exon 2 to skip over the vast expanse of intron 1 to join to the splice donor site of exon 1b (7 , 19 , 82) . This ability is maintained in the fusion gene, and the end results are the joining of ABL splice acceptor site of exon 2 to the splice donor sites of various BCR exons and the excision of ABL exons 1a and 1b. (ABL exons 1a and 1b do not have splice acceptor sites.) Indeed, even in CML containing breaks within M-bcr, splicing can occasionally result in a transcript with an e1/a2 junction in addition to transcripts with a b2a2 or b3a2 junction (143 , 166) .

Bcr-Abl Functional Characteristics
Kinase Activation.
Tyrosine kinase activity is essential to cellular signaling and growth, and constitutively elevated kinase activity has been associated with oncogenic changes in several systems. The Abl protein is a nonreceptor tyrosine kinase, which normally has very little constitutive kinase activity (5) . Both the p210^Bcr-Abl and the p190^Bcr-Abl proteins have constitutively activated tyrosine kinase enzymatic activity, with higher levels of activity in the p190 protein (Tables 6 and 7 ). Interestingly, most of the autophosphorylated tyrosines occur within the Bcr segment of Bcr-Abl (72) . The tyrosine kinase activity is attributable to the kinase domain found within the Abl segment of the fusion proteins (5 , 6 , 8, 9, 10 , 200) . Indeed, it appears that the degree of transforming activity of Bcr-Abl correlates with the degree of tyrosine kinase activity (200) , and this activity has been implicated in the growth factor independence that Bcr-Abl confers on cells (202) . Furthermore, Bcr-Abl induces the tyrosine phosphorylation of many cellular proteins including Crkl, Shc, Syp, Fes, Vav, and paxillin (99 , 100 , 170 , 203, 204, 205, 206, 207, 208) .

Interaction with Ship Proteins.
The Ship proteins (Ship1 and Ship2) are also downstream targets of Bcr-Abl (211, 212, 213, 214, 215) . Ship1 has been shown to regulate hematopoiesis in mice, and disruption of murine Ship results in a myeloproliferative syndrome (216) . p210^Bcr-Abl negatively regulates the expression of Ship1, in part, by reducing its half-life (198) . The Ship proteins have also been found to interact with the adapter proteins Shc and Grb2, which, as discussed above, play a role in Ras-mediated signal transduction pathways (211 , 212 , 214 , 217) . Finally, the Bcr-Abl-specific kinase inhibitor STI 571 (CGP 57148B) causes reexpression of Ship, further supporting the implication that p210^Bcr-Abl directly, but reversibly, regulates Ship expression (198) .

Effect on Adhesion Molecules.
Other substrates of the tyrosine kinase activity of Bcr-Abl include the focal adhesion proteins Fak (focal adhesion kinase) and paxillin (208 , 218) . Clinically, an increased expansion of committed myeloid progenitors and precursors, elevated levels of mature granulocytes, and premature release of the progenitor/precursor cells characterize CML. This is postulated to be attributable to defects in the adhesion properties of these cells, perhaps because of inside-to-outside disruption of focal adhesion molecule function and subsequent perturbation of adhesion molecules such as integrin ß1 (196) . [Normally, hematopoietic cells can attach to extracellular matrix such as fibronectin and stroma via integrins (i.e., 4ß1 and 5ß1), which in turn interacts with cytoskeletal proteins at focal adhesion points (196) .] The salutary effect of IFN- in a subset of CML patients may be attributable to restoration of normal ß1 integrin function (196 , 219 , 220) . In addition, inhibition of either the levels or the kinase activity of Bcr-Abl can restore ß1 integrin-mediated adhesion (221 , 222) . However, other investigators have disputed these results with experiments that demonstrate that expression of Bcr-Abl in certain cell lines leads to increased adhesion of these cells to fibronectin-coated surfaces mediated through expression of 5ß1 integrin (223) . It has also been shown that overexpression of Crkl, the Bcr-Abl substrate, which can act as a mediator between Bcr-Abl and paxillin (224) , increases cell adhesion to fibronectin-coated plates (225) . At least some of these experimental disparities may be attributed to differences in cell type used and/or the use of established cell lines versus bone marrow samples from CML patients.

Effect on Apoptosis.
One proposed mechanism through which the activity of Bcr-Abl is mediated is suppression of apoptosis, or programmed cell death. Hematopoietic growth factors are known to suppress apoptosis, and BCR/ABL can abrogate growth factor dependence in a variety of hematopoietic cell lines (226) . Suppression of apoptosis by Bcr-Abl may be mediated by inducing the expression of the antiapoptotic protein, Bcl-2 (perhaps through Stat pathways), by phosphorylation of the proapoptotic protein Bad or through Ras-dependent pathways (176 , 195 , 227) .

Effect on Stat5.
The growth factor independence demonstrated by Bcr-Abl-positive cells is, to some extent, mediated through constitutive activation of the growth factor-dependent signal transducer and activator of transcription (Stat) proteins, especially Stat5 (182 , 184, 185, 186 , 188 , 228 , 229) . Hematopoiesis is strongly regulated by growth factors and, in myeloid cells, cytokines such as interleukin 3 and granulocyte/macrophage-colony stimulating factor, upon binding to their respective receptors, can elicit the Jak/Stat signaling pathway. [Phosphorylation on its tyrosine residues can activate the Jak protein, and they in turn can activate the Stat proteins also through tyrosine-phosphorylation. Further downstream, activated Stats are then able to increase the transcriptional expression of cell survival genes (230) .] In cells transformed by p210^Bcr-Abl, Bcr-Abl not only constitutively phosphorylates the shared ß_c subunit of the interleukin 3 and granulocyte/macrophage-colony stimulating factor receptor in the absence of ligand but also coimmunoprecipitates with it (183) . Bcr-Abl may also work upstream of the Stat proteins by constitutively phosphorylating, and thus activating, the Jaks, which in turn activate the Stat proteins (183 , 186 , 228) . However, because Bcr-Abl can directly activate the Stat proteins, the need for the Jaks as a mediator could be bypassed (185) .

Although both p210^Bcr-Abl and p190^Bcr-Abl phosphorylate several members of the Stat proteins in BCR-ABL-positive or BCR-ABL-transformed cells and cell lines, Stat5 appears to be the most prominent substrate (182 , 184, 185, 186 , 228) . In addition, phospho-Stat5 is required for the growth factor-independent growth and contributed to the transformation, as well as the antiapoptotic activity, of BCR-ABL cell lines developed from CML patients (186, 187, 188) .

Negative Regulation of Bcr-Abl by Bcr.
Bcr can form heterotetramers with Bcr-Abl through the NH₂-terminal oligomerization domains of the two proteins (76 , 77) . In addition, Bcr binds to SH2 domains of normal Abl and coprecipitates with normal Abl (60) . The result of interaction between Bcr and Bcr-Abl may be functional feedback regulation (71) . Indeed, phosphorylation of the tyrosine 360 of Bcr by Bcr-Abl inhibits the kinase activity of Bcr, whereas serine phosphorylation within the first exon of Bcr inhibits the kinase activity of Abl (71 , 231 , 232) .

	Therapeutic Implications and Future Directions

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

 
Recently, molecules that specifically target the BCR-ABL gene product have been developed. One such molecule that has aroused tremendous interest is the Bcr-Abl-specific kinase inhibitor STI 571 (CGP 57148B). STI 571 is a derivative of 2-phenylaminopyrimidine, a class of inhibitors believed to function by competing with ATP for the ATP-binding site of the kinases (233) . This compound was shown to be a potent inhibitor of oncogenic forms of Abl. It suppresses tumor growth in v-Abl-transformed cells as well as in primary cells from CML patients (233, 234, 235, 236) . In addition, long-term (2–8 weeks) exposure of the CML progenitor cells to STI 571 results in a sustained inhibition of these cells (236) . In addition to its antiproliferative attributes, STI 571 also induces apoptosis in Bcr-Abl-positive cells (235 , 237) . Subsequent studies demonstrated that the apoptotic effect of STI 571 may be mediated by decreased levels of phosphorylated Stat-5 (238 , 239) . This in turn leads to down-regulation of Stat-5-dependent expression of the antiapoptotic protein, Bcl-X_L (238 , 239) . Several investigators are also examining the in vitro effect of STI 571 when used in conjunction with other established therapies for BCR-ABL-positive leukemias (240, 241, 242) . These studies demonstrate, for example, that the combination of STI 571 and IFN- additively inhibited proliferation of CML cells (240 , 241) .

Currently, STI 571 is in early clinical trials aimed at chronic phase CML patients who have failed IFN therapy and at blast crisis patients (243, 244, 245, 246) . Twenty-three of 24 (96%) IFN-refractory chronic phase patients treated with 300–500 mg of STI 571 p.o. on a daily basis attained complete hematological response (243) . Even more striking, many patients had cytogenetic responses, and there was little in the way of side effects. The durability of these responses is not yet clear. Preliminary results of a trial in 234 patients with accelerated phase showed that 78% attained hematological responses at 4 weeks (246) . In addition, 82% of patients with Ph-positive ALL or lymphoid blast crisis have responded. Fifty-five % of the responses were complete, albeit short-lived. Patients with myeloid blast crisis of CML also responded. Indeed, 55% of a group of 33 such patients attained response, with 22% of the responses being complete (244 , 245) . The latter observations are surprising because by definition, blast crisis patients are presumed to have additional molecular defects beyond Bcr-Abl that drive evolution of the disease and growth of the leukemic cells. These findings therefore suggest that inactivation of Bcr-Abl nevertheless interferes with a growth or survival signal in advanced disease. These striking results indicate that gene-targeted therapies have the potential to control malignant cell proliferation without host toxicities.

Another innovative approach is to target BCR-ABL at the RNA level. This can be accomplished by the use of antisense oligonucleotides or of catalytic RNAs called ribozymes (247 , 248) . One requirement for the success of these two strategies is specificity for the target gene. In the case of BCR-ABL, the majority of antisense/ribozyme constructed is targeted toward the junction of BCR-ABL (e.g., b3a2 junction). Theoretically, this would increase the selective binding of the aberrant RNA and lessen the occurrence of nonspecific binding toward normal BCR or ABL RNA. However, the incidence of nonspecific cleavage of other RNAs as well as poor uptake of the nucleotides are some of the problems encountered with these kind of strategies. These difficulties have led to the exploration of modified oligonucleotides and ribozymes (248, 249, 250, 251) , as well as alternative forms of catalytic RNA. This includes the use of M1 RNA (the catalytic RNA subunit of RNase P from Escherichia coli), a ribozyme that can be easily modified to target specific mRNA sequence, through the addition of a guide sequence against a specific site of the target mRNA (e.g., BCR-ABL junction; Ref. 252 ). Targeting BCR-ABL at the RNA level may be best applicable to ex vivo purging of bone marrow cells from patients with CML (253) .

