Cancer Research Annual Meeting 2010 Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernard, D.
Right arrow Articles by Abbadie, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernard, D.
Right arrow Articles by Abbadie, C.
[Cancer Research 61, 2656-2664, March 15, 2001]
© 2001 American Association for Cancer Research

Molecular Biology and Genetics

Antiproliferative and Antiapoptotic Effects of cRel May Occur within the Same Cells via the Up-Regulation of Manganese Superoxide Dismutase1

David Bernard, Brigitte Quatannens, Agnes Begue, Bernard Vandenbunder and Corinne Abbadie2

EP 560 [D. B., B. V., C. A.] and UMR 8526 [B. Q., A. B.], Centre National de la Recherche Scientifique/Institut Pasteur de Lille/Université Lille 2, Institut de Biologie de Lille, 59021 Lille Cedex, France


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Rel/nuclear factor {kappa}B transcription factors were shown to have either pro- or antiapoptotic as well as pro- or antiproliferative functions, and it is often assumed that the outcome of their activation depends on the cell type or cellular context. Inconsistent with this assumption, we show here that cRel is able in one cell type to inhibit proliferation, protect against apoptosis induced by tumor necrosis factor {alpha} (TNF-{alpha}) + cycloheximide (CHX), and increase the basal rate of apoptosis. Both the effects of proliferation inhibition and protection against TNF-{alpha} + CHX-induced apoptosis are massive and occur in the same cells. Using reverse transcription-PCR, Western blot and immunofluorescence, and transactivation assays, we found that the manganese superoxide dismutase (MnSOD), an enzyme that converts O-2 in H2O2, is up-regulated by cRel through a {kappa}B site in intron 2. Inhibition of MnSOD induction by antisense oligonucleotides and overexpression of MnSOD respectively reverts and mimics both the antiproliferative and antiapoptotic effects of cRel, suggesting that they both occur via the induction of this gene. On one hand, MnSOD could improve the efficiency of cRel-overexpressing cells in eliminating toxic O-2 produced on TNF-{alpha} treatment, explaining why they escape TNF-{alpha}-induced apoptosis. On the other hand, cRel-overexpressing cells should accumulate H2O2. We present evidence linking this H2O2 accumulation to the proliferation arrest induced by cRel. Therefore, different effects on proliferation and apoptosis could arise from the induction of MnSOD and thus coexist in cRel-overexpressing cells.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transcription factors of the Rel/NF-{kappa}B3 family have several characteristics that enable them to participate in the control of the basic processes of proliferation, differentiation, and apoptosis. They are ubiquitously expressed, a wide range of stimuli converge on their activation, and their target genes are numerous and varied (1 , 2) . The Rel/NF-{kappa}B family comprises RelA (or p65), RelB, NF-{kappa}B1 (or p105/p50), NF-{kappa}B2 (or p100/p52), and cRel in vertebrates. In most cell types, Rel/NF-{kappa}B factors exist in the cytoplasm, sequestered by an inhibitory protein of the I{kappa}B family that masks their nuclear localization sequence. On stimulation by agents such as cytokines, I{kappa}B is phosphorylated by the I{kappa}B kinase IKK1 or IKK2, ubiquitinated, and degraded by the proteasome. Free Rel/NF-{kappa}B factors then enter the nucleus and trigger the expression of many target genes (3) .

Numerous studies have assigned to Rel/NF-{kappa}B the function of protecting cells from apoptosis. RelA-/- mouse embryos die at embryonic day 15 of gestation by apoptotic degeneration of the liver (4) due to an enhanced sensitivity to TNF-{alpha} toxicity (5) . Similarly, IKK2-/- mouse embryos, which cannot activate Rel/NF-{kappa}B, die at embryonic day 13 because of massive TNF-{alpha}-induced apoptosis in the liver (6) . In human fibrosarcoma cells, constitutive inhibition of Rel/NF-{kappa}B factors by an I{kappa}B{alpha} superrepressor increases the sensitivity to apoptosis induced by TNF-{alpha}, ionizing radiation, or daunorubicin (7 , 8) . In HeLa cells, overexpression of RelA or cRel protects against apoptosis induced by TNF-{alpha} or Fas ligand (9 , 10) . In murine B cells, Rel/NF-{kappa}B factors were shown to protect against apoptosis induced by transforming growth factor ß1 or anti-IgM (11 , 12) . In contrast, other data have associated Rel/NF-{kappa}B factors with the promotion of apoptosis. High levels of c-rel mRNAs were found in apoptotic cells of the avian embryo, and overexpression of cRel in bone marrow cells induces massive cell death (13) . Induction and activation of cRel were associated with the induction of apoptosis in chicken thymocytes (14) . Likewise, thymocytes of transgenic mice overexpressing an I{kappa}B{alpha} superrepressor have acquired the capacity to resist anti-CD3-induced apoptosis (15) . In mature T cells, inhibiting Rel/NF-{kappa}B activity confers resistance to apoptosis induced by DNA-damaging agents or by T-cell receptor engagement (16 , 17) . Proapoptotic effects of Rel/NF-{kappa}B were also described in neuronal cells after N-methyl-D-aspartate stimulation or focal ischemia (18 , 19) .

Beside apoptosis, Rel/NF-{kappa}B factors were also involved in the control of cell cycle progression. Several in vitro studies have shown that these factors promote the G1 to S progression (20, 21, 22) , whereas another study has suggested they promote a proliferation arrest at the G1-S transition (23) . An antiproliferative effect of NF-{kappa}B was observed in vivo in keratinocytes overexpressing constitutively active p50 or RelA (24) , whereas mouse splenic B and T cells that were cRel-/- were found to be unresponsive to some mitogenic stimuli (25) .

Rel/NF-{kappa}B proteins thus appear as multipotent transcription factors that can be involved in both proliferation and apoptosis and whose activation can lead to opposed outcomes for the cell. This is exemplified by the phenotype of embryos lacking the I{kappa}B kinase IKK1 that display multiple developmental defects as a result of different cellular defaults. For example, IKK1-/- embryos failed to form distinct digits because of a reduced number of apoptotic cells in the interdigital areas; they also have abnormal skin lacking superficial cornified layer due to a block of keratinocyte differentiation and displaying hyperplasia due to a too high rate of basal cell proliferation (26 , 27) . It was often suggested that these different effects of Rel/NF-{kappa}B are dependent on the cell type or cellular context in which they act. Inconsistent with this assumption, we show here that a Rel/NF-{kappa}B member, cRel, is able to induce three different phenotypes in HeLa cells: (a) a proliferation arrest; (b) an increase in apoptosis; and (c) a resistance against apoptosis induced by TNF-{alpha} and CHX. Two of them, the capacity to resist TNF-{alpha} + CHX-induced apoptosis and the proliferation arrest, occur in the same cells.

This unexpected result raised the question of how this single transcription factor can simultaneously control the rates of apoptosis and proliferation. Indeed, among the Rel/NF-{kappa}B target genes described to date, several (such as TRAF1, TRAF2, cIAP1, cIAP2, XIAP, Bfl-1/A1, and Bcl-x) specifically account for the antiapoptotic effect (28, 29, 30, 31, 32, 33, 34, 35) , Fas ligand specifically accounts for the proapoptotic effect (16) , and cyclin D1 specifically accounts for the proproliferative effect (21) , but none was shown to be involved in more than one of these effects.

Because reactive oxygen species can interfere in the control of cell growth and death (for review, see Refs. 36 and 37 ), we reasoned that cRel could act on both proliferation and apoptosis by inducing a change in the redox state of the cell. We therefore searched for variations in the expression of some antioxidant enzymes on cRel expression. We focused particularly on mitochondrial MnSOD, which converts the toxic anion superoxide radical (O-2) in hydrogen peroxide (H2O2), because it has been shown to be activated by cytokines that activate Rel/NF-{kappa}B (38) , suggesting that it could be a Rel/NF-{kappa}B target gene.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Construction of the Bicistronic GFP/cRel Expression Vector.
The bicistronic GFP/cRel expression vector was constructed from the pEGFP-C1 vector (Clontech) designed to synthesize proteins fused to the COOH terminus of the EGFP. To stop the translation of EGFP at the 5' end of the MCS, we inserted a sequence containing multiple stop codons between the HindIII and BglII sites. Next, the internal ribosomal entry site sequence of poliovirus type 1 (39) was inserted between the Asp-718 and SmaI sites of the MCS. This construct, named pEGFP, was used as a control vector. Finally, to obtain the pEGFP/cRel expression vector, human c-rel cDNA (40) was inserted in the XbaI site of the MCS.

