| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
National Cancer Institute, NIH, Bethesda, Maryland 20892
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
B (7)
. The DR4, DR5, DcR1, and DcR2 genes are tightly clustered on human chromosome 8p2221 (5
, 7)
, suggesting that they have been derived from a common ancestor by gene duplication. A fifth TRAIL receptor, osteoprotegerin, exists in a soluble form and inhibits apoptosis by interfering with the binding of TRAIL to the DR4 and DR5 receptors (8)
. In contrast to Fas ligand, the expression of which is limited to cells of the immune system (9)
and a few immune-privileged sites (10, 11, 12)
, TRAIL is expressed in a wide range of normal fetal and adult tissues (13)
and induces apoptosis only in transformed and malignant cells (3)
, thus constituting a promising new candidate for cancer treatment. ESFTs comprise a biologically distinct group of bone and/or soft tissue sarcomas in children and young adults characterized by specific chromosomal translocations. After osteosarcomas, ESFTs are the most common malignant osseous neoplasms in this age group. Patients with recurrent or metastatic disease at presentation have bad outcomes because of poor tumor response to standard chemotherapy (14) . Therefore, there is a need for novel agents or therapeutic strategies. Our previous studies have shown that ESFTs undergo Fas-mediated apoptosis in vitro, but this response is not universal (15) . This and the finding that treatment of mice with a Fas-activating monoclonal antibody leads to liver failure from massive hepatocellular apoptosis (16) suggest that exogenous activation of the Fas pathway may not be as promising as originally thought.
In this study, we explored the effectiveness of human rTRAIL in ESFT cell lines and its possible mode of action. We found that TRAIL induced apoptosis through a caspase-mediated pathway in all but one of the 10 cell lines tested, even in lines that were Fas resistant. The nonresponding line was sensitized after transfection of the missing DR5 receptor. More importantly, we found that the apoptosis-inducing TRAIL receptors, DR4 and DR5, were widely expressed in ESFTs, not only in vitro but also in vivo, suggesting that TRAIL may be applied effectively in the treatment of ESFT.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Tumor Tissues
For the immunohistochemical studies, formalin-fixed, paraffin-embedded tumor tissues from 32 patients with ESFTs were obtained from the files of the Laboratory of Pathology at the National Cancer Institute.
Reagents
Human recombinant His-tagged soluble TRAIL was obtained from Biomol (Plymouth Meeting, PA), and human recombinant LZ-tagged soluble TRAIL was from Immunex (Seattle, WA). Goat polyclonal antibodies for DR4, DR5, DcR1, FADD, and the long form of cellular FLIP (antibody C19) and rabbit polyclonal antibodies for caspase-3 and Fas were purchased from Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA). Monoclonal antibodies for caspase-8 and caspase-10 were purchased from Upstate Biotechnologies (Lake Placid, NY) and for caspase-9 from Santa Cruz Biotechnologies. The anti-DcR2 rabbit polyclonal antibody was purchased from Imgenex (San Diego, CA). The monoclonal antibodies 4E7 and 3F11 that were used in flow cytometry for cell surface detection of DR4 and DR5 (18)
, respectively, were supplied by Dr. A. Ashkenazi (Genentech, San Francisco, CA).
Survival and Death Assays
MTT Colorimetric Assay.
This assay was performed as described previously (15)
. In brief, cells untreated or treated with His-tagged rTRAIL (0.5, 1, or 2 µg/ml) for 18 h in serum-free DMEM at 37°C were incubated with MTT (1 mg/ml; Sigma) for 4 h. Absorbance was measured by spectrophotometry.
TUNEL Method.
After treatment with His-tagged rTRAIL (1 µg/ml for 18 h), air-dried cytospins were labeled with the In Situ Cell Death kit-Fluorescence (Roche Molecular Biochemicals, Indianapolis, IN), following the instructions of the manufacturer, and were viewed with a Zeiss standard fluorescence microscope.
Electron Microscopy.
Cells treated with His-tagged rTRAIL (1 µg/ml for 18 h) or untreated were pelleted and fixed in 2.5% glutaraldehyde in phosphate buffer (pH 7.4) for 24 h, postfixed in OsO4, and embedded in Maraglas 655 (Ladd Research Industries, Burlington, VT). Sections were stained with uranyl acetate and lead citrate and examined in a Philips CM10 electron microscope.
Annexin V Labeling.
Early apoptosis was quantified with the Annexin V-PI detection kit (Immunotech/Beckman Coulter, Miami FL). Briefly, 106 SK-N-MC cells before and after treatment with His-tagged rTRAIL (1 µg/ml for 4 h) were labeled with fluorescein-conjugated Annexin V and PI and analyzed by dual-color cytometry using an EPICS-XL-MCL flow cytometer (Coulter, Hialeah, FL). Cells that were PI negative (i.e., with intact cellular membrane) and Annexin V positive were considered as early apoptotic cells. Annexin detects phosphatidylserine, which translocates from the inner to the outer leaflet of the plasma membrane during early apoptosis (19)
.