Another potentially unique direction using Bcr fragments as therapy is based on the observation that high levels of Bcr in Bcr-Abl-transformed cells attenuate the kinase activity of Bcr-Abl (254) . In addition, a Bcr peptide fragment containing a mutated (S354 to E354) or phosphorylated serine 354 greatly inhibits the tyrosine kinase activity of both Abl and Bcr-Abl (231 , 255) . Similarly, a peptide containing the Bcr oligomerization domain (amino acids 1–160) has been demonstrated to reverse the transformed phenotype of p210^Bcr-Abl-positive 32D myeloid leukemia cells (58) . On the basis of these results, it has been hypothesized that these peptide fragments, or even a truncated Bcr containing exon 1, could be used as a therapeutic agent for Bcr-Abl-positive leukemias (58 , 71) .

Finally, direct suppression of Bcr-Abl by interference with downstream pathways critical to transformation merits exploration. Because of the interaction between Bcr and G proteins and the crucial role of Ras-dependent pathways in Bcr-Abl-mediated oncogenesis (201 , 209) , Ras is an apt target (256) . Activation of Ras depends on the addition of a prenyl group (generally a farnesyl), which allows it to attach to the cell membrane. Molecules that inhibit farnesyl transferase, one of the key enzymes responsible for this reaction, are now entering clinical trials in CML.

In summary, understanding the molecular genetics of BCR-ABL leukemogenesis is leading rapidly toward molecular targeting as a treatment. Indeed, several vital lessons have been learned from the development of the Bcr-Abl tyrosine kinase inhibitor (257) . These include the importance of identifying molecular targets and the feasibility of using novel drug design technology to discover specific and selective inhibitors, even for enzymes such as kinases that have widespread biological impact. The success of STI 571 in the clinic indicates that this approach can and should be used as a paradigm for applying molecular therapeutics in other cancers.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom requests for reprints should be addressed, at Department of Bioimmunotherapy, Box 422, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: (713) 794-1226; Fax: (713) 745-2374.

² The abbreviations used are: CML, chronic myelogenous leukemia; Ph, Philadelphia; GEF, guanine nucleotide exchange factor; GTPase, guanine triphosphatase; GAP, GTPase activating protein; XPB, xeroderma pigmentosum group B; SH2, Src homology 2; Grb2, growth factor receptor binding protein 2; Bap-1, Bcr-associated protein 1; ALL, acute lymphocytic leukemia; AML, acute myelogenous leukemia; M-bcr, major breakpoint cluster region; Ship, SH2-containing phosphatidylinositol 3,4,5-triphosphate 5-phosphatase; Jak, Janus kinase.

Received 8/ 4/00. Accepted 1/12/01.

	REFERENCES

Top Introduction Genomic Structure of the... Functional Domains of BCR First Exon Central Domain COOH-Terminal Domain Bcr-associated Proteins Structure of the BCR-ABL... Therapeutic Implications and... REFERENCES

 