Cell Culture, Transfection, and Flow Cytometry Sorting.
HeLa cells (93021013; European Collection of Cell Culture), were grown at 37°C in an atmosphere of 5% CO2 in DMEM supplemented with 10% fetal bovine serum, 2 mM glutamine, and 10 units/ml antibiotics. Cells were transfected using FuGENE6 (Boehringer Mannheim) according to manufacturer’s recommendations. GFP-expressing cells were sorted 24 h after transfection with an Epics Elite cytometer (Coulter) using excitation at 488 nm and detection at 520–530 nm. To establish the growth curves, 8000 sorted cells were seeded per well in 12-well plates. Cells were counted daily with a Coulter counter.

Immunoblotting.
After sorting, cells were grown for 48 h and then washed with 50 mM phosphate buffer (pH 7.8), scraped, and sonicated. The extracts were centrifuged at 20,000 x g at 4°C for 10 min, and the total protein concentration was measured with the Bio-Rad protein assay. Proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes (Hybond-C extra; Amersham). The primary antibodies used were as follows: (a) antihuman cRel mouse IgG1 (sc-6955; Santa Cruz Biotechnology); (b) antihuman MnSOD sheep IgG (Calbiochem); (c) antihuman Cu/ZnSOD sheep IgG (Calbiochem); and (d) antihuman catalase sheep IgG (The Binding Site). The secondary antibodies were either a peroxidase-conjugated rabbit antisheep IgG or a peroxidase-conjugated goat antimouse IgG (Jackson ImmunoResearch Laboratories). Peroxidase activity was revealed using an enhanced chemiluminescence kit (Amersham).

Immunofluorescence.
Cells were fixed with 4% paraformaldehyde in PBS and permeabilized with 0.2% Triton X-100. cRel was detected by a procedure involving a tyramide amplification. Briefly, cells were incubated with antihuman cRel mouse IgG1 (sc-6955, Santa Cruz Biotechnology), biotinylated swine antigoat/mouse/rabbit immunoglobulin (Dako), extravidin-peroxidase (Sigma), biotinylated tyramide (New England Nuclear Life Science), and finally with lissamine rhodamine-conjugated streptavidin (Jackson ImmunoResearch Laboratories). MnSOD was detected with antihuman MnSOD mouse IgG1 (Chemicon) and antimouse immunoglobulin-rhodamine (Boehringer Mannheim). Nuclei were stained with Hoechst 33258 at 1 µg/ml for 3 min.

Proliferation and Apoptosis Assays.
To mark proliferating cells, cells were incubated with 10 µM BrdUrd (Boehringer Mannheim) for 4 h. Cells were subsequently fixed and permeabilized as described above and incubated with 40 units/ml DNase I (Promega) and 20 units/ml Exonuclease III (Boehringer Mannheim) for 30 min at 37°C. BrdUrd was revealed by incubations with anti-BrdUrd mouse immunoglobulin (Boehringer Mannheim), biotinylated swine antigoat/mouse/rabbit immunoglobulin (Dako), and lissamine rhodamine-conjugated streptavidin (Jackson ImmunoResearch Laboratories). Apoptosis was induced with 20 ng/ml human recombinant TNF-{alpha} (R&D Systems) and 10 µg/ml CHX (Sigma). Apoptotic cells were revealed with annexin V-AlexaTM 568 (Boehringer Mannheim). Alternatively, the apoptotic rate was measured with a quantitative Cell Death Detection ELISAPLUS kit (Boehringer Mannheim) that detects DNA fragmentation.

Flow Cytometry Analysis of DNA Content.
Cells were fixed with 4% paraformaldehyde, rinsed in PBS, and postfixed with 70% ethanol. After a PBS wash, cells were scraped in the presence of trypsine/EDTA, centrifuged at 270 x g, and resuspended in PBS. They were then incubated in 100 µg/ml propidium iodide (Molecular Probe) and 40 µg/ml RNase A (Sigma) for 30 min at 37°C. Fluorescence intensity measurements were done after excitation at 488 nm and detection at 520–530 nm for GFP and 665–685 nm for propidium iodide.

Semiquantitative RT-PCR.
Sorted cells were seeded and allowed to grow for 24 h. Cells were homogenized in Trizol (Life Technologies, Inc.), and total RNAs were isolated according to the manufacturer’s recommendations. cDNAs were synthesized using the Gene Amp RNA PCR kit (Perkin-Elmer) and amplified with the gene Amp 9600 PCR system (Perkin-Elmer) in a final volume of 50 µl containing all four deoxynucleotide triphosphates, 2 mM MgCl2, 1 unit of Taq gold polymerase (Roche), and each primer at 1 µM. Primers used were as follows: (a) MnSOD forward, GGCGCCCTGGAACCTCACAT; (b) MnSOD reverse, ACACATCAATCCCCAGCAGT; (c) I{kappa}B{alpha} forward, CGCCCAAGCACCCGGATACAGC; (d) I{kappa}B{alpha} reverse, TGGGGTCAGTCACTCGAAGCACAA, and (e) ß-actin as described elsewhere (16) . Thirty to 35 amplification cycles were done at 94°C for 1 min; 56.3°C (MnSOD), 55°C (ß-actin), or 56.9°C (I{kappa}B{alpha}) for 1 min; and 72°C for 1 min, with an initial step of 5 min at 95°C.

Cloning of the MnSOD Intron 2 and Reporter Gene Assays.
The TNFRE of human MnSOD intron 2 was amplified from human genomic DNA (Clontech) using the High Fidelity PCR Master system (Boehringer Mannheim). Primers used were as follows: (a) TNFRE forward, GGTACCTGATTGTGTTTGAAGTAAATG; and (b) TNFRE reverse, GAGCTCTGATTCCACAAGTAAAGG. The amplified fragment was cloned in the pGL3 promoter vector (Promega), yielding the pGLP3P-TNFRE reporter vector. The C/EBP 5' part of the TNFRE was synthesized by Genset with a MluI adapter in 5' and a XhoI adapter in 3'and then cloned in the pGL3 promoter vector, yielding pGL3P-C/EBP.

The expression vector used to inhibit Rel/NF-{kappa}B activity contains the avian I{kappa}B{alpha} cDNA inserted in the pCR3 plasmid (Invitrogen). The reporter vector used to measure cRel transcription activity was p3{kappa}B-Luc containing three HIV {kappa}B sites upstream of the thymidine kinase minimal promoter and the Luc cDNA. Luc activity was measured by the Luc assay system (Promega) according to the manufacturer’s recommendations.

Antisense Oligonucleotide (ASO) Inhibition of MnSOD Expression.
The oligonucleotides used were synthetic phosphorothioates (Genset). Sense and antisense sequences were as described in Ref. 41 . Cells were transfected with pEGFP or pEGFP/cRel, and 8 h later, the medium was replaced with fresh medium containing 10 µM SOs or ASOs. Effects on proliferation and apoptosis were measured 48 h later.

MnSOD cDNA Cloning.
The MnSOD cDNA was retrotranscribed from total RNAs extracted from cRel-transfected cells and amplified using the High Fidelity PCR Master System (Boehringer Mannheim). Primers used were as follows: (a) MnSOD forward, GGCGGCATCAGCGGTAGC; and (b) MnSOD reverse, TGCCCAATAACAAAATG. The amplified fragment was cloned in pCR2.1 and then inserted in pcDNA3.1. The entire MnSOD cDNA was sequenced and is identical to the X15132 sequence in the GenBank database.

Statistics.
Statistical analysis of quantitative results was performed with ANOVA (StatView).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of cRel in HeLa Cells via a Bicistronic GFP/cRel Expression Vector.
To investigate the molecular mechanisms underlying the effects of cRel on apoptosis and proliferation, we transiently overexpressed cRel in HeLa cells. We used a vector allowing us to coexpress cRel and the GFP from a bicistronic mRNA (see "Materials and Methods"). This strategy enables us to mark the transfected cells and analyze them individually under a fluorescent microscope or proceed to a larger scale analysis on nearly pure populations sorted by flow cytometry.