Apo2.7 Labeling.
Quantification of late apoptosis was determined in SK-N-MC cells before and after treatment with His-tagged rTRAIL (1 µg/ml for 18 h). The cells were immunostained with the Apo2.7 PE-conjugated monoclonal antibody (Immunotech/Beckman-Coulter, Miami, FL) according to the manufacturers instructions and analyzed by flow cytometry. Apo2.7 specifically detects the Mr 38,000 mitochondrial membrane antigen 7A6, which is exclusively exposed on the cell membrane of apoptotic cells and can therefore be used as a late apoptotic marker in nonpermeabilized cells (20
, 21) .
Comparative Treatment with His-tagged and LZ TRAIL
To compare the potency of the His-tagged soluble TRAIL that we used in our experiments to that of the LZ-tagged soluble TRAIL used by others (22
, 23)
, we treated SK-N-MC cells for 18 h with various concentrations of the two available forms of TRAIL and evaluated cell death with the MTT assay. Dose-response curves were drawn, and LD50s were calculated for both forms with the help of the STATISTICA software (StatSoft, Tulsa, OK).
Multiplex RT-PCR
Total RNA was isolated with the Trizol reagent (Life Technologies, Inc.) according to the instructions of the manufacturer. Two µg of the RNA were reversely transcribed into cDNA with the Superscript kit (Life Technologies, Inc.) using random hexamers. To compensate for variations in the quality or quantification of RNA or tube-to-tube variation in the reverse transcription and PCR reactions, we performed multiplex RT-PCR using sets of primers for DR5 and for the 18S RNA, which was used as an internal standard (QuantumRNA 18S internal standards, Ambion, Austin, TX). For DR5, the GGCAAGTCTCTCTCCCAGCGTCTC forward and GGGAGCCGCTCATGAGGAA-GTTGG reverse primers were used. For 18S RNA, we used a mixture of primers and competimers, modified at their 3' ends to block extension by DNA polymerase. By mixing 18S primers with increasing amounts of 18S competimers, the overall PCR amplification efficiency of 18S is reduced to match the amplification efficiency of the less abundant DR5 transcript. We used a 3:7 ratio of primers to competimers, which is suitable for moderately expressed transcripts, such as DR5. Two µl of the transcription reaction were subjected to quantitative multiplex PCR using the above primers. The PCR cycles were: 95°C for 5 min, 35 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, and 72°C for 5 min. The PCR products were subjected to agarose gel electrophoresis and visualized under UV light.
Immunohistochemistry
Immunohistochemical detection of DR4 and DR5 in ESFT tissues was performed as described previously (24)
. The primary goat polyclonal antibodies, anti-DR4 (1:100 dilution) and anti-DR5 (1:50 dilution), respectively, were applied overnight in the presence or absence of a 10-fold excess of the corresponding blocking peptides. The peroxidase reaction was developed with 3,3'-diaminobenzidine, and the slides were counterstained with hematoxylin. Positive staining was evaluated subjectively by two independent observers.
Western Blot Analysis
TRAIL receptor protein expression was evaluated by Western blotting, as described previously (15)
. Blotted membranes were immunostained with anti-DR4, anti-DR5, anti-DcR1, and anti-DcR2 antibodies (1:500). The potential involvement of caspases in TRAIL-induced apoptosis and the kinetics of caspase activation were evaluated in the SK-N-MC cells before and after treatment with 1 µg/ml His-tagged rTRAIL for 0, 0.5, 1, and 4 h. Thirty µg of protein extracted at the above time points were electrophoresed, electroblotted, and immunostained with antibodies against caspase-3, caspase-8, caspase-9, and caspase-10 (1:500). The proteins were visualized with the enhanced chemiluminescence technique (Amersham Pharmacia Biotech, Piscataway, NJ).
Flow Cytometry for DR4 and DR5
Cells (106) cells from the CHP-100S, CHP-100 L, SK-N-MC, TC-71, and TC-268 lines, and the cervical adenocarcinoma HeLa cells which served as a positive control, were incubated for 45 min with the 4E7 and 3F11 monoclonal antibodies against DR4 and DR5 receptors or with their respective isotype controls (5.0 µg/ml). Subsequently, the cells were washed with PBS, incubated for 45 min with goat antimouse IgG FITC-conjugated F(ab')2 fragment (2 µg/ml, Jackson Immunoresearch Laboratories, West Grove, PA), washed, fixed in 1% formaldehyde in PBS, and analyzed by flow cytometry.