1. Groffen J., Stephenson J. R., Heisterkamp N., de Klein A., Bartram C. R., Grosveld G. Philadelphia chromosomal breakpoints are clustered within a limited region, bcr, on chromosome 22. Cell, 36: 93-99, 1984.[Medline]
2. Rowley J. D. A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature (Lond.), 243: 290-293, 1973.[Medline]
3. Prakash O., Yunis J. J. High resolution chromosomes of the t(9;22) positive leukemias. Cancer Genet. Cytogenet., 11: 361-367, 1984.[Medline]
4. Heisterkamp N., Stam K., Groffen J., de Klein A., Grosveld G. Structural organization of the BCR gene and its role in the Ph' translocation. Nature (Lond.), 315: 758-761, 1985.[Medline]
5. Konopka J. B., Watanabe S. M., Witte O. N. An alteration of the human c-Abl protein in K562 leukemia cells unmasks associated tyrosine kinase activity. Cell, 37: 1035-1042, 1984.[Medline]
6. Kloetzer W., Kurzrock R., Smith L., Talpaz M., Spiller M., Gutterman J., Arlinghaus R. The human cellular ABL gene product in the chronic myelogenous leukemia cell line K562 has an associated tyrosine protein kinase activity. Virology, 140: 230-238, 1985.[Medline]
7. Ben-Neriah Y., Bernards A., Paskind M., Daley G. Q., Baltimore D. Alternative 5' exons in c-ABL mRNA. Cell, 44: 577-586, 1986.[Medline]
8. Kurzrock R., Kloetzer W. S., Talpaz M., Blick M., Walters R., Arlinghaus R. B., Gutterman J. U. Identification of molecular variants of p210^Bcr-Abl in chronic myelogenous leukemia. Blood, 70: 233-236, 1987.[Abstract/Free Full Text]
9. Kurzrock R., Shtalrid M., Talpaz M., Kloetzer W. S., Gutterman J. U. Expression of c-Abl in Philadelphia-positive acute myelogenous leukemia. Blood, 70: 1584-1588, 1987.[Abstract/Free Full Text]
10. Kurzrock R., Shtalrid M., Romero P., Kloetzer W. S., Talpaz M., Trujillo J. M., Blick M., Beran M., Gutterman J. U. A novel c-Abl protein product in Philadelphia-positive acute lymphoblastic leukaemia. Nature (Lond.), 325: 631-635, 1987.[Medline]
11. Chan L. C., Karhi K. K., Rayter S. I., Heisterkamp N., Eridani S., Powles R., Lawler S. D., Groffen J., Foulkes J. G., Greaves M. F., Wiedemann L. M. A novel Abl protein expressed in Philadelphia chromosome positive acute lymphoblastic leukaemia. Nature (Lond.), 325: 635-637, 1987.[Medline]
12. Hermans A., Heisterkamp N., von Lindern M., van Baal S., Meijer D., van der Plas D., Wiedemann L. M., Groffen J., Bootsma D., Grosveld G. Unique fusion of BCR and c-ABL genes in Philadelphia chromosome positive acute lymphoblastic leukemia. Cell, 51: 33-40, 1987.[Medline]
13. Walker L. C., Ganesan T. S., Dhut S., Gibbons B., Lister T. A., Rothbard J., Young B. D. Novel chimaeric protein expressed in Philadelphia positive acute lymphoblastic leukaemia. Nature (Lond.), 329: 851-853, 1987.[Medline]
14. Kurzrock R., Gutterman J. U., Talpaz M. The molecular genetics of Philadelphia chromosome-positive leukemias. N. Engl. J. Med., 319: 990-998, 1988.[Medline]
15. Shtivelman E., Lifshitz B., Gale R. P., Canaani E. Fused transcript of ABL and BCR genes in chronic myelogenous leukaemia. Nature (Lond.), 315: 550-554, 1985.[Medline]
16. Stam K., Heisterkamp N., Grosveld G., de Klein A., Verma R. S., Coleman M., Dosik H., Groffen J. Evidence of a new chimeric BCR/c-ABL mRNA in patients with chronic myelocytic leukemia and the Philadelphia chromosome. N. Engl. J. Med., 313: 1429-1433, 1985.[Abstract]
17. Dhut S., Dorey E. L., Horton M. A., Ganesan T. S., Young B. D. Identification of two normal BCR gene products in the cytoplasm. Oncogene, 3: 561-566, 1988.[Medline]
18. Konopka J. B., Witte O. N. Detection of c-Abl tyrosine kinase activity in vitro permits direct comparison of normal and altered ABL gene products. Mol. Cell. Biol., 5: 3116-3123, 1985.[Abstract/Free Full Text]
19. Shtivelman E., Lifshitz B., Gale R. P., Roe B. A., Canaani E. Alternative splicing of RNAs transcribed from the human ABL gene and from the BCR-ABL fused gene. Cell, 47: 277-284, 1986.[Medline]
20. Gale R. P., Canaani E. An 8-kilobase ABL RNA transcript in chronic myelogenous leukemia. Proc. Natl. Acad. Sci. USA, 81: 5648-5652, 1984.[Abstract/Free Full Text]
21. Melo J. V., Gordon D. E., Cross N. C. P., Goldman J. M. The ABL-BCR fusion gene is expressed in chronic myeloid leukemia. Blood, 81: 158-165, 1993.[Abstract/Free Full Text]
22. Kurzrock R., Shtalrid M., Gutterman J. U., Koller C. A., Walters R., Trujillo J. M., Talpaz M. Molecular analysis of chromosome 22 breakpoints in adult Philadelphia-positive acute lymphoblastic leukaemia. Br. J. Haematol., 67: 55-59, 1987.[Medline]
23. Melo J. V. The diversity of Bcr-Abl fusion proteins and their relationship to leukemia phenotype. Blood, 88: 2375-2384, 1996.[Free Full Text]
24. Saglio G., Guerrasio A., Rosso C., Zaccaria A., Tassinari A., Serra A., Rege-Cambrin G., Mazza U., Gavosto F. New type of BCR/ABL junction in Philadelphia chromosome-positive chronic myelogenous leukemia. Blood, 76: 1819-1824, 1990.[Abstract/Free Full Text]
25. Stam K., Heisterkamp N., Reynolds F. H., Jr., Groffen J. Evidence that the PHL gene encodes a 160,000-dalton phosphoprotein with associated kinase activity. Mol. Cell. Biol., 7: 1955-1960, 1987.[Abstract/Free Full Text]
26. Heisterkamp N., Knoppel E., Groffen J. The first BCR gene intron contains breakpoints in Philadelphia chromosome positive leukemia. Nucleic Acids Res., 16: 10069-10081, 1988.[Abstract/Free Full Text]
27. Nowell P. C., Hungerford D. A. A minute chromosome in human chronic granulocytic leukemia. Science (Washington DC), 132: 1197 1960.
28. Romero P., Beran M., Shtalrid M., Andersson B., Talpaz M., Blick M. Alternative 5' end of the BCR-ABL transcript in chronic myelogenous leukemia. Oncogene, 4: 93-98, 1989.[Medline]
29. National Center for Biotechnology Information. Entrez Nucleotide Query. http://www.ncbi.nlm.nih.gov/Entrez/, 1999.
30. Amson R. B., Marcelle C., Telerman A. Identification of a 130Kda BCR related gene product. Oncogene, 4: 243-247, 1989.[Medline]
31. Hariharan I. K., Adams J. M. cDNA sequence for human BCR, the gene that translocates to the ABL oncogene in chronic myeloid leukaemia. EMBO J., 6: 115-119, 1987.[Medline]
32. Collins S., Coleman H., Groudine M. Expression of BCR and BCR-ABL fusion transcripts in normal and leukemic cells. Mol. Cell. Biol., 7: 2870-2876, 1987.[Abstract/Free Full Text]
33. Wetzler M., Talpaz M., Van Etten R. A., Hirsh-Ginsberg C., Beran M., Kurzrock R. Subcellular localization of Bcr, Abl, and Bcr-Abl proteins in normal and leukemic cells and correlation of expression with myeloid differentiation. J. Clin. Investig., 92: 1925-1939, 1993.
34. Croce C. M., Huebner K., Isobe M., Fainstain E., Lifshitz B., Shtivelman E., Canaani E. Mapping of four distinct BCR-related loci to chromosome region 22q11: order of BCR loci relative to chronic myelogenous leukemia and acute lymphoblastic leukemia breakpoints. Proc. Natl. Acad. Sci. USA, 84: 7174-7178, 1987.[Abstract/Free Full Text]
35. Heisterkamp N., Morris C., Groffen J. ABR, an active BCR-related gene. Nucleic Acids Res., 17: 8821-8831, 1989.[Abstract/Free Full Text]
36. Lifshitz B., Fainstein E., Marcelle C., Shtivelman E., Amson R., Gale R. P., Canaani E. BCR genes and transcripts. Oncogene, 2: 113-117, 1988.[Medline]
37. Marcelle C., Gale R. P., Prokocimer M., Berrebi A., Merle-Beral H., Canaani E. Analysis of BCR-ABL mRNA in chronic myelogenous leukemia patients and identification of a new BCR-related sequence in human DNA. Genes Chromosomes Cancer, 1: 172-179, 1989.[Medline]
38. DiSilvestre D., Morris C., Heisterkamp N., Groffen J. A hypervariable RFLP within the ABR gene. Nucleic Acids Res., 18: 5924 1990.[Free Full Text]
39. Tan E-C., Leung T., Manser E., Lim L. The human active breakpoint cluster region-related gene encodes a brain protein with homology to guanine nucleotide exchange proteins and GTPase-activating proteins. J. Biol. Chem., 268: 27291-27298, 1993.[Abstract/Free Full Text]
40. Muller A. J., Witte O. N. The 5' noncoding region of the human leukemia-associated oncogene BCR/ABL is a potent inhibitor of in vitro translation. Mol. Cell. Biol., 9: 5234-5238, 1989.[Abstract/Free Full Text]
41. Zhu Q-S., Heisterkamp H., Groffen J. Unique organization of the human BCR gene promoter. Nucleic Acids Res., 18: 7119-7125, 1990.[Abstract/Free Full Text]
42. Shah N. P., Witte O. N., Denny C. T. Characterization of the BCR promoter in Philadelphia chromosome-positive and -negative cell lines. Mol. Cell. Biol., 11: 1854-1860, 1991.[Abstract/Free Full Text]
43. Watson J. D., Hopkins N. H., Roberts J. W., Steitz J. A., Weiner A. M. The functioning of higher eucaryotic genes Ed. 4 Gillen J. R. eds. . Molecular Biology of the Gene, : 676-744, Benjamin/Cummings Menlo Park, California 1988.
44. Li W., Dreazen O., Kloetzer W., Gale R. P., Arlinghaus R. B. Characterization of BCR gene products in hematopoietic cells. Oncogene, 4: 127-138, 1989.[Medline]
45. Heisterkamp N., Kaartinen V., van Soest S., Bokoch G. M., Groffen J. Human ABR encodes a protein with GAP^Rac activity and homology to the DBL nucleotide exchange factor domain. J. Biol. Chem., 268: 16903-16906, 1993.[Abstract/Free Full Text]
46. Chuang T-H., Xu X., Kaartinen V., Heisterkamp N., Groffen J., Bokoch G. M. Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein family. Proc. Natl. Acad. Sci. USA, 92: 10282-10286, 1995.[Abstract/Free Full Text]
47. Dhut S., Chaplin T., Young B. D. Bcr-Abl and Bcr proteins. Biochemical characterization and localization. Leukemia (Baltimore), 4: 745-750, 1990.[Medline]
48. Arlinghaus R. B. Multiple BCR-related gene products and their proposed involvement in ligand-induced signal transduction pathways. Mol. Carcinog., 5: 171-173, 1992.[Medline]
49. Wetzler M., Talpaz M., Yee G., Stass S. A., Van Etten R. A., Andreeff M., Goodacre A. M., Kleine H-D., Mahadevia R. K., Kurzrock R. Cell cycle-related shifts in subcellular localization of Bcr: association with mitotic chromosomes and with heterochromatin. Proc. Natl. Acad. Sci. USA, 92: 3488-3492, 1995.[Abstract/Free Full Text]
50. Laurent E., Talpaz M., Wetzler M., Kurzrock R. Cytoplasmic and nuclear localization of the 130 and 160 kDa Bcr proteins. Leukemia (Baltimore), 14: 1892-1897, 2000.[Medline]
51. Takeda N., Shibuya M., Maru Y. The Bcr-Abl oncoprotein potentially interacts with the xeroderma pigmentosum group B protein. Proc. Natl. Acad. Sci. USA, 96: 203-207, 1999.[Abstract/Free Full Text]
52. Maru Y., Kobayashi T., Tanaka K., Shibuya M. Bcr binds to the xeroderma pigmentosum group B protein. Biochem. Biophys. Res. Commun., 260: 309-312, 1999.[Medline]
53. Frit P., Bergmann E., Egly J-M. Transcription factor IIH: a key player in the cellular response to DNA damage. Biochimie, 81: 27-38, 1999.[Medline]
54. Maru Y., Witte O. N. The BCR gene encodes a novel serine/threonine kinase activity within a single exon. Cell, 67: 459-468, 1991.[Medline]
55. Reuther G. W., Fu H., Cripe L. D., Collier R. J., Pendergast A-M. Association of the protein kinases c-Bcr and Bcr-Abl with proteins of the 14-3-3 family. Science (Washington DC), 266: 129-133, 1994.[Abstract/Free Full Text]
56. Braselmann S., McCormick F. Bcr and Raf form a complex in vivo via 14-3-3 proteins. EMBO J., 14: 4839-4848, 1995.[Medline]
57. McWhirter J. R., Galasso D. L., Wang J. Y. J. A coiled-coil oligomerization domain of Bcr is essential for the transforming function of Bcr-Abl oncoproteins. Mol. Cell. Biol., 13: 7587-7595, 1993.[Abstract/Free Full Text]
58. Guo X. Y. D., Cuillerot J-M., Wang T., Wu Y., Arlinghaus R., Claxton D., Bachier C., Greenberger J., Colombowala I., Deisseroth A. B. Peptide containing the BCR oligomerization domain (AA 1–160) reverses the transformed phenotype of p210^Bcr-Abl positive 32D myeloid leukemia cells. Oncogene, 17: 825-833, 1998.[Medline]
59. Pendergast A-M., Quilliam L. A., Cripe L. D., Bassing C. H., Dai Z., Li N., Batzer A., Rabun K. M., Der C. J., Schlessinger J., Gishizky M. L. BCR-ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of the Grb-2 adaptor protein. Cell, 75: 175-185, 1993.[Medline]
60. Pendergast A-M., Muller A. J., Havlik M. H., Maru Y., Witte O. N. Bcr sequences essential for transformation by the BCR-ABL oncogene bind to the Abl SH2 regulatory domain in a nonphosphotyrosine-dependent manner. Cell, 66: 161-171, 1991.[Medline]
61. Muller A. J., Pendergast A-M., Havlik M. H., Puil L., Pawson T., Witte O. N. A limited set of SH2 domains binds Bcr through a high-affinity phosphotyrosine-independent interaction. Mol. Cell. Biol., 12: 5087-5093, 1992.[Abstract/Free Full Text]
62. Stewart M. J., Cox G., Reifel-Miller A., Kim S. Y., Westbrook C. A., Leibowitz D. S. A novel transcriptional suppressor located within a downstream intron of the BCR gene. J. Biol. Chem., 269: 10820-10829, 1994.[Abstract/Free Full Text]
63. Ron D., Zannini N., Levis M., Wickner R. B., Hunt L. T., Graziani G., Tronick S. R., Aaronson S. A., Eva A. A region of proto-dbl essential for its transforming activity shows sequence similarity to a yeast cell cycle gene CDC24, and the human breakpoint cluster gene, BCR. New Biol., 3: 372-379, 1991.[Medline]
64. Adams J. M., Houston H., Allen J., Lints T., Harvey R. The hematopoietically expressed VAV proto-oncogene shares homology with the DBL GDP-GTP exchange factor, the BCR gene, and a yeast gene (CDC24) involved in cytoskeletal organization. Oncogene, 7: 611-618, 1992.[Medline]
65. Diekmann D., Brill S., Garrett M. D., Totty N., Hsuan J., Monfries C., Hall C., Lim L., Hall A. BCR encodes a GTPase-activating protein for p21^Rac. Nature (Lond.), 351: 400-402, 1991.[Medline]
66. Voncken J. W., van Schaick H., Kaartinen V., Deemer K., Coates T., Landing B., Pattengale P., Dorseuil O., Bokoch G. M., Groffen J., Heisterkamp N. Increased neutrophil respiratory burst in BCR-null mutants. Cell, 80: 719-728, 1995.[Medline]
67. Cicchetti P., Mayer B. J., Thiel G., Baltimore D. Identification of a protein that binds to the SH3 region of Abl and is similar to Bcr and GAP-rho. Science (Washington DC), 257: 803-806, 1992.[Abstract/Free Full Text]
68. Hart M. J., Eva A., Evans T., Aaronson S. A., Cerione R. A. Catalysis of guanine nucleotide exchange on the Cdc42Hs protein by the DBL oncogene product. Nature (Lond.), 354: 311-314, 1991.[Medline]
69. Muller A. J., Young J. C., Pendergast A-M., Pondel M., Landau N. R., Littman D. R., Witte O. N. BCR first exon sequences specifically activate the BCR/ABL tyrosine kinase oncogene of Philadelphia chromosome-positive human leukemias. Mol. Cell. Biol., 11: 1785-1792, 1991.[Abstract/Free Full Text]