To check the overexpression of cRel, immunoblotting experiments were performed on extracts of cells transfected with either pEGFP/cRel expression vector or pEGFP control vector devoid of cRel and sorted by flow cytometry. As shown in Fig. 1ACitation , a protein migrating at the expected size of Mr 75,000 was detected only in pEGFP/cRel-transfected cells. The correlation between the expression of cRel and GFP was verified by immunofluorescence. All of the cells showing an obvious green fluorescence were positive for cRel (Fig. 1B)Citation . Because the activity of Rel/NF-{kappa}B transcription factors is regulated by their nucleocytoplasmic localization, we examined the subcellular localization of the overexpressed cRel. In most GFP-positive cells, the overexpressed cRel was localized in the nucleus (Fig. 1B)Citation , suggesting that it could modulate transcription. To further establish whether the overexpressed cRel was transcriptionally active, cells were cotransfected with a p3{kappa}B-Luc reporter vector (containing three HIV {kappa}B sites) and with either pEGFP/cRel or pEGFP. The Luc activity of cRel-transfected cells was about 4-fold that of control cells (Fig. 1C)Citation . Therefore, the pEGFP/cRel-transfected cells, which were recognizable by their GFP fluorescence, overexpress a transcriptionally active cRel.



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Expression of cRel in HeLa cells via a bicistronic GFP/cRel expression vector. A, analysis of cRel overexpression by immunoblotting. Ten µg of extracts from pEGFP- or pEGFP/cRel-transfected cells sorted by flow cytometry were resolved by 10% SDS-PAGE and analyzed by immunoblotting with an anti-cRel antibody. B, analysis of cRel expression and subcellular localization by immunofluorescence. pEGFP/cRel-transfected cells were identified by their GFP fluorescence (left). cRel was revealed using an anti-cRel antibody, tyramide amplification, and revelation with rhodamine (middle). Nuclei were stained with Hoechst (right). C, analysis of cRel transcriptional activity. Cells were cotransfected with either pEGFP or pEGFP/cRel and the p3{kappa}B-Luc reporter vector. Fold induction of Luc activity corresponds to the Luc activity in pEGFP/cRel-transfected cells:Luc activity in pEGFP-transfected cells. Each bar represents the mean ± SD of three points. The number of independent experiments is n = 3 in A–C.

 
cRel Decreases the Growth Rate of HeLa Cells by Arresting Proliferation and Inducing Apoptosis.
The effects of cRel overexpression were first evaluated on the growth of HeLa cells. Twenty-four h after transfection with pEGFP or pEGFP/cRel, cells were sorted by flow cytometry according to their GFP fluorescence intensity. Growth curves were established with cells originating from the most fluorescent third of the GFP-positive population. Until day 3 after sorting, cRel-expressing cells did not grow, whereas the number of control cells was multiplied by 4 (Fig. 2A)Citation . When cells were taken from the most fluorescent two-thirds of the GFP-positive population, the growth retardation of cRel-expressing cells was less perceptible (data not shown). When cells were taken from the entire population of GFP-positive cells, including the less fluorescent part of the population, no growth retardation was observed (data not shown). Therefore, overexpression of cRel decreases the growth rate of HeLa cells in a dose-dependent manner.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. cRel decreases the growth rate of HeLa cells by arresting proliferation and inducing apoptosis. A, growth curves of pEGFP- and pEGFP/cRel-transfected cells sorted by flow cytometry. For each point of the curve, P < 0.05. B, analysis of the effects of cRel on proliferation by BrdUrd assays. pEGFP- and pEGFP/cRel-transfected cells were assayed for BrdUrd incorporation 24, 48, and 72 h after transfection. The percentage of BrdUrd-positive cells among GFP-positive cells was counted. C, flow cytometry analysis of the cell cycle stage at which cRel-expressing cells are arrested. The DNA content of 10,000 GFP-positive cells transfected with pEGFP or pEGFP/cRel was measured after propidium iodide staining. Cell number (Y axis) is plotted against DNA content (X axis). Arrows indicate cells with 6N and 8N DNA content. D, analysis of the effects of cRel on apoptosis. Cells were transfected with pEGFP or pEGFP/cRel and sorted by flow cytometry 24 h later, and apoptosis was evaluated 24 or 48 h later using a quantitative cell death detection ELISA kit that gives a colorimetric measure (absorbance) of DNA degradation into oligonucleosomes. Each bar represents the mean ± SD of three points. *, a significant difference with P < 0.05. The number of independent experiments is n = 3 in A–C and n = 2 in D.

 
Because the growth of a cell population depends on the rates of proliferation and apoptosis, we examined whether cRel modified these two processes in HeLa cells. The proliferation rate of pEGFP- and pEGFP/cRel-transfected cells was estimated by BrdUrd incorporation. The percentage of BrdUrd-positive cells among the GFP-positive cells was about 50% in control cells, compared to only 30%, 18%, and 12% in cRel-expressing cells at 24, 48, and 72 h after transfection, respectively (Fig. 2B)Citation . These results, taken together with the growth curves, indicate that 3 days after transfection, almost all cells expressing cRel to a high level are cell cycle arrested. To determine the stage at which the cell cycle arrest occurred, we performed a flow cytometric analysis of the DNA content of the GFP-positive cells transfected by the control vector or the expression vector. The comparison of the DNA histograms indicates that cRel arrests HeLa cells at all of the cell cycle phases, with a slightly higher incidence at the G2-M phases (Fig. 2C)Citation . In addition, DNA histograms show a higher number of cells with 6N/8N quantity of DNA in cRel-expressing cells than in control cells; accordingly, large spread cells with large and distorted nuclei or multiple nuclei were observed by microscopic analysis (data not shown), suggesting that in some cells, cRel induces endoreplication and thus polyploidy.

An effect of cRel on the apoptotic rate of HeLa cells was investigated using an ELISA kit (Boehringer Mannheim) that detects DNA fragmentation into oligonucleosomes. Cells were transfected with pEGFP or pEGFP/cRel and sorted by flow cytometry according to the intensity of their GFP fluorescence. Cells used in the assay originated from the most fluorescent third of the GFP-positive population. The results indicate that the rate of apoptosis increases about 2-fold on cRel overexpression (Fig. 2D)Citation . When the assay was done with cells originating from the most fluorescent two-thirds of the GFP-positive population, the apoptosis rate increase was about 1.7 (data not shown). Therefore, overexpression of cRel increases the rate of HeLa cell apoptotic cell death in a dose-dependent manner. The percentage of apoptotic cells was estimated by the annexin V assay: it was about 5–10% in pEGFP-transfected cells and increases to a maximum of 15% in pEGFP/cRel-transfected cells (data not shown).

Taken together, these results indicate that cRel decreases the growth rate of HeLa cells both by decreasing their proliferation and by increasing their apoptosis.

cRel Protects HeLa Cells from TNF-{alpha}-induced Apoptosis.
The fact that cRel can induce apoptosis of HeLa cells was quite unexpected because it has been shown that it can protect them from apoptosis induced by TNF-{alpha} in the presence of the protein synthesis inhibitor CHX (9 , 10) . We therefore verified this result in our model. Forty-eight h after transfection with either pEGFP/cRel or pEGFP, cells were treated with or without TNF-{alpha} + CHX for 2, 5, and 10 h. After 10 h of TNF-{alpha} + CHX treatment, almost all GFP-positive cells transfected with the control plasmid were apoptotic, i.e., displayed condensed cytoplasm and condensed or fragmented nuclei. In contrast, the majority of GFP-positive cells transfected with the cRel expression vector were still spread on the dish and displayed normal nuclei (Fig. 3A)Citation . It is noteworthy that apoptosis-resistant cells were always among the most fluorescent ones (Fig. 3A)Citation . Apoptosis was also evaluated by an annexin V assay. After 10 h of TNF-{alpha} + CHX treatment, 80% of cells transfected with pEGFP were apoptotic, as compared with only 30% of cells transfected with pEGFP/cRel (Fig. 3B)Citation . Nearly no apoptosis occurred when cells were treated with TNF-{alpha} or CHX alone (data not shown). These results indicate that the overexpression of cRel over a 48-h period makes the cells resistant to apoptosis induced by TNF-{alpha} in the presence of CHX, suggesting that one or several antiapoptotic protein(s) have accumulated during this period.



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. cRel protects HeLa cells from TNF-{alpha}-induced apoptosis. Cells were transfected with pEGFP or pEGFP/cRel and tested 48 h later for their sensitivity to apoptosis induced by TNF-{alpha} + CHX. A, apoptosis was estimated by microscopic observation after 10 h of TNF-{alpha} + CHX treatment. Apoptotic cells were identified among GFP-positive cells because of their condensed cytoplasm (GFP) and condensed nuclei (Hoechst). The TNF-{alpha} + CHX treatment induced apoptosis in almost all pEGFP-transfected cells (arrows), whereas pEGFP/cRel-transfected cells were still alive and well spread on the dish. B, apoptotic cells were also revealed by annexin V labeling, and the percentage of apoptotic cells among GFP-positive cells was counted after 2, 5, and 10 h of TNF-{alpha} + CHX treatment. The number of independent experiments is n = 5 in A and n = 3 in B.

 
cRel Induces the Expression of MnSOD.
Taken together, our results show that cRel is not only able to protect HeLa cells from TNF-{alpha} + CHX-induced apoptosis but can also block their proliferation and increase their apoptosis. All three phenotypes occur preferentially in the most GFP-positive cells and not differentially in subpopulations expressing cRel at different levels. Moreover, according to the high percentage of affected cells, it is clear that the cell cycle-arrested cells and the apoptosis-resistant cells are the same cells and not two subpopulations reacting differentially to cRel overexpression. We therefore searched for any change in the expression of MnSOD, a putative target gene of Rel/NF-{kappa}B transcription factors, because it could act in all these phenomena, as an enzyme involved in the regulation of the redox state of the cell. Levels of mRNAs encoding MnSOD, I{kappa}B{alpha}, a known target gene of cRel (positive control), and ß-actin (loading control) were estimated by RT-PCR performed on total RNA extracted from pEGFP- or pEGFP/cRel-transfected cells sorted by flow cytometry. Fig. 4ACitation shows that the amounts of MnSOD and I{kappa}B{alpha} mRNA were increased in cRel-expressing cells compared with control cells. The overexpression of MnSOD was verified by immunoblot. As shown in Fig. 4BCitation , the amount of MnSOD protein was clearly increased in cRel-overexpressing cells compared with control cells. To check whether cRel-induced MnSOD was localized correctly in mitochondria, we performed an immunofluorescence analysis. In pEGFP/cRel-transfected cells, the immunoreactivity was localized in patches surrounding the nucleus and in dots within the cytoplasm, in agreement with the expected mitochondrial localization (Fig. 4C)Citation .



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. cRel induces the expression of MnSOD. A, analysis of MnSOD, I{kappa}B{alpha} (positive control), and ß-actin (loading control) mRNA levels by RT-PCR on total RNA from pEGFP- or pEGFP/cRel-transfected cells sorted by flow cytometry. B, immunoblot analysis of MnSOD expression in pEGFP- or pEGFP/cRel-transfected cells sorted by flow cytometry. Ten µg of extracts were resolved in 12.5% SDS-PAGE and analyzed with an anti-MnSOD antibody. C, immunofluorescence analysis of MnSOD expression and subcellular localization. Cells transfected with pEGFP/cRel were identified by their GFP fluorescence (left). MnSOD was revealed using an anti-MnSOD antibody and rhodamine (right). The number of independent experiments is n = 3 in A–C.

 
cRel Activates an Intronic Enhancer of the MnSOD Gene.
MnSOD expression being induced in cReP-expressing cells, we next wanted to determine whether the MnSOD gene could be a direct transcriptional target of cRel. A TNF-responsive element (TNFRE) containing a {kappa}B site has been mapped in the intron 2 of the mouse MnSOD gene (42) . Because the corresponding sequence in human intron 2 (+2609 to +2864) is well conserved, we checked whether it was TNF-{alpha}-responsive in HeLa cells and whether Rel/NF-{kappa}B factors were involved in the TNF-{alpha} response. The putative human TNFRE was cloned into the pGL3 promoter vector (Fig. 5A)Citation . HeLa cells were transfected by this pGL3P-TNFRE vector and treated or not treated with TNF-{alpha}. Fig. 5BCitation shows that TNF-{alpha}-treated cells exhibited a 2.3-fold induction of Luc activity. When cells were cotransfected with a plasmid encoding the Rel/NF-{kappa}B inhibitor I{kappa}B{alpha}, this induction was not observed (Fig. 5B)Citation . Therefore, the human +2609 to +2864 sequence contains the TNFRE, and the TNF-{alpha} response is mediated by Rel/NF-{kappa}B proteins. We next investigated the ability of cRel to activate transcription from this intronic enhancer. RelA and p50 were shown to be able to bind the {kappa}B site of the mouse intron 2 (42) and also, surprisingly, to a neighboring C/EBPX site (43) . We thus evaluated the ability of cRel to activate transcription not only from the entire enhancer but also from the sole 5' half comprising the C/EPBX site. cRel was found to activate Luc activity from the entire TNFRE by 2.5-fold but did not activate Luc activity from the 5' part (Fig. 5C)Citation . Therefore, cRel could directly activate the transcription of the human MnSOD gene, most likely from the intron 2 {kappa}B site. While this part of our work was completed, Xu et al. (44) confirmed the involvement of the {kappa}B site in the TNF-{alpha} response of the human MnSOD gene by site-directed mutagenesis.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. cRel activates an intronic enhancer of the MnSOD gene. A, schematic representation of the reporter plasmids containing the entire human putative TNFRE (pGL3P-TNRE) or its 5' half (pGL3P-C/EBP). B, response of the human putative TNFRE to TNF-{alpha} and involvement of Rel/NF-{kappa}B transcription factors in this response. Cells were transfected with pGL3P-TNFRE without or with a vector encoding the Rel/NF-{kappa}B inhibitor I{kappa}B{alpha}. Twenty-four h later, cells were stimulated by 20 ng/ml TNF-{alpha} for 15 h, and Luc activity was measured. C, response of the human putative TNFRE to cRel. Cells were cotransfected with pEGFP or pEGFP/cRel and pGL3P-TNFRE or pGL3P-C/EBP, and Luc activity was measured 24 h later. Each bar represents the mean ± SD of three points. *, a significant difference with P < 0.0005. The number of independent experiments is n = 3 in B and C.

 
MnSOD ASOs Revert Both the Proliferation Arrest and the Protection against Apoptosis Induced by cRel.
To evaluate the involvement of MnSOD in the main phenotypes induced by cRel, i.e., cell cycle arrest and resistance against TNF-{alpha} + CHX-induced apoptosis, we examined whether they could be reverted by reducing MnSOD induction with ASOs. First, the efficiency of ASOs was evaluated in parental HeLa cells in which MnSOD expression was induced by a 4-h TNF-{alpha} treatment. In the presence of 10 µM ASOs, MnSOD protein expression was decreased compared to that in the presence of SOs but not completely abolished (Fig. 6A)Citation . HeLa cells were then transfected by pEGFP or pEGFP/cRel and incubated with ASOs or SOs, and 48 h later, the proliferation of GFP-positive cells was assayed by BrdUrd incorporation. The overexpression of cRel inhibited the proliferation of HeLa cells by 2.4-fold in the presence of control SOs as compared with only 1.7-fold in the presence of ASOs (Fig. 6B)Citation , i.e., the antiproliferative effect of cRel reverted to about 50% when the induction of MnSOD expression was reduced.



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. MnSOD ASOs revert both the proliferation arrest and apoptosis protection induced by cRel. A, efficiency of ASOs. Cells were treated with 10 µM ASO or SO for 4 h, and TNF-{alpha} at 30 ng/ml was added for 4 h to induce MnSOD expression. Eight µg of each cellular extract were resolved by 12.5% SDS-PAGE and analyzed by immunoblotting with an anti-MnSOD antibody. B, oligonucleotide effects on the proliferation arrest induced by cRel. Cells were transfected with pEGFP or pEGFP/cRel and treated with 10 µM ASO or SO. Forty-eight h later, proliferation was assayed by BrdUrd incorporation as described in the Fig. 2Citation legend. The fold inhibition of proliferation corresponds to the percentage of BrdUrd-positive cells in pEGFP-transfected cells:the percentage of BrdUrd-positive cells in pEGFP/cRel-transfected cells. C, oligonucleotide effects on the apoptosis resistance induced by cRel. Cells were transfected and treated with oligonucleotides as described above, and apoptosis was induced with 5 h of TNF-{alpha} + CHX treatment. The percentage of apoptotic cells was counted after Hoechst staining as described in the Fig. 3Citation legend. The fold inhibition of TNF-{alpha} + CHX-induced apoptosis corresponds to this percentage in pEGFP-transfected cells:this percentage in pEGFP/cRel-transfected cells. Each bar represents the mean ± SD of three points. *, a significant difference with P = 0.0092 in B and P < 0.0001 in C. The number of independent experiments is n = 2 in A–C.