70. McWhirter J. R., Wang J. Y. J. Activation of tyrosine kinase and microfilament-binding functions of c-Abl by Bcr sequences in Bcr/Abl fusion proteins. Mol. Cell. Biol., 11: 1553-1565, 1991.[Abstract/Free Full Text]
71. Arlinghaus R. B. The involvement of Bcr in leukemias with the Philadelphia chromosome. Crit. Rev. Oncog., 9: 1-18, 1998.[Medline]
72. Liu J., Campbell M., Guo J. Q., Lu D., Xian Y. M., Andersson B. S., Arlinghaus R. B. BCR-ABL tyrosine kinase is autophosphorylated or transphosphorylates p160 Bcr on tyrosine predominantly within the first Bcr exon. Oncogene, 8: 101-109, 1992.
73. Sadowski I., Stone J. C., Pawson T. A noncatalytic domain conserved among cytoplasmic protein-tyrosine kinases modifies the kinase function and transforming activity of Fujinami sarcoma virus p130^Gag-Fps. Mol. Cell. Biol., 6: 4396-4408, 1986.[Abstract/Free Full Text]
74. Koch C. A., Anderson D., Moran M. F., Ellis C., Pawson T. SH2 and SH3 domains: elements that control interactions of cytoplasmic signaling proteins. Science (Washington DC), 252: 668-674, 1991.[Abstract/Free Full Text]
75. Margolis B. Proteins with SH2 domains: transducers in the tyrosine kinase signaling pathway. Cell Growth Differ., 3: 73-80, 1992.[Medline]
76. Pendergast A-M., Clark R., Kawasaki E. S., McCormick F. P., Witte O. N. Baculovirus expression of functional p210 BCR-ABL oncogene product. Oncogene, 4: 759-766, 1989.[Medline]
77. Campbell M. L., Li W., Arlinghaus R. B. p210 Bcr-Abl is complexed to p160 Bcr and Ph-p53 proteins in K562 cells. Oncogene, 5: 773-776, 1990.[Medline]
78. Okuda K., Golub T. R., Gilliland D. G., Griffin J. D. p210 BCR/ABL, p190 BCR/ABL, and TEL/ABL activate similar signal transduction pathways in hematopoietic cell lines. Oncogene, 13: 1147-1152, 1996.[Medline]
79. van Etten R. A., Jackson P., Baltimore D. The mouse type IV c-ABL gene product is a nuclear protein, and activation of transforming ability is associated with cytoplasmic localization. Cell, 58: 669-678, 1989.[Medline]
80. Kipreos E. T., Wang J. Y. J. Cell cycle-regulated binding of c-Abl tyrosine kinase to DNA. Science (Washington DC), 256: 382-385, 1992.[Abstract/Free Full Text]
81. Heisterkamp N., Groffen J., Stephenson J. R., Spurr N. K., Goodfellow P. N., Solomon E., Carritt B., Bodmer W. F. Chromosomal localization of human cellular homologues of two viral oncogenes. Nature (Lond.), 299: 747-749, 1982.[Medline]
82. Bernards A., Rubin C. M., Westbrook C. A., Paskind M., Baltimore D. The first intron in the human c-ABL gene is at least 200 kilobases long and is a target for translocations in chronic myelogenous leukemia. Mol. Cell. Biol., 7: 3231-3236, 1987.[Abstract/Free Full Text]
83. Dhut S., Chaplin T., Young B. D. Normal c-ABL gene protein-a nuclear component. Oncogene, 6: 1459-1464, 1991.[Medline]
84. Kharbanda S., Pandey P., Morris P. L., Whang Y., Xu Y., Sawant S., Zhu L-J., Kumar N., Yuan Z-M., Weichselbaum R., Sawyers C. L., Pandita T. K., Kufe D. Functional role for the c-Abl tyrosine kinase in meiosis I. Oncogene, 16: 1773-1777, 1998.[Medline]
85. David-Cordonnier M-H., Hamdane M., Bailly C., D’Halluin J-C. Determination of the human c-Abl consensus DNA binding site. FEBS Lett., 424: 177-182, 1998.[Medline]
86. David-Cordonnier M-H., Hamdane M., Bailly C., D’Halluin J-C. The DNA binding domain of the human c-Abl tyrosine kinase preferentially binds to DNA sequences containing an AAC motif and to distorted DNA structures. Biochemistry, 37: 6065-6076, 1998.[Medline]
87. Franz W. M., Berger P., Wang J. Y. J. Deletion of an N-terminal regulatory domain of the c-Abl tyrosine kinase activates its oncogenic potential. EMBO J., 8: 137-147, 1989.[Medline]
88. Jackson P., Baltimore D. N-terminal mutations activate the leukemogenic potential of the myristylated form of c-Abl. EMBO J., 8: 449-456, 1989.[Medline]
89. Barila D., Superti-Furga G. An intramolecular SH3-domain interaction regulates c-Abl activity. Nat. Genet., 18: 280-282, 1998.[Medline]
90. Welch P. J., Wang J. Y. J. A c-terminal protein-binding domain in the retinoblastoma protein regulates nuclear c-Abl tyrosine kinase in the cell cycle. Cell, 75: 779-790, 1993.[Medline]
91. Goga A., Liu X., Hambuch T. M., Senechal K., Major E., Berk A. J., Witte O. N., Sawyers C. L. p53 dependent growth suppression by the c-Abl nuclear tyrosine kinase. Oncogene, 11: 791-799, 1995.[Medline]
92. Afar D. E. H., McLaughlin J., Sherr C. J., Witte O. N., Roussel M. F. Signaling by ABL oncogenes through cyclin D1. Proc. Natl. Acad. Sci. USA, 92: 9540-9544, 1995.[Abstract/Free Full Text]
93. Shafman T., Khanna K. K., Kedar P., Spring K., Kozlov S., Yen T., Hobson K., Gatei M., Zhang N., Watters D., Egerton M., Shiloh Y., Kharbanda S., Kufe D., Lavin M. F. Interaction between Atm protein and c-Abl in response to DNA damage. Nature (Lond.), 387: 520-523, 1997.[Medline]
94. Baskaran R., Wood L. D., Whitaker L. L., Canman C. E., Morgan S. E., Xu Y., Barlow C., Baltimore D., Wynshaw-Boris A., Kastan M. B., Wang J. Y. J. Ataxia telangiectasia mutant protein activates c-Abl tyrosine kinase in response to ionizing radiation. Nature (Lond.), 387: 516-519, 1997.[Medline]
95. Agami R., Blandino G., Oren M., Shaul Y. Interaction of c-Abl and p73 and their collaboration to induce apoptosis. Nature (Lond.), 399: 809-813, 1999.[Medline]
96. Yuan Z. M., Shioya H., Ishiko T., Sun X., Gu J., Huang Y. Y., Lu H., Kharbanda S., Weichselbaum R., Kufe D. p73 is regulated by tyrosine kinase c-Abl in the apoptotic response to DNA damage. Nature (Lond.), 399: 814-817, 1999.[Medline]
97. Gong J. G., Costanzo A., Yang H-Q., Melino G., Kaelin W. G., Jr., Levrero M., Wang J. Y. The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature (Lond.), 399: 806-809, 1999.[Medline]
98. Kipreos E. T., Wang J. Y. J. Differential phosphorylation of c-Abl in cell cycle determined by Cdc2 kinase and phosphatase activity. Science (Washington DC), 248: 217-220, 1990.[Abstract/Free Full Text]
99. Nichols G. L., Raines M. A., Vera J. C., Lacomis L., Tempst P., Golde P. W. Identification of Crkl as the constitutively phosphorylated 39-kD tyrosine phosphoprotein in chronic myelogenous leukemia cells. Blood, 84: 2912-2918, 1994.[Abstract/Free Full Text]
100. Oda T., Heaney C., Hagopian J. R., Okuda K., Griffin J. D., Druker B. J. Crkl is the major tyrosine-phosphorylated protein in neutrophils from patients with chronic myelogenous leukemia. J. Biol. Chem., 269: 22925-22928, 1994.[Abstract/Free Full Text]
101. Sawyers C. L., McLaughlin J., Goga A., Havlik M., Witte O. N. The nuclear tyrosine kinase c-Abl negatively regulates cell growth. Cell, 77: 121-131, 1994.[Medline]
102. Dai Z., Pendergast A-M. Abi-2, a novel SH3-containing protein interacts with the c-Abl tyrosine kinase and modulates c-Abl transforming activity. Genes Dev., 9: 2569-2582, 1995.[Abstract/Free Full Text]
103. Dai Z., Quackenbush R. C., Courtney K. D., Grove M., Cortez D., Reuther G. W., Pendergast A. M. Oncogenic Abl and Src tyrosine kinases elicit the ubiquitin-dependent degradation of target proteins through a Ras-independent pathway. Genes Dev., 12: 1415-1424, 1998.[Abstract/Free Full Text]
104. Shi Y., Alin K., Goff S. P. Abl-interactor-1, a novel SH3 protein binding to the carboxy-terminal portion of the Abl protein, suppresses v-Abl transforming activity. Genes Dev., 9: 2583-2597, 1995.[Abstract/Free Full Text]
105. Juang J-L., Hoffmann F. M. Drosophila Abelson interacting protein (dAbi) is a positive regulator of Abelson tyrosine kinase activity. Oncogene, 18: 5138-5147, 1999.[Medline]
106. McWhirter J. R., Wang J. Y. J. An actin-binding function contributes to transformation by the Bcr-Abl oncoprotein of Philadelphia chromosome-positive human leukemias. EMBO J., 12: 1533-1546, 1993.[Medline]
107. Gibbs J. B., Schaber M. D., Garsky V. M., Vogel U. S., Scolnick E. M., Dixon R. A. F., Marshall M. S. Structure/function relationships of Ras and guanosine triphosphatase-activating protein Nathanson N. M. Harden T. K. eds. . G proteins and Signal Transduction: Society of General Physiologists, 43rd Annual Symposium, : 77-85, Rockefeller University Press New York 1990.
108. van Aelst L., D’Souza-Schorey C. Rho GTPases and signaling networks. Genes Dev., 11: 2295-2322, 1997.[Free Full Text]
109. Cen H., Papageorge A. G., Zippel R., Lowy D. R., Zhang K. Isolation of multiple mouse cDNAs with coding homology to Saccharomyces cerevisiae CDC25: identification of a region related to BCR, VAV, DBL, and CDC24. EMBO J., 11: 4007-4015, 1992.[Medline]
110. Sloat B. F., Adams A., Pringle J. R. Roles of the CDC24 gene product in cellular morphogenesis during the Saccharomyces cerevisiae cell cycle. J. Cell Biol., 89: 395-405, 1981.[Abstract/Free Full Text]
111. Chant J., Pringle J. R. Budding and cell polarity in Saccharomyces cerevisiae. Curr. Opin. Genet. Dev., 1: 342-350, 1991.[Medline]
112. Ziman M., O’Brien J. M., Ouellette L. A., Church W. R., Johnson D. I. Mutational analysis of CDC42Sc, a Sacchromyces cerevisiae gene that encodes a putative GTP-binding protein involved in the control of cell polarity. Mol. Cell. Biol., 11: 3537-3544, 1991.[Abstract/Free Full Text]
113. Johnson D. I., Pringle J. R. Molecular characterization of CDC42, a Sacchromyces cerevisiae gene involved in the development of cell polarity. J. Cell Biol., 111: 143-152, 1990.[Abstract/Free Full Text]
114. Ziman M., Johnson D. I. Genetic evidence for a functional interaction between Saccharomyces cerevisiae CDC24 and CDC42. Yeast, 10: 463-474, 1994.[Medline]
115. Hall A. The cellular functions of small GTP-binding proteins. Science (Washington DC), 249: 635-640, 1990.[Abstract/Free Full Text]
116. Hall A. Ras-related proteins. Curr. Opin. Cell Biol., 5: 265-268, 1993.[Medline]
117. Ridley A. J., Hall A. The small GTP-binding protein Rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell, 70: 389-399, 1992.[Medline]
118. Lancaster C. A., Taylor-Harris P. M., Self A. J., Brill S., van Erp H. E., Hall A. Characterization of RhoGAP. A GTPase-activating protein for Rho-related small GTPases. J. Biol. Chem., 269: 1137-1142, 1994.[Abstract/Free Full Text]
119. Hall C., Monfries C., Smith P., Lim H. H., Kozma R., Ahmed S., Vanniasingham V., Leung T., Lim L. Novel human brain cDNA encoding a 34,000 M_r protein n-chimaerin, related to both the regulatory domain of protein kinase C and Bcr, the product of the breakpoint cluster region gene. J. Mol. Biol., 211: 11-16, 1990.[Medline]
120. Aitken A. 14-3-3 proteins on the MAP. Trends Biochem. Sci., 20: 95-97, 1995.[Medline]
121. Ford J. C., Al-Khodairy F., Fotou E., Sheldrick K. S., Griffiths D. J. F., Carr A. M. 14-3-3 protein homologs required for the DNA damage checkpoint in fission yeast. Science (Washington DC), 265: 533-535, 1994.[Abstract/Free Full Text]
122. Lopez-Girona A., Furnari B., Mondesert O., Russell P. Nuclear localization of Cdc25 is regulated by DNA damage and a 14-3-3 protein. Nature (Lond.), 397: 172-175, 1999.[Medline]
123. Muslin A. J., Tanner J. W., Allen P. M., Shaw A. S. Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell, 84: 889-897, 1996.[Medline]
124. Jones D. H., Ley S., Aitken A. Isoforms of 14-3-3 protein can form homo- and heterodimers in vivo and in vitro: implications for function as adapter proteins. FEBS Lett., 368: 55-58, 1995.[Medline]
125. Catovsky D., Pittman S., O’Brien M., Cherchi M., Costello C., Foa R., Pearce E., Hoffbrand A. V., Janossy G., Ganeshaguru K., Greaves M. F. Multiparameter studies in lymphoid leukemias. Am. J. Clin. Pathol., 72: 736-745, 1979.[Medline]
126. Collins S. J. Breakpoints on chromosome 9 and 22 in Philadelphia chromosome-positive chronic myelogenous leukemia (CML). J. Clin. Investig., 78: 1392-1396, 1986.
127. Schaefer-Rego K., Dudek H., Popenoe D., Arlin Z., Mears J. G., Bank A., Leibowitz D. CML patients in blast crisis have breakpoints localized to a specific region of the BCR. Blood, 70: 448-455, 1987.[Abstract/Free Full Text]
128. Boehm T. L., Drahovsky D. Application of a BCR-specific probe in the classification of human leukaemia. J. Cancer Res. Clin. Oncol., 113: 267-272, 1987.[Medline]
129. Benn P., Soper L., Eisenberg A., Silver R. T., Coleman M., Cacciapaglia B., Bennett L., Baird M., Silverstein M., Berger C., Bernhardt B. Utility of molecular genetic analysis of BCR rearrangement in the diagnosis of chronic myeloid leukemia. Cancer Genet. Cytogenet., 29: 1-7, 1987.[Medline]
130. Selleri L., Narni F., Emilia G., Colo A., Zucchini P., Venturelli D., Donelli A., Torelli U., Torelli G. Philadelphia-positive chronic myeloid leukemia with a chromosome 22 breakpoint outside the breakpoint cluster region. Blood, 70: 1659-1664, 1987.[Abstract/Free Full Text]
131. Hirosawa S., Aoki N., Shibuya M., Onozawa Y. Breakpoints in Philadelphia chromosome (Ph¹)-positive leukemias. Jpn. J. Cancer Res., 78: 590-595, 1987.[Medline]
132. Shtalrid M., Talpaz M., Kurzrock R., Kantarjian H., Trujillo J., Gutterman J., Yoffe G., Blick M. Analysis of breakpoints within the BCR gene and their correlation with the clinical course of Philadelphia-positive chronic myelogenous leukemia. Blood, 72: 485-490, 1988.[Abstract/Free Full Text]
133. Clark S. S., McLaughlin J., Crist W. M., Champlin R., Witte O. N. Unique forms of the Abl tyrosine kinase distinguish Ph¹-positive CML from Ph¹-positive ALL. Science (Washington DC), 235: 85-88, 1987.[Abstract/Free Full Text]
134. Rodenhuis S., Smets L. A., Slater R. M., Behrendt H., Veerman A. J. P. Distinguishing the Philadelphia chromosome of acute lymphoblastic leukemia from its counterpart in chronic myelogenous leukemia. N. Engl. J. Med., 313: 51-52, 1985.[Medline]
135. Erikson J., Griffin C. A., ar-Rushdi A., Valtieri M., Hoxie J., Finan J., Emanuel B. S., Rovera G., Nowell P. C., Croce C. M. Heterogeneity of chromosome 22 breakpoint in Philadelphia-positive (Ph+) acute lymphocytic leukemia. Proc. Natl. Acad. Sci. USA, 83: 1807-1811, 1986.[Abstract/Free Full Text]
136. de Klein A., Hagemeijer A., Bartram C. R., Houwen R., Hoefsloot L., Carbonell F., Chan L., Barnett M., Greaves M., Kleihauer E., Heisterkamp N., Groffen J., Grosveld G. BCR rearrangement and translocation of the c-ABL oncogene in Philadelphia positive acute lymphoblastic leukemia. Blood, 68: 1369-1375, 1986.[Abstract/Free Full Text]
137. Okabe M., Matsushima S., Morioka M., Kobayashi M., Abe S., Sakurada K., Kakinuma M., Miyazaki T. Establishment and characterization of a cell line, TOM-1, derived from a patient with Philadelphia chromosome-positive acute lymphocytic leukemia. Blood, 69: 990-998, 1987.[Abstract/Free Full Text]