 
CRel-overexpressing cells treated with SOs or ASOs were also assayed for their sensitivity to TNF-{alpha} + CHX-induced apoptosis. Fig. 6CCitation shows that cRel protected cells against apoptosis 1.8-fold in the presence of SOs versus only 1.2-fold in the presence of ASOs, corresponding to a phenotype reversion of about 70%. Considering the partial efficiency of ASOs in inhibiting MnSOD expression, these results indicate that the effects of cRel on proliferation and TNF-{alpha} + CHX-induced apoptosis both rely on the induction of MnSOD.

MnSOD Overexpression Mimics both the Proliferation Arrest and the Protection against Apoptosis Induced by cRel.
To further evaluate the involvement of MnSOD in the cell cycle arrest and apoptosis resistance induced by cRel, we examined whether overexpressing MnSOD could mimic these effects. MnSOD cDNA was cloned in a pcDNA3.1 vector, and the expression of the MnSOD protein from this vector was checked by immunoblotting (Fig. 7A)Citation . HeLa cells were then cotransfected with the pcDNA3.1/MnSOD expression vector or the pcDNA3.1 control vector and the pEGFP vector to mark transfected cells. After having checked the overexpression of MnSOD in GFP-positive cells by immunofluorescence (data not shown), BrdUrd incorporation assays were performed as described previously. The results show that there was about 3-fold less BrdUrd-proliferating cells among MnSOD-overexpressing cells than among control cells (Fig. 7B)Citation . MnSOD-overexpressing HeLa cells were also assayed for their resistance to TNF-{alpha} + CHX-induced apoptosis. Eight h of TNF-{alpha} + CHX treatment induced apoptosis in 70% of control cells versus 40% of MnSOD-overexpressing cells (Fig. 7C)Citation . Therefore, the overexpression of MnSOD mimics for the most part the antiproliferative and antiapoptotic effects of cRel.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 7. MnSOD overexpression mimics both the proliferation arrest and apoptosis protection induced by cRel. A, immunoblot analysis of MnSOD overexpression. Extracts of pcDNA3.1- or pcDNA3.1/MnSOD-transfected cells were prepared 48 h after transfection, and 10 µg were resolved in 12.5% SDS-PAGE and analyzed with an anti-MnSOD antibody. B, effect of MnSOD overexpression on proliferation. Cells were cotransfected with pcDNA3.1 or pcDNA3.1/MnSOD and pEGFP (ratio, 9:1) and assayed 48 h later for BrdUrd incorporation as described in the Fig. 2Citation legend. C, effect of MnSOD overexpression on TNF-{alpha} + CHX resistance. Cells were cotransfected as described above and treated 48 h later with TNF-{alpha} + CHX for 6 and 8 h. The percentage of apoptotic cells was counted after Hoechst staining as described in the Fig. 3Citation legend. Each bar represents the mean ± SD of three points. *, a significant difference with P < 0.005. The number of independent experiments is n = 5 in A and n = 2 in B and C.

 
The Cell Cycle Arrest Induced by cRel Could Be Due to H2O2 Accumulation.
The enzymatic function of MnSOD is to dismutate the toxic anion superoxide (O-2) in hydrogen peroxide (H2O2). This catalytic activity is also shared by the nuclear and cytosolic Cu/ZnSOD. H2O2 itself is toxic, and it is subsequently transformed into H2O by two enzymes, the GPX and the catalase (36) . We therefore wondered whether the expression of these antioxidant enzymes was also modified in cRel-expressing cells. An immunoblot analysis revealed that (a) Cu/ZnSOD levels were similar in control and cRel-expressing cells, (b) GPX was undetectable in HeLa cells, and (c) catalase was induced in cRel-expressing cells but very slightly compared with MnSOD (Fig. 8A)Citation . Therefore, by only inducing the expression of MnSOD, cRel would change the balance between H2O2-producing and H2O2-degrading enzymes and thus lead to H2O2 accumulation.



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 8. The cell cycle arrest induced by cRel could be due to H2O2 accumulation. A, immunoblot analysis of some antioxidant enzyme expression in pEGFP- and pEGFP/cRel-transfected cells sorted by flow cytometry. Cellular extracts were resolved by 12.5% SDS-PAGE and analyzed using specific antibodies. B, involvement of H2O2 in the proliferation arrest induced by cRel. Cells were transfected with pEGFP or pEGFP/cRel, and H2O2 was quenched by exogenously adding catalase at different concentrations. Forty-eight h later, proliferation was assayed by BrdUrd incorporation. The fold inhibition of proliferation induced by cRel was calculated as described in the Fig. 6Citation legend. C, parental HeLa cells were treated for 18 h with different concentrations of H2O2, and BrdUrd assays were performed. The percentage of BrdUrd-positive cells in the total population was counted. Each bar represents the mean ± SD of three points. *, a significant difference with P = 0.0019 in B and P < 0.05 in C. The number of independent experiment is n = 2 in A and n = 2 in B and C.

 
To establish whether the cell cycle arrest of cRel-expressing cells could be mediated by H2O2 accumulation, we measured their proliferation rate when H2O2 was quenched. Because H2O2 passively diffuses across membranes (45) , quenching was achieved by adding catalase in the culture medium. Cells were transfected with either pEGFP or pEGFP/cRel in the presence of catalase, and 48 h later, proliferation was assayed by BrdUrd incorporation. When catalase was not added, cRel-expressing cells proliferated 4.4-fold less than control cells. When catalase was added at 50 and 500 units/ml, cRel-expressing cells proliferated 4.1-fold less and only 3-fold less than control cells, respectively (Fig. 8B)Citation . Therefore, decreasing H2O2 concentration reduces in a dose-dependent manner the inhibition of proliferation induced by cRel. This phenotype reversion, which reaches 40%, suggests that cRel arrests the cell cycle by increasing H2O2 concentration via the induction of MnSOD.

To further establish the involvement of H2O2 in the cRel-induced proliferation arrest, we examined whether direct treatment of parental HeLa cells with H2O2 might affect their proliferation. H2O2 was added in the culture medium at concentrations that do not induce cell death (data not shown), and proliferating cells were counted 18 h later. Fig. 8CCitation shows that H2O2 decreases the proliferation rate in a dose-dependent manner. Therefore, exogenously added H2O2 mimics the effect of cRel, supporting the hypothesis that cRel arrests proliferation of HeLa cells by accumulating H2O2.


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
By Up-Regulating MnSOD, cRel Arrests Proliferation of HeLa Cells and Simultaneously Renders Them Resistant to TNF-{alpha} + CHX-induced Apoptosis.
Numerous studies have described opposing effects of Rel/NF-{kappa}B transcription factors on apoptosis and proliferation, suggesting that the function of Rel/NF-{kappa}B factors could vary according to the cell type or extracellular context. Unexpectedly, in contrast, we show here that one member of the Rel/NF-{kappa}B family, cRel, is able in one cell type (HeLa cells) to inhibit proliferation, protect against TNF-{alpha} + CHX-induced apoptosis, and increase the basal rate of apoptosis. Both effects of proliferation inhibition and protection against TNF-{alpha} + CHX-induced apoptosis are massive and consequently clearly occur in the same cells. Therefore, the central question was what are the target genes induced by cRel responsible for this double effect? We demonstrate that, surprisingly, both effects rely at least in part on the induction of the same gene coding the antioxidant enzyme MnSOD. Indeed, both the cell cycle arrest and the TNF-{alpha} + CHX resistance induced by cRel were reverted by MnSOD ASOs, and both were mimicked by MnSOD overexpression.

MnSOD catalyzes the dismutation of the anion superoxide radical (O-2) to hydrogen peroxide (H2O2). O-2 has multiple deleterious effects such as lipid peroxidation, DNA cross-linking, and formation of disulphide bonds in proteins (46) but is continuously transformed into H2O2 by SODs. O-2 is the side product of several intracellular reactions, including electron transport during respiration, and may be accumulated in diverse harmful situations, including TNF-{alpha} treatment (46 , 47) . We therefore propose that cRel would protect against TNF-{alpha} + CHX-induced apoptosis via MnSOD induction by rendering cells more effective in eliminating the O-2 produced by TNF-{alpha}. This assumption is supported by previous data showing that human embryonic 293 kidney cells develop resistance to TNF-{alpha} + CHX when they overexpress MnSOD (48) .