138. Fainstein E., Marcelle C., Rosner A., Canaani E., Gale R. P., Dreazen O., Smith S. D., Croce C. M. A new fused transcript in Philadelphia chromosome positive acute lymphocytic leukaemia. Nature (Lond.), 330: 386-388, 1987.[Medline]
139. ar-Rushdi A., Negrini M., Kurzrock R., Huebner K., Croce C. M. Fusion of the BCR and the c-ABL genes in Ph'-positive acute lymphocytic leukemia with no rearrangement in the breakpoint cluster region. Oncogene, 2: 353-357, 1988.[Medline]
140. Saglio G., Guerrasio A., Tassinari A., Ponzetto C., Zaccaria A., Testoni P., Celso B., Rege-Cambrin G., Serra A., Pegoraro L., Avanzi G. C., Attadia V., Falda M., Gavosto F. Variability of the molecular defects corresponding to the presence of a Philadelphia chromosome in human hematologic malignancies. Blood, 72: 1203-1208, 1988.[Abstract/Free Full Text]
141. Chen S. J., Chen Z., Font M-P., d’Auriol L., Larsen C-J., Berger R. Structural alterations of the BCR and ABL genes in Ph1 positive acute leukemias with rearrangements in the BCR gene first intron: further evidence implicating Alu sequences in the chromosome translocation. Nucleic Acids Res., 17: 7631-7642, 1989.[Abstract/Free Full Text]
142. Popenoe D. W., Schaefer-Rego K., Mears J. G., Bank A., Leibowitz D. Frequent and extensive deletion during the 9,22 translocation in CML. Blood, 68: 1123-1128, 1986.[Abstract/Free Full Text]
143. Dhingra K., Talpaz M., Kantarjian H., Ku S., Rothberg J., Gutterman J. U., Kurzrock R. Appearance of acute leukemia-associated p190^Bcr-Abl in chronic myelogenous leukemia may correlate with disease progression. Leukemia (Baltimore), 5: 191-195, 1991.[Medline]
144. de Klein A., van Kessel A. G., Grosveld G., Bartram C. R., Hagemeijer A., Bootsma D., Spurr N. K., Heisterkamp N., Groffen J., Stephenson J. R. A cellular oncogene is translocated to the Philadelphia chromosome in chronic myelocytic leukaemia. Nature (Lond.), 300: 765-767, 1982.[Medline]
145. Heisterkamp N., Stephenson J. R., Groffen J., Hansen P. F., de Klein A., Bartram C. R., Grosveld G. Localization of the c-ABL oncogene adjacent to a translocation break point in chronic myelocytic leukaemia. Nature (Lond.), 306: 239-242, 1983.[Medline]
146. Leibowitz D., Schaefer-Rego K., Popenoe D. W., Mears G., Bank A. Variable breakpoints on the Philadelphia chromosome in chronic myelogenous leukemia. Blood, 66: 243-245, 1985.[Abstract/Free Full Text]
147. Papadopoulos P. C., Greenstein A. M., Gaffney R. A., Westbrook C. A., Wiedemann L. M. Characterization of the translocation breakpoint sequences in Philadelphia-positive acute lymphoblastic leukemia. Genes Chromosomes Cancer, 1: 233-239, 1990.[Medline]
148. Zhang J. G., Goldman J. M., Cross N. C. Characterization of genomic BCR-ABL breakpoints in chronic myeloid leukaemia by PCR. Br. J. Haematol., 90: 138-146, 1995.[Medline]
149. Chissoe S. L., Bodenteich A., Wang Y-F., Wang Y-P., Burian D., Clifton S. W., Crabtree J., Freeman A., Iyer K., Jian L., Ma Y., McLaury H-J., Pan H-Q., Sarhan O. H., Toth S., Wang Z., Zhang G., Heisterkamp N., Groffen J., Roe B. A. Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation. Genomics, 27: 67-82, 1995.[Medline]
150. Jeffs A. R., Benjes S. M., Smith T. L., Sowerby S. J., Morris C. M. The BCR gene recombines preferentially with Alu elements in complex BCR-ABL translocations of chronic myeloid leukaemia. Hum. Mol. Genet., 7: 767-776, 1998.[Abstract/Free Full Text]
151. Biernaux C., Loos M., Sels A., Huez G., Stryckmans P. Detection of major BCR-ABL gene expression at a very low level in blood cells of some healthy individuals. Blood, 86: 3118-3122, 1995.[Abstract/Free Full Text]
152. Bose S., Deininger M., Gora-Tybor J., Goldman J. M., Melo J. V. The presence of typical and atypical BCR-ABL fusion genes in leukocytes of normal individuals: biologic significance and implications for the assessment of minimal residual disease. Blood, 92: 3362-3367, 1998.[Abstract/Free Full Text]
153. Kozubek S., Lukasova E., Ryznar L., Kozubek M., Liskova A., Govorun R. D., Krasavin E. A., Horneck G. Distribution of ABL and BCR genes in cell nuclei of normal and irradiated lymphocytes. Blood, 89: 4537-4545, 1997.[Abstract/Free Full Text]
154. Neves H., Ramos C., da Silva M. G., Parreira A., Parriera L. The nuclear topography of ABL, BCR, PML, and RAR genes: evidence for gene proximity in specific phases of the cell cycle and stages of hematopoietic differentiation. Blood, 93: 1197-1207, 1999.[Abstract/Free Full Text]
155. Anastasi J., Moinuddin R., Daugherty C. The juxtaposition of ABL with BCR and risk for fusion may come at a time of BCR replication in late S-phase. Blood, 94: 1137-1145, 1999.[Free Full Text]
156. Wada H., Mizutani S., Nishimura J., Usuki Y., Kohsaki M., Komai M., Kaneko H., Sakamoto S., Delia D., Kanamaru A., Kakishita E. Establishment and molecular characterization of a novel leukemic cell line with Philadelphia chromosome expressing p230 Bcr/Abl fusion protein. Cancer Res., 55: 3192-3196, 1995.[Abstract/Free Full Text]
157. Pane F., Frigeri F., Sindona M., Luciano L., Ferrara F., Cimino R., Meloni G., Saglio G., Salvatore F., Rotoli B. Neutrophilic-chronic myeloid leukemia: a distinct disease with a specific molecular marker (BCR-ABL with c3a2 junction). Blood, 88: 2410-2414, 1996.[Abstract/Free Full Text]
158. Emilia G., Luppi M., Marasca R., Torelli G. Relationship between Bcr/Abl fusion proteins and leukemia phenotype. Blood, 89: 3889 1997.[Free Full Text]
159. Mittre H., Leymarie P., Macro M., Leporrier M. A new case of chronic myeloid leukemia with c3/a2 BCR/ABL junction. Is it really a distinct disease?. Blood, 89: 4239-4241, 1997.[Abstract/Free Full Text]
160. Briz M., Vilches C., Cabrera R., Forès R., Fernández M. N. Typical chronic myelogenous leukemia with e19a2 junction BCR/ABL transcript. Blood, 90: 5024-5025, 1997.[Free Full Text]
161. Haskovec C., Ponzetto C., Polak J., Maritano D., Zemanova Z., Serra A., Michalova K., Klamova H., Cermak J., Saglio G. p230 Bcr/Abl protein may be associated with an acute leukaemia phenotype. Br. J. Haematol., 103: 1104-1108, 1998.[Medline]
162. Inukai T., Sugita K., Suzuki T., Ijima K., Goi K., Tezuka T., Kojika S., Hatakeyama K., Kagami K., Mori T., Okazaki T., Mizutani S., Nakazawa S. A novel 203 kD aberrant BCR-ABL product in a girl with Philadelphia chromosome positive acute lymphoblastic leukaemia. Br. J. Haematol., 85: 823-825, 1993.[Medline]
163. Hochhaus A., Reiter A., Skladny H., Melo J. V., Sick C., Berger U., Guo J. Q., Arlinghaus R. B., Hehlmann R., Goldman J. M., Cross N. C. P. A novel BCR-ABL fusion gene (e6a2) in a patient with Philadelphia chromosome-negative chronic myelogenous leukemia. Blood, 88: 2236-2240, 1996.[Abstract/Free Full Text]
164. Byrne J. L., Carter G. I., Davies J. M., Haynes A. P., Russell N. H., Cross N. C. P. A novel BCR-ABL fusion gene (e2/1a) in a patient with Philadelphia-positive chronic myelogenous leukaemia and an aggressive clinical course. Br. J. Haematol., 103: 791-794, 1998.[Medline]
165. How G. F., Lim L. C., Kulkarni S., Tan L. T., Tan P., Cross N. C. P. Two patients with novel BCR/ABL fusion transcripts (e8/a2 and e13/a2) resulting from translocation breakpoints within BCR exons. Br. J. Haematol., 105: 434-436, 1999.[Medline]
166. Lichty B. D., Keating A., Callum J., Yee K., Croxford R., Corpus G., Nwachukwu B., Kim P., Guo J., Kamel-Reid S. Expression of p210 and p190 BCR-ABL due to alternative splicing in chronic myelogenous leukaemia. Br. J. Haematol., 103: 711-715, 1998.[Medline]
167. Skourides P. A., Perera S. A., Ren R. Polarized distribution of Bcr-Abl in migrating myeloid cells and co-localization of Bcr-Abl and its target proteins. Oncogene, 18: 1165-1176, 1999.[Medline]
168. Druker B., Okuda K., Matulonis U., Salgia R., Roberts T., Griffin J. D. Tyrosine phosphorylation of rasGAP and associated proteins in chronic myelogenous leukemia cell lines. Blood, 79: 2215-2220, 1992.[Abstract/Free Full Text]
169. Simon M. A., Dodson G. S., Rubin G. M. An SH3-SH2-SH3 protein is required for p21^Ras1 activation and binds to Sevenless and Sos protein in vitro. Cell, 73: 169-177, 1993.[Medline]
170. Tauchi T., Boswell H. S., Leibowitz D., Broxmeyer H. E. Coupling between p210^Bcr-Abl and Shc and Grb2 adaptor proteins in hematopoietic cells permits growth factor receptor-independent link to Ras activation pathway. J. Exp. Med., 179: 167-175, 1994.[Abstract/Free Full Text]
171. Wisniewski D., Strife A., Wojciechowicz D., Lambek C., Clarkson B. A 62-kilodalton tyrosine phosphoprotein constitutively present in primary chronic phase chronic myelogenous leukemia enriched lineage negative blast populations. Leukemia (Baltimore), 8: 688-693, 1994.[Medline]
172. Carpino N., Wisniewski D., Strife A., Marshak D., Kobayashi R., Stillman B., Clarkson B. p62^Dok. A constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells. Cell, 88: 197-204, 1997.[Medline]
173. Yamanashi Y., Baltimore D. Identification of the Abl- and RasGAP-associated 62 kDa protein as a docking protein, Dok. Cell, 88: 205-211, 1997.[Medline]
174. Bhat A., Johnson K. J., Oda T., Corbin A. S., Druker B. J. Interactions of p62^Dok with p210^Bcr-Abl and Bcr-Abl-associated proteins. J. Biol. Chem., 273: 32360-32368, 1998.[Abstract/Free Full Text]
175. Bedi A., Barber J. P., Bedi G. C., El-Deiry W. S., Sidransky D., Vala M. S., Akhtar A. J., Hilton J., Jones R. J. BCR-ABL-mediated inhibition of apoptosis with delay of G2/M transition after DNA damage: a mechanism of resistance to multiple anticancer agents. Blood, 86: 1148-1158, 1995.[Abstract/Free Full Text]
176. Sanchez-Garcia I., Grutz G. Tumorigenic activity of the BCR-ABL oncogenes is mediated by BCL2. Proc. Natl. Acad. Sci. USA, 92: 5287-5291, 1995.[Abstract/Free Full Text]
177. McGahon A., Bissonnette R., Schmitt M., Cotter K. M., Green D. R., Cotter T. G. BCR-ABL maintains resistance of chronic myelogenous leukemia cells to apoptotic cell death. Blood, 83: 1179-1187, 1994.[Abstract/Free Full Text]
178. McGahon A. J., Nishioka W. K., Martin S. J., Mahboubi A., Cotter T. G., Green D. R. Regulation of the Fas apoptotic cell death pathway by Abl. J. Biol. Chem., 270: 22625-22631, 1995.[Abstract/Free Full Text]
179. Amarante-Mendes G. P., Kim C. N., Liu L., Huang Y., Perkins C. L., Green D. R., Bhalla K. Bcr-Abl exerts its anti-apoptotic effect against diverse apoptotic stimuli through blockage of mitochondrial release of cytochrome c and activation of caspase-3. Blood, 91: 1700-1705, 1998.[Abstract/Free Full Text]
180. Dubrez L., Eymin B., Sordet O., Droin N., Turhan A. G., Solary E. Bcr-Abl delays apoptosis upstream of procaspase-3 activation. Blood, 91: 2415-2422, 1998.[Abstract/Free Full Text]
181. Reuther J. Y., Reuther G. W., Cortez D., Pendergast A-M., Baldwin A. S., Jr. A requirement for NF-B activation in Bcr-Abl-mediated transformation. Genes Dev., 12: 968-981, 1998.[Abstract/Free Full Text]
182. Carlesso N., Frank D. A., Griffin J. D. Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (Stat) proteins in hematopoietic cell lines transformed by Bcr/Abl. J. Exp. Med., 183: 811-820, 1996.[Abstract/Free Full Text]
183. Wilson-Rawls J., Xie S., Liu J., Laneuville P., Arlinghaus R. B. p210 Bcr-Abl interacts with the interleukin 3 receptor ß_c subunit and constitutively induces its tyrosine phosphorylation. Cancer Res., 56: 3426-3430, 1996.[Abstract/Free Full Text]
184. Frank D. A., Varticovski L. Bcr/Abl leads to the constitutive activation of Stat proteins, and shares an epitope with tyrosine phosphorylated Stats. Leukemia (Baltimore), 10: 1724-1730, 1996.[Medline]
185. Ilaria R. L., van Etten R. A. p210 and p190^Bcr/Abl induce the tyrosine phosphorylation and DNA binding activity of multiple specific STAT family members. J. Biol. Chem., 271: 31704-31710, 1996.[Abstract/Free Full Text]
186. Shuai K., Halpern J., ten Hoeve J., Rao X., Sawyers C. L. Constitutive activation of Stat5 by the BCR-ABL oncogene in chronic myelogenous leukemia. Oncogene, 13: 247-254, 1996.[Medline]
187. Nieborowska-Skorska M., Wasik M. A., Slupianek A., Salomoni P., Kitamura T., Calabretta B., Skorski T. Signal transducer and activator of transcription (Stat)5 activation by BCR/ABL is dependent on intact Src homology (SH)3 and SH2 domains of BCR/ABL and is required for leukemogenesis. J. Exp. Med., 189: 1229-1242, 1999.[Abstract/Free Full Text]
188. de Groot R. P., Raaijmakers J. A. M., Lammers J-W. J., Jove R., Koenderman L. Stat5 activation by Bcr-Abl contributes to transformation of K562 leukemia cells. Blood, 94: 1108-1112, 1999.[Abstract/Free Full Text]
189. Varticovski L., Daley G. Q., Jackson P., Baltimore D., Cantley L. C. Activation of phosphatidylinositol 3-kinase in cells expressing ABL oncogene variants. Mol. Cell. Biol., 11: 1107-1113, 1991.[Abstract/Free Full Text]
190. Skorski T., Kanakaraj P., Nieborowska-Skorska M., Ratajczak M. Z., Wen S-C., Zon G., Gewirtz A. M., Perussia B., Calabretta B. Phosphatidylinositol-3 kinase activity is regulated by BCR/ABL and is required for the growth of Philadelphia chromosome-positive cells. Blood, 86: 726-736, 1995.[Abstract/Free Full Text]
191. Sattler M., Salgia R., Okuda K., Uemura N., Durstin M. A., Pisick E., Xu G., Li J-L., Prasad K. V., Griffin J. D. The proto-oncogene product p120^Cbl and the adaptor proteins Crkl and c-Crk link c-Abl, p190^Bcr/Abl, and p210^Bcr/Abl to the phosphatidylinositol-3' kinase pathway. Oncogene, 12: 839-846, 1996.[Medline]
192. Skorski T., Bellacosa A., Nieborowska-Skorska M., Majewski M., Martinez R., Choi J. K., Trotta R., Wlodarski P., Perrotti D., Chan T. O., Wasik M. A., Tsichlis P. N., Calabretta B. Transformation of hematopoietic cells by BCR/ABL requires the activation of a PI-3k/Akt-dependent pathway. EMBO J., 16: 6151-6161, 1997.[Medline]
193. Raitano A. B., Halpern J. R., Hambuch T. M., Sawyers C. L. The Bcr-Abl leukemia oncogene activates Jun kinase and requires Jun for transformation. Proc. Natl. Acad. Sci. USA, 92: 11746-11750, 1995.[Abstract/Free Full Text]
194. Puil L., Liu J., Gish G., Mbamalu G., Bowtell D., Pelicci P. G., Arlinghaus R., Pawson T. Bcr-Abl oncoproteins bind directly to activators of the Ras signalling pathway. EMBO J., 13: 764-773, 1994.[Medline]
195. Cortez D., Stoica G., Pierce J. H., Pendergast A-M. The Bcr-Abl tyrosine kinase inhibits apoptosis by activating a Ras-dependent signaling pathway. Oncogene, 13: 2589-2594, 1996.[Medline]
196. Verfaillie C. M., Hurley R., Lundell B. I., Zhao C., Bhatia R. Integrin-mediated regulation of hematopoiesis: do Bcr/Abl-induced defects in integrin function underlie the abnormal circulation and proliferation of CML progenitors?. Acta Haematol., 97: 40-52, 1997.[Medline]
197. Bhatia R., Munthe H. A., Verfaillie C. M. Role of abnormal integrin-cytoskeletal interactions in impaired ß1 integrin function in chronic myelogenous leukemia hematopoietic progenitors. Exp. Hematol., 27: 1384-1396, 1999.[Medline]
198. Sattler M., Verma S., Byrne C. H., Shrikhande G., Winkler T., Algate P. A., Rohrschneider L. R., Griffin J. D. Bcr/Abl directly inhibits expression of Ship, an SH2-containing polyinositol-5-phosphatase involved in the regulation of hematopoiesis. Mol. Cell. Biol., 19: 7473-7480, 1999.[Abstract/Free Full Text]
199. van der Feltz M. J. M., Shivji M. K. K., Grosveld G., Wiedmann L. M. Characterization of the translocation breakpoint in a patient with Philadelphia positive, BCR negative acute lymphoblastic leukaemia. Oncogene, 3: 215-219, 1988.[Medline]
200. Lugo T. G., Pendergast A-M., Muller A. J., Witte O. N. Tyrosine kinase activity and transformation potency of BCR-ABL oncogene products. Science (Washington DC), 247: 1079-1082, 1990.[Abstract/Free Full Text]
201. Sawyers C. L., McLaughlin J., Witte O. N. Genetic requirement for Ras in the transformation of fibroblasts and hematopoietic cells by the BCR-ABL oncogene. J. Exp. Med., 181: 307-313, 1995.[Abstract/Free Full Text]
202. Anderson S. M., Mladenovic J. The BCR-ABL oncogene requires both kinase activity and src-homology 2 domain to induce cytokine secretion. Blood, 87: 238-244, 1996.[Abstract/Free Full Text]
203. ten Hoeve J., Arlinghaus R. B., Guo J. Q., Heisterkamp N., Groffen J. Tyrosine phosphorylation of Crkl in Philadelphia⁺ leukemia. Blood, 84: 1731-1736, 1994.[Abstract/Free Full Text]
204. Ernst T. J., Slattery K. E., Griffin J. D. p210^Bcr/Abl and p160^v-Abl induce an increase in the tyrosine phosphorylation of p93^c-Fes. J. Biol. Chem., 269: 5764-5769, 1994.[Abstract/Free Full Text]
205. Tauchi T., Feng G-S., Shen R., Song H. Y., Donner D., Pawson T., Broxmeyer H. E. SH2-containing phosphotyrosine phosphatase Syp is a target of p210^Bcr-Abl tyrosine kinase. J. Biol. Chem., 269: 15381-15387, 1994.[Abstract/Free Full Text]
206. Matsuguchi T., Salgia R., Hallek M., Eder M., Druker B., Ernst T. J., Griffin J. D. Shc phosphorylation in myeloid cells is regulated by granulocyte macrophage colony-stimulating factor, interleukin-3, and Steel factor and is constitutively increased by p210^Bcr/Abl. J. Biol. Chem., 269: 5016-5021, 1994.[Abstract/Free Full Text]
207. Matsuguchi T., Inhorn R. C., Carlesso N., Xu G., Druker B., Griffin J. D. Tyrosine phosphorylation of p95^Vav in myeloid cells is regulated by GM-CSF, IL-3, and Steel factor and is constitutively increased by p210^Bcr/Abl. EMBO J., 14: 257-265, 1995.[Medline]
208. Salgia R., Li J-L., Lo S. H., Brunkhorst B., Kansas G. S., Sobhany E. S., Sun Y., Pisick E., Hallek M., Ernst T., Tantravahi R., Chen L. B., Griffin J. D. Molecular cloning of human paxillin, a focal adhesion protein phosphorylated by p210^Bcr/Abl. J. Biol. Chem., 270: 5039-5047, 1995.[Abstract/Free Full Text]
209. Mandanas R. A., Leibowitz D. S., Gharehbaghi K., Tauchi T., Burgess G. S., Miyazawa K., Jayaram H. N., Boswell H. S. Role of p21 Ras in p210 Bcr-Abl transformation of murine myeloid cells. Blood, 82: 1838-1847, 1993.[Abstract/Free Full Text]
210. Tauchi T., Okabe S., Miyazawa K., Ohyashiki K. The tetramerization domain-independent Ras activation by Bcr-Abl oncoprotein in hematopoietic cells. Int. J. Oncol., 12: 1269-1276, 1998.[Medline]
211. Damen J. E., Liu L., Rosten P., Humphries R. K., Jefferson A. B., Majerus P. W., Krystal G. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5-phosphatase. Proc. Natl. Acad. Sci. USA, 93: 1689-1693, 1996.[Abstract/Free Full Text]
212. Lioubin M. N., Algate P. A., Tsai S., Carlberg K., Aebersold R., Rohrschneider L. R. p150^Ship, a signal transduction molecule with inositol polyphosphate-5-phosphatase activity. Genes Dev., 10: 1084-1095, 1996.[Abstract/Free Full Text]
213. Kavanaugh W. M., Pot D. A., Chin S. M., Deuter-Reinhard M., Jefferson A. B., Norris F. A., Masiarz F. R., Cousens L. S., Majerus P. W., Williams L. T. Multiple forms of an inositol polyphosphate 5-phosphatase form signaling complexes with Shc and Grb2. Curr. Biol., 6: 438-445, 1996.[Medline]
214. Odai H., Sasaki K., Iwamatsu A., Nakamoto T., Ueno H., Yamagata T., Mitani K., Yazaki Y., Hirai H. Purification and molecular cloning of SH2- and SH3-containing inositol polyphosphate-5-phosphatase, which is involved in the signaling pathway of granulocyte-macrophage colony-stimulating factor, erythropoietin, and Bcr-Abl. Blood, 89: 2745-2756, 1997.[Abstract/Free Full Text]
215. Pesesse X., Deleu S., de Smedt F., Drayer L., Erneux C. Identification of a second SH2-domain-containing protein closely related to the phosphatidylinositol polyphosphate 5-phosphatase SHIP. Biochem. Biophys. Res. Commun., 239: 697-700, 1997.[Medline]
216. Helgason C. D., Damen J. E., Rosten P., Grewal R., Sorensen P., Chappel S. M., Borowski A., Jirik F., Krystal G., Humphries R. K. Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev., 12: 1610-1620, 1998.[Abstract/Free Full Text]
217. Wisniewski D., Strife A., Swendeman S., Erdjument-Bromage H., Geromanos S., Kavanaugh W. M., Tempst P., Clarkson B. A novel SH2-containing phosphatidylinositol 3,4,5-triphosphate 5-phosphatase (Ship2) is constitutively tyrosine phosphorylated and associated with Src homologous and collagen gene (SHC) in chronic myelogenous leukemia progenitor cells. Blood, 93: 2707-2720, 1999.[Abstract/Free Full Text]
218. Gotoh A., Miyazawa K., Ohyashiki K., Tauchi T., Boswell H. S., Broxmeyer H. E., Toyama K. Tyrosine phosphorylation and activation of focal adhesion kinase (p125^Fak) by Bcr-Abl oncoprotein. Exp. Hematol., 23: 1153-1159, 1995.[Medline]
219. Bhatia R., Wayner E. A., McGlave P. B., Verfaillie C. M. Interferon- restores normal adhesion of chronic myelogenous leukemia hematopoietic progenitors to bone marrow stroma by correcting impaired ß1 integrin receptor function. J. Clin. Investig., 94: 384-391, 1994.
220. Bhatia R., McCarthy J. B., Verfaillie C. M. Interferon- restores normal ß1 integrin-mediated inhibition of hematopoietic progenitor proliferation by the marrow microenvironment in chronic myelogenous leukemia. Blood, 87: 3883-3891, 1996.[Abstract/Free Full Text]
221. Bhatia R., Verfaillie C. M. Inhibition of Bcr-Abl expression with antisense oligodeoxynucleotides restores ß1 integrin-mediated adhesion and proliferation inhibition in chronic myelogenous leukemia hematopoietic progenitors. Blood, 91: 3414-3422, 1998.[Abstract/Free Full Text]
222. Bhatia R., Munthe H. A., Verfaillie C. M. Tyrphostin AG957, a tyrosine kinase inhibitor with anti-Bcr/Abl tyrosine kinase activity restores ß1 integrin-mediated adhesion and inhibitory signaling in chronic myelogenous leukemia hematopoietic progenitors. Leukemia (Baltimore), 12: 1708-1717, 1998.[Medline]
223. Kramer A., Horner S., Willer A., Fruehauf S., Hochhaus A., Hallek M., Hehlmann R. Adhesion to fibronectin stimulates proliferation of wild-type and BCR/ABL-transfected murine hematopoietic cells. Proc. Natl. Acad. Sci. USA, 96: 2087-2092, 1999.[Abstract/Free Full Text]
224. Salgia R., Uemura N., Okuda K., Li J-L., Pisick E., Sattler M., de Jong R., Druker B., Heisterkamp N., Chen L. B., Groffen J., Griffin J. D. CRKL links p210^BCR/ABL with paxillin in chronic myelogenous leukemia cells. J. Biol. Chem., 270: 29145-29150, 1995.[Abstract/Free Full Text]
225. Uemura N., Salgia R., Ewaniuk D. S., Little M-T., Griffin J. D. Involvement of the adapter protein Crkl in integrin-mediated adhesion. Oncogene, 18: 3343-3353, 1999.[Medline]
226. Chung S-W., Daniel R., Wong B. Y., Wong P. M. C. The ABL genes in normal and abnormal cell development. Crit. Rev. Oncog., 7: 33-48, 1996.[Medline]
227. Sanchez-Garcia I., Martin-Zanca D. Regulation of BCL-2 gene expression by Bcr-Abl is mediated by Ras. J. Mol. Biol., 267: 225-228, 1997.[Medline]
228. Chai S. K., Nichols G. L., Rothman P. Constitutive activation of JAKs and Stats in BCR-ABL-expressing cell lines and peripheral blood cells derived from leukemic patients. J. Immunol., 159: 4720-4728, 1997.[Abstract]
229. Ahmed M., Dusanter-Fourt I., Bernard M., Mayeux P., Hawley R. G., Bennardo T., Novault S., Bonnet M. L., Gisselbrecht S., Varet B., Turhan A. G. BCR-ABL and constitutively active erythropoietin receptor (cEpoR) activate distinct mechanisms for growth factor-independence and inhibition of apoptosis in Ba/F3 cell line. Oncogene, 16: 489-496, 1998.[Medline]
230. Darnell J. E., Jr. STATs and gene regulation. Science (Washington DC), 277: 1630-1635, 1997.[Abstract/Free Full Text]
231. Liu J., Wu Y., Arlinghaus R. B. Sequences within the first exon of BCR inhibit the activated tyrosine kinase of c-Abl and the Bcr-Abl oncoprotein. Cancer Res., 56: 5120-5124, 1996.[Abstract/Free Full Text]
232. Liu J., Wu Y., Ma G. Z., Lu D., Haataja L., Heisterkamp N., Groffen J., Arlinghaus R. B. Inhibition of Bcr serine kinase by tyrosine phosphorylation. Mol. Cell. Biol., 16: 998-1005, 1996.[Abstract]
233. Buchdunger E., Zimmermann J., Mett H., Meyer T., Muller M., Druker B. J., Lydon N. B. Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative. Cancer Res., 56: 100-104, 1996.[Abstract/Free Full Text]
234. Druker B. J., Tamura S., Buchdunger E., Ohno S., Segal G. M., Fanning S., Zimmermann J., Lydon N. B. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat. Med., 2: 561-566, 1996.[Medline]
235. Beran M., Cao X., Estrov Z., Jeha S., Jin G., O’Brien S., Talpaz M., Arlinghaus R. B., Lydon N. B., Kantarjian H. Selective inhibition of cell proliferation and Bcr-Abl phosphorylation in acute lymphoblastic leukemia cells expressing M_r 190,000 Bcr-Abl protein by a tyrosine kinase inhibitor (CGP-57148). Clin. Cancer Res., 4: 1661-1672, 1998.[Abstract]
236. Kasper B., Fruehauf S., Schiedlmeier B., Buchdunger E., Ho A. D., Zeller W. J. Favorable therapeutic index of a p210(Bcr-Abl)-specific tyrosine kinase inhibitor; activity on lineage-committed and primitive chronic myelogenous leukemia progenitors. Cancer Chemother. Pharmacol., 44: 433-438, 1999.[Medline]
237. Dan S., Naito M., Tsuruo T. Selective induction of apoptosis in Philadelphia chromosome-positive chronic myelogenous leukemia cells by an inhibitor of Bcr-Abl tyrosine kinase, CGP 57148. Cell Death Differ., 5: 710-715, 1998.[Medline]
238. Prosper F., Horita M., Andreu E. J., Benito A., Arbona C., Sanz C., Benet I., Fernandez-Luna J. L. Blockade of the Bcr-Abl kinase activity induces apoptosis of CML cells by suppressing STAT5 dependent expression of BCL-X_L. Blood, 94 (Suppl. 1): 102a 1999.
239. Donato N. J., Wu J. Y., Kantarjian H. M., Talpaz M. Inhibition of Bcr-Abl induces apoptosis through effects on downstream signaling cascades: death through abrogation of survival signals. Blood, 94 (Suppl. 1): 102a 1999.
240. Thiesing J. T., Ohno-Jones S., Kolibaba K. S., Druker B. J. Efficacy of an Abl tyrosine kinase inhibitor in conjunction with other antineoplastic agents against BCR-ABL positive cells. Blood, 94 (Suppl. 1): 100a 1999.
241. Barteneva N., Stiouf I., Donato N., Kornblau S., Van N., Domain D., Talpaz M. Altered interferon- responsiveness in K562 cells pretreated with Abl-tyrosine kinase inhibitor CGP57148B. Blood, 94 (Suppl. 1): 272b 1999.
242. Topaly J., Zeller W. J., Ho A. D., Fruehauf S. Combination therapy of chronic myelogenous leukemia employing Bcr/Abl specific tyrosine kinase inhibition. Blood, 94 (Suppl. 1): 281b 1999.
243. Druker B. J., Talpaz M., Resta D., Peng B., Buchdunger E., Ford J., Sawyers C. L. Clinical efficacy and safety of an Abl specific tyrosine kinase inhibitor as targeted therapy for chronic myelogenous leukemia. Blood, 94 (Suppl. 1): 368a 1999.
244. Druker B. J., Kantarjian H., Sawyers C. L., Resta D., Reese S. F., Ford J., Talpaz M. Activity of an Abl specific tyrosine kinase inhibitor in patients with BCR-ABL positive acute leukemias, including chronic myelogenous leukemia in blast crisis. Blood, 94 (Suppl. 1): 697a 1999.
245. Talpaz M., Sawyers C. L., Kantarjian H., Resta D., Reese S. F., Ford J., Druker B. J. Activity of an Abl specific tyrosine kinase inhibitor in patients with BCR-ABL positive acute leukemias, including chronic myelogenous leukemia in blast crisis. Proc. Am. Soc. Clin. Oncol., 19: 4a 2000.
246. Talpaz M., Silver R. T., Druker B., Paquette R., Goldman J. M., Reese S. F., Capdeville R. A Phase II study of STI 571 in adult patients with Philadelphia chromosome positive chronic myeloid leukemia in accelerated phase. Blood, 96 (Vol. 11, Part 1): 487a 2000.
247. James H. A., Gibson I. The therapeutic potential of ribozymes. Blood, 91: 371-382, 1998.[Abstract/Free Full Text]
248. Galderisi U., Cascino A., Giordano A. Antisense oligonucleotides as therapeutic agents. J. Cell. Physiol., 181: 251-257, 1999.[Medline]
249. Kuwabara T., Warashina M., Tanabe T., Tani K., Asano S., Taira K. A novel allosterically trans-activated ribozyme, the maxizyme, with exceptional specificity in vitro and in vivo. Mol. Cell, 2: 617-627, 1998.[Medline]
250. Warashina M., Kuwabara T., Nakamatsu Y., Taira K. Extremely high and specific activity of DNA enzymes in cells with a Philadelphia chromosome. Chem. Biol., 5: 237-250, 1999.
251. Wu Y., Yu L., McMahon R., Rossi J. J., Forman S. J., Snyder D. S. Inhibition of BCR-ABL oncogene expression by novel deoxyribozymes (DNAzymes). Hum. Gene Ther., 10: 2847-2857, 1999.[Medline]
252. Cobaleda C., Sanchez-Garcia I. In vivo inhibition by a site-specific catalytic RNA subunit of Rnase P designed against the BCR-ABL oncogenic products: a novel approach for cancer treatment. Blood, 95: 731-737, 2000.[Abstract/Free Full Text]
253. Kronenwett R., Haas R. Specific BCR-ABL-directed antisense nucleic acids and ribozymes: a tool for the treatment of chronic myelogenous leukemia?. Recent Results Cancer Res., 144: 127-138, 1998.[Medline]
254. Wu Y., Ma G., Lu D., Lin F., Xu H. J., Liu J., Arlinghaus R. B. Bcr: a negative regulator of the Bcr-Abl oncoprotein. Oncogene, 18: 4416-4424, 1999.[Medline]
255. Liu J., Hawk N., Lin F., Arlinghaus R. Phosphoserine peptides from the serine-rich B box of the Bcr first exon inhibit the Abl and Bcr-Abl kinases. Blood, 94 (Suppl. 1): A453 1999.
256. Beaupre D. M., Kurzrock R. RAS and leukemia: from basic mechanisms to gene-directed therapy. J. Clin. Oncol., 17: 1071-1079, 1999.[Abstract/Free Full Text]
257. Druker B. J., Lydon N. B. Lessons learned from the development of an Abl tyrosine kinase inhibitor for chronic myelogenous leukemia. J. Clin. Investig., 105: 3-7, 2000.[Medline]