How would MnSOD be able, in addition, to arrest proliferation? Because H2O2 produced by dismutating O-2 also has deleterious effects, it is subsequently transformed into H2O by GPX and catalase. We have shown that the expression of these two enzymes is not significantly modified in cRel-expressing cells. Therefore, the overexpression of cRel would lead to an alteration of the balance between the SODs and catalase/GPX systems and hence probably to H2O2 accumulation, which could act as the effector molecule to arrest proliferation. Indeed, decreasing H2O2 concentration by exogenously adding catalase reverted the proliferation arrest. Conversely, direct treatment of parental HeLa cells by H2O2 induced, as did cRel, a proliferation arrest. Comparable results were obtained in prostate carcinoma cells transfected with MnSOD and in NIH3T3 cells transfected with Cu/ZnSOD. In both cases, the overexpression of the SOD leads to imbalance in antioxidant enzymes, cell cycle arrest via H2O2 accumulation, and cell morphology alterations including spreading and apparition of tetra and octaploid cells (49 , 50) , such as those observed in some cRel-overexpressing HeLa cells. Other studies done in various cancer cell lines have similarly shown that the overexpression of MnSOD leads to growth arrest (51, 52, 53) .

Besides its effect on cell cycle progression, H2O2 at high levels can induce apoptosis (54 , 55) . One can assume that cells overexpressing the highest levels of cRel would particularly accumulate H2O2 and hence undergo apoptosis, therefore explaining why cRel would be able in addition to induce apoptosis of a part of the HeLa cell population.

In conclusion, cRel would participate in the control of the oxidative state of the cell by regulating the expression of MnSOD. That way, cRel would render cells resistant to TNF-{alpha} + CHX-induced apoptosis by improving their ability to eliminate O-2. However, at the same time, it would stop the proliferation of these cells and would even induce their apoptosis as a result of H2O2 accumulation (Fig. 9)Citation . Therefore, the phenotypes of proliferation arrest, apoptosis resistance, and apoptosis susceptibility conferred by cRel could occur simultaneously and not necessarily alternatively and independently, according to the cell type or cellular context as often assumed. The common denominator between these cell behaviors is MnSOD, which, on its own, modulates the concentration of two different "second messengers," O-2 and H2O2, with different effects. The idea that activation of Rel/NF-{kappa}B transcription factors may generate a cell cycle arrest coupled to apoptosis resistance is supported by a study demonstrating that keratinocytes growth-arrested by senescence, confluence, or transforming growth factor ß treatment become resistant to apoptosis induced by UV irradiation (56) . Very recently, it was shown that NF-{kappa}B participates in the induction of apoptosis by p53, whereas it is still able to protect against TNF-{alpha}-induced apoptosis, thus reinforcing the idea that Rel/NF-{kappa}B factors may simultaneously mediate different, even opposite, functions in the same cell (57) .



View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 9. Model depicting the molecular mechanism by which cRel would act on both proliferation and apoptosis. cRel induces MnSOD. This leads on one hand to H2O2 accumulation and proliferation arrest. In some cells in which H2O2 would be highly accumulated, apoptosis may occur. On the other hand, the MnSOD induction would render cells more efficient in eliminating the O-2 produced on TNF-{alpha} treatment, thus enabling them to escape cell death. Black shading indicates demonstrated parts of the model, and gray shading indicates the hypothetical parts of the model.

 
Other Cell Cycle Regulators Are Indirectly Altered in cRel-expressing Cells.
In this work, we have characterized for the first time a direct Rel/NF-{kappa}B target gene whose induction leads to an inhibition of proliferation. The proliferation arrest seems to occur at any cell cycle phase, with a slightly higher incidence at the G2-M phases and an apparition of polyploid cells. This suggests that cRel does not block the cell cycle at a particular checkpoint but rather reduces the overall cycle speed by disturbing progression in each phase. This is in agreement with the involvement of MnSOD, which is not supposed to act on a specific phase or checkpoint but would rather alter, via H2O2, different cell components including DNA. Bash et al. (23) had previously documented a proliferation arrest of HeLa cells by overexpression of the avian cRel via a tetracycline-regulated system. Although they mention an overall slowdown of cell cycle progression, they show that the arrest occurs mainly at the G1-S transition. Accordingly, they describe changes in the expression or activity of several critical regulators of the G1-S transition, including stabilization of the p53 protein and, consequently, accumulation of the cyclin/cyclin-dependent kinase inhibitor p21 (23) . Because there are some data indicating that p53 and p21 may act in S phase and G2-M transition too (for review, see Ref. 58 ), we examined whether they were affected in our system. We confirmed the main results of Bash et al. (23) , i.e., an accumulation of p53 protein and an accumulation of both p21 mRNA and protein on cRel overexpression (data not shown). However, the p53 and p21 accumulation was detected only 48 h after transfection, whereas that of MnSOD was detected as early as 24 h after transfection. Moreover, by microscopic analysis of individual cells, we ascertain that only half of cRel-expressing cells overexpress p53 and p21 (data not shown), whereas almost all cRel-expressing cells express the MnSOD, and almost all are cell cycle arrested. Therefore, in contrast to MnSOD, p53 and p21 are not directly activated by cRel and seem to operate later and to a lesser extent. Other genes operating in cell cycle or apoptosis and regulated by Rel/NF-{kappa}B factors have been described (see "Introduction"); some of them also probably participate in the phenotypes induced by cRel.

Inhibiting Rel/NF-{kappa}B Transcription Factors during Anticancer Treatments.
The antiapoptotic effect of cRel evidenced in this work is confirmed by a long list of publications. These results have often led people to speculate that it would be possible to improve the efficiency of anticancer drugs by inhibiting Rel/NF-{kappa}B. However, the protective effect of Rel/NF-{kappa}B proteins against drug-induced apoptosis is not universal. For example, it was shown in two human lymphoma cell lines that NF-{kappa}B protects against apoptosis induced by TNF-{alpha}, Taxol, and okadaic acid but not against that induced by daunomycin, doxorubicin, H2O2, vinblastine, and vincristine (59) . This restriction in the antiapoptotic activities of Rel/NF-{kappa}B transcription factors and our present demonstration of possible coexisting antiproliferative and proapoptotic activities question the use of agents aimed to inhibit Rel/NF-{kappa}B factors during anticancer treatments.


   ACKNOWLEDGMENTS
 
We thank K. Kean for the poliovirus plasmid, N. Rice for the human c-rel plasmid, and C. Glineur for the I{kappa}B{alpha} and 3{kappa}B-Luc plasmids. We are grateful to J. Coll, P. Delplace, D. Dive, V. Fafeur, D. Monte, and A. Pourtier for helpful discussions and critical reading of the manuscript.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Center National de la Recherche Scientifique, the Université Lille 2, the Association pour la Recherche sur le Cancer, the Institut Pasteur de Lille, the Conseil Régional Nord/Pas-de-Calais, and the European Regional Development Fund. C. A. is Maître de Conférences at the Université Lille 1. Back

2 To whom requests for reprints should be addressed, at EP 560, Centre National de la Recherche Scientifique/Institut Pasteur de Lille/Université Lille 2, Institut de Biologie de Lille, 1 rue Calmette, BP 447, 59021 Lille cedex, France. Phone: 33-3-20-87-10-90; Fax: 33-3-20-87-11-11; E-mail: corinne.abbadie{at}ibl.fr Back

3 The abbreviations used are: NF-{kappa}B, nuclear factor {kappa}B; MnSOD, manganese superoxide dismutase; CHX, cycloheximide; TNF-{alpha}, tumor necrosis factor {alpha}; RT-PCR, reverse transcription-PCR; IKK, I{kappa}B kinase; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; MCS, multiple cloning site; BrdUrd, bromodeoxyuridine; TNFRE, TNF-responsive element; C/EBP, CAAT/enhancer binding protein; Luc, luciferase; ASO, antisense oligonucleotide; SO, sense oligonucleotide; Cu/ZnSOD, copper/zinc-containing superoxide dismutase; GPX, glutathione peroxidase; I{kappa}B, inhibitor of NF-{kappa}B. Back

Received 6/ 1/00. Accepted 1/16/01.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Foo S. Y., Nolan G. P. NF-{kappa}B to the rescue: RELs, apoptosis and cellular transformation. Trends Genet., 15: 229-235, 1999.[Medline]
  2. Pahl H. L. Activators and target genes of Rel/NF-{kappa}B transcription factors. Oncogene, 18: 6853-6866, 1999.[Medline]
  3. Mercurio F., Manning A. M. Multiple signals converging on NF-{kappa}B. Curr. Opin. Cell Biol., 11: 226-232, 1999.[Medline]
  4. Beg A. A., Sha W. C., Bronson R. T., Ghosh S., Baltimore D. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-{kappa}ß. Nature (Lond.), 376: 167-170, 1995.[Medline]
  5. Doi T. S., Marino M. W., Takahashi T., Yoshida T., Sakakura T., Old L. J., Obata Y. Absence of tumor necrosis factor rescues RelA-deficient mice from embryonic lethality. Proc. Natl. Acad. Sci. USA, 96: 2994-2999, 1999.[Abstract/Free Full Text]
  6. Li Q., Van Antwerp D., Mercurio F., Lee K. F., Verma I. M. Severe liver degeneration in mice lacking the I{kappa}B kinase 2 gene. Science (Washington DC), 284: 321-325, 1999.[Abstract/Free Full Text]
  7. Wang C. Y., Mayo M. W., Baldwin A. S., Jr. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-{kappa}B. Science (Washington DC), 274: 784-786, 1996.[Abstract/Free Full Text]
  8. Van Antwerp D., Martin S. J., Kafri T., Green D. R., Verma I. M. Suppression of TNF{alpha}-induced apoptosis by NF-{kappa}B. Science (Washington DC), 274: 787-789, 1996.[Abstract/Free Full Text]
  9. Liu Z-G., Hsu H., Goeddel D. V., Karin M. Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-{kappa}B activation prevents cell death. Cell, 87: 565-576, 1996.[Medline]
  10. Zong W. X., Bash J., Gelinas C. Rel blocks both anti-Fas- and TNF{alpha}-induced apoptosis and an intact Rel transactivation domain is essential for this effect. Cell Death Differ., 5: 963-972, 1998.[Medline]
  11. Wu M., Lee H., Bellas R. E., Schauer S. L., Arsura M., Katz D., Fitzgerald M. J., Rothstein T. L., Sherr D. H., Sonenshein G. E. Inhibition of NF-{kappa}B/Rel induces apoptosis of murine B cells. EMBO J., 15: 4682-4690, 1996.[Medline]
  12. Arsura M., Wu M., Sonenshein G. E. TGF-ß1 inhibits NF-{kappa}B/Rel activity inducing apoptosis of B cells: transcriptional activation of I{kappa}B{alpha}. Immunity, 5: 31-40, 1996.[Medline]
  13. Abbadie C., Kabrun N., Bouali F., Smardova J., Stehelin D., Vandenbunder B., Enrietto P. J. High levels of c-rel expression are associated with programmed cell death in the developing avian embryo and in bone marrow cells in vitro. Cell, 75: 899-912, 1993.[Medline]
  14. Huguet C., Mattot V., Bouali F., Stehelin D., Vandenbunder B., Abbadie C. The avian transcription factor c-rel is induced and translocates into the nucleus of thymocytes undergoing apoptosis. Cell Death Differ., 4: 1-10, 1997.
  15. Hettmann B. T., DiDonato J., Karin M., Leiden J. M. An essential role for NF-{kappa}ß in promoting double positive thymocyte apoptosis. J. Exp. Med., 189: 145-157, 1999.[Abstract/Free Full Text]
  16. Kasibhatla S., Brunner T., Genestier L., Echeverri F., Mahboubi A., Green D. R. DNA damaging agents induce expression of Fas ligand and subsequent apoptosis in T lymphocytes via the activation of NF-{kappa}B and AP-1. Mol. Cell, 1: 543-551, 1998.[Medline]
  17. Kasibhatla S., Genestier L., Green D. R. Regulation of Fas ligand expression during activation-induced cell death in T lymphocytes via NF-{kappa}B. J. Biol. Chem., 274: 987-992, 1999.[Abstract/Free Full Text]
  18. Qin Z. H., Chen R. W., Wang Y., Nakai M., Chuang D. M., Chase T. N. NF-{kappa}B nuclear translocation upregulates c-Myc and p53 expression during NMDA receptor-mediated apoptosis in rat striatum. J. Neurosci., 19: 4023-4033, 1999.[Abstract/Free Full Text]
  19. Schneider A., Martin-Villalba A., Weih F., Vogel J., Wirth T., Schwaninger M. NF-{kappa}B is activated and promotes cell death in focal cerebral ischemia. Nat. Med., 5: 554-559, 1999.[Medline]
  20. Guttridge D. C., Albanese C., Reuther J. Y., Pestell R. G., Baldwin A. S., Jr. NF-{kappa}B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol. Cell. Biol., 19: 5785-5799, 1999.[Abstract/Free Full Text]
  21. Hinz M., Krappmann D., Eichten A., Heder A., Scheidereit C., Strauss M. NF-{kappa}B function in growth control: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol. Cell. Biol., 19: 2690-2698, 1999.[Abstract/Free Full Text]
  22. Bargou C. R., Emmerich F., Krappmann D., Bommert K., Mapara M. Y., Arnold W., Royer H. D., Grinstein E., Greiner A., Scheidereit C., Dörken B. Constitutive NF-{kappa}B-RelA activation is required for proliferation and survival of Hodgkin’s disease tumor cells. J. Clin. Investig., 100: 2961-2969, 1997.[Medline]
  23. Bash J., Zong W-X., Gélinas C. c-Rel arrests the proliferation of Hela cells and affects critical regulators of the G1/S-phase transition. Mol. Cell. Biol., 17: 6526-6536, 1997.[Abstract]
  24. Seitz C. S., Lin Q., Deng H., Khavari P. A. Alterations in NF-{kappa}B function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-{kappa}B. Proc. Natl. Acad. Sci. USA, 95: 2307-2312, 1998.[Abstract/Free Full Text]
  25. Kontgen F., Grumont R. J., Strasser A., Metcalf D., Li R., Tarlinton D., Geronkadis S. Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleuin-2 expression. Genes Dev., 9: 1965-1977, 1995.[Abstract/Free Full Text]
  26. Takeda K., Takeuchi O., Tsujimura T., Itami S., Adachi O., Kawai T., Sanjo H., Yoshikawa K., Terada N., Akira S. Limb and skin abnormalities in mice lacking IKK{alpha}. Science (Washington DC), 284: 313-316, 1999.[Abstract/Free Full Text]
  27. Hu Y., Baud V., Delhase M., Zhang P., Deerinck T., Ellisman M., Johnson R., Karin M. Abnormal morphogenesis but intact IKK activation in mice lacking the IKK{alpha} subunit of I{kappa}B kinase. Science (Washington DC), 284: 316-320, 1999.[Abstract/Free Full Text]
  28. Wang C. Y., Mayo M. W., Korneluk R. G., Goeddel D. V., Baldwin A. S., Jr. NF-{kappa}B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science (Washington DC), 281: 1680-1683, 1998.[Abstract/Free Full Text]
  29. Chu Z-L., McKinsey A., Liu L., Gentry J. J., Malim M. H., Ballard D. W. Suppression of TNF-induced cell death by inhibitor of apoptosis c-IAP2 is under NF-{kappa}B control. Proc. Natl. Acad. Sci. USA, 94: 10057-10062, 1997.[Abstract/Free Full Text]
  30. Stehlik C., De Martin R., Kumabashiri I., Scmid J. A., Binder B. R., Lipp J. NF-{kappa}B-regulated XIAP gene expression protects endothelial cells from TNF{alpha}induced apoptosis. J. Exp. Med., 188: 211-216, 1998.[Abstract/Free Full Text]
  31. Grumont R. J., Rourke I. J., Gerondakis S. Rel-dependent induction of A1 transcription is required to protect B cells from antigen receptor ligation-induced apoptosis. Genes Dev., 13: 400-411, 1999.[Abstract/Free Full Text]
  32. Zong W. X., Edelstein L. C., Chen C., Bash J., Gelinas C. The prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcriptional target of NF-{kappa}B that blocks TNF{alpha}-induced apoptosis. Genes Dev., 13: 382-387, 1999.[Abstract/Free Full Text]
  33. Wang C-Y., Guttridge D. C., Mayo M. W., Baldwin A. S., Jr. NF-{kappa}B induces expression of the Bcl-2 homologue A1/Bfl-1 to preferentially suppress chemotherapy-induced apoptosis. Mol. Cell. Biol., 19: 5923-5929, 1999.[Abstract/Free Full Text]