This article has been cited by other articles:

				E. J. Andreu, E. Lledo, E. Poch, C. Ivorra, M. P. Albero, J. A. Martinez-Climent, C. Montiel-Duarte, J. Rifon, J. Perez-Calvo, C. Arbona, et al. BCR-ABL Induces the Expression of Skp2 through the PI3K Pathway to Promote p27Kip1 Degradation and Proliferation of Chronic Myelogenous Leukemia Cells Cancer Res., April 15, 2005; 65(8): 3264 - 3272. [Abstract] [Full Text] [PDF]

				R. Nimmanapalli, P. Bali, E. O'Bryan, L. Fuino, F. Guo, J. Wu, P. Houghton, and K. Bhalla Arsenic Trioxide Inhibits Translation of mRNA of bcr-abl, Resulting in Attenuation of Bcr-Abl Levels and Apoptosis of Human Leukemia Cells Cancer Res., November 15, 2003; 63(22): 7950 - 7958. [Abstract] [Full Text] [PDF]

				E. Laurent, D. L. Mitchell, Z. Estrov, M. Lowery, S. L. Tucker, M. Talpaz, and R. Kurzrock Impact of p210Bcr-Abl on Ultraviolet C Wavelength-induced DNA Damage and Repair Clin. Cancer Res., September 1, 2003; 9(10): 3722 - 3730. [Abstract] [Full Text] [PDF]

				R. Kurzrock, H. M. Kantarjian, B. J. Druker, and M. Talpaz Philadelphia Chromosome-Positive Leukemias: From Basic Mechanisms to Molecular Therapeutics Ann Intern Med, May 20, 2003; 138(10): 819 - 830. [Abstract] [Full Text] [PDF]

				A. Schmidt and A. Hall Guanine nucleotide exchange factors for Rho GTPases: turning on the switch Genes & Dev., July 1, 2002; 16(13): 1587 - 1609. [Full Text] [PDF]

				M. H. Cohen, G. Williams, J. R. Johnson, J. Duan, J. Gobburu, A. Rahman, K. Benson, J. Leighton, S. K. Kim, R. Wood, et al. Approval Summary for Imatinib Mesylate Capsules in the Treatment of Chronic Myelogenous Leukemia Clin. Cancer Res., May 1, 2002; 8(5): 935 - 942. [Abstract] [Full Text] [PDF]

				B. M. F. Mow, J. Chandra, P. A. Svingen, C. G. Hallgren, E. Weisberg, T. J. Kottke, V. L. Narayanan, M. R. Litzow, J. D. Griffin, E. A. Sausville, et al. Effects of the Bcr/abl kinase inhibitors STI571 and adaphostin (NSC 680410) on chronic myelogenous leukemia cells in vitro Blood, January 15, 2002; 99(2): 664 - 671. [Abstract] [Full Text] [PDF]

				C. Yu, G. Krystal, L. Varticovksi, R. McKinstry, M. Rahmani, P. Dent, and S. Grant Pharmacologic Mitogen-activated Protein/Extracellular Signal-regulated Kinase Kinase/Mitogen-activated Protein Kinase Inhibitors Interact Synergistically with STI571 to Induce Apoptosis in Bcr/Abl-expressing Human Leukemia Cells Cancer Res., January 1, 2002; 62(1): 188 - 199. [Abstract] [Full Text] [PDF]

This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Laurent, E. Articles by Kurzrock, R. Search for Related Content PubMed PubMed Citation Articles by Laurent, E. Articles by Kurzrock, R.