  34. Lee H. H., Dadgostar H., Cheng Q., Shu J., Cheng G. NF-{kappa}B-mediated up-regulation of Bcl-x and Bfl-1/A1 is required for CD40 survival signaling in B lymphocytes. Proc. Natl. Acad. Sci. USA, 96: 9136-9141, 1999.[Abstract/Free Full Text]
  35. Tsukahara T., Kannagi M., Ohashi T., Kato H., Arai M., Nunez G., Iwanaga Y., Yamamoto N., Ohtani K., Nakamura M., Fujii M. Induction of bcl-xL expression by human T-cell leukemia virus type 1 Tax through NF-{kappa}B in apoptosis-resistant T-cell transfectants with Tax. J. Virol., 73: 7981-7987, 1999.[Abstract/Free Full Text]
  36. Mates J. M., Sanchez-Jimenez F. Antioxidant enzymes and their implications in pathophysiologic processes. Front. Biosci., 4: D339-D345, 1999.[Medline]
  37. Powis G., Briehl M., Oblong J. Redox signalling and the control of cell growth and death. Pharmacol. Ther., 68: 149-173, 1995.[Medline]
  38. Wong G. H., Goeddel D. V. Induction of MnSOD by TNF: possible protective mechanism. Science (Washington DC), 242: 941-944, 1988.[Abstract/Free Full Text]
  39. Ziegler E., Borman A. M., Kirchweger R., Skern T., Kean K. M. Foot-and-mouth disease virus Lb proteinase can stimulate rhinovirus and enterovirus IRES-driven translation and cleave several proteins of cellular and viral origin. J. Virol., 69: 3465-3474, 1995.[Abstract]
  40. Brownell E., Mittereder N., Rice N. R. A human rel proto-oncogene cDNA containing an Alu fragment as a potential coding exon. Oncogene, 4: 935-942, 1989.[Medline]
  41. Kinscherf R., Claus R., Wagner M., Gehrke C., Kamencic H., Hou D., Nauen O., Schmiedt W., Kovacs G., Pill J., Metz J., Deigner H. P. Apoptosis caused by oxidized LDL is MnSOD and p53 dependent. FASEB J., 12: 461-467, 1998.[Abstract/Free Full Text]
  42. Jones P. L., Ping D., Boss J. M. TNF{alpha} and IL-1ß regulate the murine manganese superoxide dismutase gene through a complex intronic enhancer involving C/EBP-ß and NF-{kappa}B. Mol. Cell. Biol., 17: 6970-6981, 1997.[Abstract]
  43. Maehara K., Hasegawa T., Xiao H., Takeuchi A., Abe R., Isobe K. Cooperative interaction of NF-{kappa}B and C/EBP binding sites is necessary for MnSOD gene transcription mediated by lipopolysaccharide and interferon-{gamma}. FEBS Lett., 449: 115-119, 1999.[Medline]
  44. Xu Y., Kiningham K. K., Devalaraja M. N., Yeh C. C., Majima H., Kasarskis E. J., St. Clair D. K. An intronic NF-{kappa}B element is essential for induction of the human MnSOD gene by TNF{alpha} and IL1ß. DNA Cell Biol., 18: 709-721, 1999.[Medline]
  45. Burdon R. H. Superoxide and hydrogen peroxide in relation to mammalian cell proliferation. Free Radic. Biol. Med., 18: 775-794, 1995.[Medline]
  46. Gamaley I. A., Klyubin I. V. Roles of reactive oxygen species: signaling and regulation of cellular functions. Int. Rev. Cytol., 188: 203-255, 1999.[Medline]
  47. Hennet T., Richter C., Peterhans E. TNF-{alpha} induces superoxide anion generation in mitochondria of L929 cells. Biochem. J., 289: 587-592, 1993.
  48. Wong G. H. W., Elwell J. H., Oberley L. W., Goeddel D. V. MnSOD is essential for cellular resistance to cytotoxicity of TNF. Cell, 58: 923-931, 1989.[Medline]
  49. De Haan J. B., Cristiano F., Iannello R., Bladier C., Kelner M. J., Kola I. Elevation in the ratio of Cu/Zn-SOD to glutathione peroxidase activity induces features of cellular senescence and this effect is mediated by hydrogen peroxide. Hum. Mol. Genet., 5: 283-292, 1996.[Abstract/Free Full Text]
  50. Li N., Zhai Y., Oberley T. D. Two distinct mechanisms for inhibition of cell growth in human prostate carcinoma cells with antioxidant enzyme imbalance. Free Radic. Biol. Med., 26: 1554-1568, 1999.[Medline]
  51. Zhong W., Oberley L. W., Oberley T. D., Yan T., Domann F. E., St. Clair D. K. Inhibition of cell growth and sensitization to oxidative damage by overexpression of MnSOD in rat glioma cells. Cell Growth Differ., 7: 1175-1186, 1996.[Abstract]
  52. Yan T., Oberley L. W., Zhong W., St Clair D. K. MnSOD overexpression causes phenotypic reversion in SV40-transformed human lung fibroblasts. Cancer Res., 56: 2864-2871, 1996.[Abstract/Free Full Text]
  53. Church S. L., Grant J. W., Ridnour L. A., Oberley L. W., Swanson P. E., Meltzer P. S., Trent J. M. Increased MnSOD expression suppresses the malignant phenotype of human melanoma cells. Proc. Natl. Acad. Sci. USA, 90: 3113-3117, 1993.[Abstract/Free Full Text]
  54. Hampton M. B., Fadeel B., Orrenius S. Redox regulation of the caspases during apoptosis. Ann. N. Y. Acad. Sci., 854: 328-335, 1998.[Medline]
  55. Hockenbery D. M., Oltvai Z. N., Yin X. M., Milliman C. L., Korsmeyer S. J. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell, 75: 241-251, 1993.[Medline]
  56. Chaturvedi V., Qin J. Z., Denning M. F., Choubey D., Diaz M. O., Nickoloff B. J. Apoptosis in proliferating, senescent, and immortalized keratinocytes. J. Biol. Chem., 274: 23358-23367, 1999.[Abstract/Free Full Text]
  57. Ryan K. M., Ernst M. K., Rice N. R., Vousden K. H. Role of NF-{kappa}B in p53-mediated programmed cell death. Nature (Lond.), 404: 892-897, 2000.[Medline]
  58. Levine A. J. p53, the cellular gatekeeper for growth and division. Cell, 88: 323-331, 1997.[Medline]
  59. Manna S. K., Aggarwal B. B. Lipopolysaccharide inhibits TNF-induced apoptosis: role of NF-{kappa}B activation and reactive oxygen intermediates. J. Immunol., 162: 1510-1518, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 IOVSHome page
W. Fan and N. G. F. Cooper
Glutamate-Induced NF{kappa}B Activation in the Retina
Invest. Ophthalmol. Vis. Sci., February 1, 2009; 50(2): 917 - 925.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y.-B. Lim, T. J. Park, and I. K. Lim
B Cell Translocation Gene 2 Enhances Susceptibility of HeLa Cells to Doxorubicin-induced Oxidative Damage
J. Biol. Chem., November 28, 2008; 283(48): 33110 - 33118.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
R. Hrdlickova, J. Nehyba, A. S. Liss, and H. R. Bose Jr.
Mechanism of Telomerase Activation by v-Rel and Its Contribution to Transformation
J. Virol., January 1, 2006; 80(1): 281 - 295.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. Papa, F. Zazzeroni, C. G. Pham, C. Bubici, and G. Franzoso
Linking JNK signaling to NF-{kappa}B: a key to survival
J. Cell Sci., October 15, 2004; 117(22): 5197 - 5208.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
D. Bernard, K. Gosselin, D. Monte, C. Vercamer, F. Bouali, A. Pourtier, B. Vandenbunder, and C. Abbadie
Involvement of Rel/Nuclear Factor-{kappa}B Transcription Factors in Keratinocyte Senescence
Cancer Res., January 15, 2004; 64(2): 472 - 481.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Pizzi, F. Goffi, F. Boroni, M. Benarese, S. E. Perkins, H.-C. Liou, and P. Spano
Opposing Roles for NF-kappa B/Rel Factors p65 and c-Rel in the Modulation of Neuron Survival Elicited by Glutamate and Interleukin-1beta
J. Biol. Chem., May 31, 2002; 277(23): 20717 - 20723.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Bernard, B. Quatannens, B. Vandenbunder, and C. Abbadie
Rel/NF-kappa B Transcription Factors Protect against Tumor Necrosis Factor (TNF)-related Apoptosis-inducing Ligand (TRAIL)-induced Apoptosis by Up-regulating the TRAIL Decoy Receptor DcR1
J. Biol. Chem., July 13, 2001; 276(29): 27322 - 27328.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernard, D.
Right arrow Articles by Abbadie, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernard, D.
Right arrow Articles by Abbadie, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online