TRASC Assay
To study the proteins that are recruited to the TRAIL receptors upon stimulation, SK-N-MC cells unstimulated or treated with 1 µg/ml His-tagged rTRAIL for 30 min were harvested and lysed in a lysis buffer consisting of 20 mM HEPES (pH 7.4), 200 mM NaCl, and 1% Igepal, and supplemented with proteinase inhibitors (1 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 2 µg/ml leupeptin, and 1 µg/ml pepstatin). The samples were cleared by microcentrifugation (14,000 rpm for 30 min at 4°C) and incubated with 1 µg/ml His-tagged rTRAIL for 4 h at 4°C. The His-tagged rTRAIL and all associated proteins were precipitated with Ni2+-conjugated agarose beads (Qiagen, Valencia, CA) for 2 h at 4°C, electrophoresed in a 12% SDS-PAGE, electroblotted onto nitrocellulose membranes, and immunoblotted with antibodies against the DR4 and DR5 receptors, as well as against caspase-8 and caspase-10 and the adaptor molecule FADD.
Protein Synthesis Inhibition and Sensitivity to TRAIL
To investigate the potential involvement of antiapoptotic proteins in the resistance of the CHP-100S cells to TRAIL, we treated these cells with His-tagged rTRAIL (1 µg/ml for 18 h) in the presence or absence of the protein synthesis inhibitor cycloheximide (concentration range, 0.310 µg/ml). Cell survival was evaluated with the MTT assay.
Transfection of DR5 Expression Vector
Because the only TRAIL-resistant ESFT cell line CHP-100S lacked DR5 expression, we studied whether restoration of DR5 expression would sensitize the CHP-100S cells to TRAIL. The cells were plated in six-well plates and transfected with 2 µg of the pcDNA3.1-GeneStorm mammalian expression vector encoding the human DR5 gene (Invitrogen, Carlsbad, CA) or the empty vector, using the Superfect reagent (Qiagen). Forty-eight h later, the cells were treated with His-tagged rTRAIL (1 µg/ml for 18 h), and cell survival was evaluated with the MTT assay.
Statistical Analysis
Statistical comparisons were performed with the one-factor ANOVA method, followed by Duncans test. Significance was set at 0.05.
| RESULTS |
|---|
|
|
|---|
|
80% apoptotic cells after treatment with 1 µg/ml of His-tagged rTRAIL for 4 and 18 h, respectively. This finding indicated that the MTT-obtained values of cell death were representative of apoptotic death.
|
|
|
|
TRAIL Receptor Expression in ESFT Tissues.
Expression of DR4 and DR5 has been studied at the mRNA level (4
, 23
, 27
, 28)
and recently at the protein level (27
, 29) in tumor cell lines. Tumor tissues were evaluated only in one study (30)
, in which DR4 and DR5 transcripts were studied in a panel of 35 brain tumors by RT-PCR. In the present study, in addition to evaluating expression of TRAIL receptors in ESFT cell lines, we evaluated DR4 and DR5 protein expression in tissue sections from a panel of 32 ESFT tumors, using an immunohistochemical method that allowed the use of archival material and morphological correlations. We found that 23 of 32 tissues (72%) expressed both receptors, and 8 of 32 (25%) expressed one receptor. Specifically, 7 of 32 were positive for DR4 only, and 1 of 32 was positive for DR5 only. One tumor was negative for both receptors. The cellular pattern of immunostaining was cytoplasmic and membranous, whereas the architectural pattern was diffuse for both receptors (Fig. 5, E and F)
. Immunoreactivity for DR4 was overall stronger and more widespread than that for DR5. However, the importance of this observation is unclear, given that it could also be attributable to variable sensitivity of the antibodies. Preincubation of each antibody with the respective blocking peptide completely abolished the immunostaining, confirming the specificity of the technique.
Caspase Activation in TRAIL-induced Apoptosis.
TRAIL-induced apoptosis is characterized by activation of caspase-8, caspase-10, caspase-9, and caspase-3 in transfection experiments (2, 3, 4)
. Because caspase-8 activation preceded caspase-3 activation in TRAIL-sensitive cells, caspase-8 was considered to be one of the proximal components in the TRAIL signaling pathway (23)
. We investigated the endogenous caspase activation in ESFT cells upon TRAIL stimulation. We found that caspase-10 was first to be cleaved at 30 min, followed by cleavage of caspase-8 at 1 h and of caspase-9 and caspase-3 at 4 h. (Fig. 6A)
. Because the cleavage of caspases is an indication of their activation, we concluded that TRAIL-induced apoptosis in ESFTs involves caspase activation, and caspase-10 is more proximal than the other caspases in the signaling pathway.
|
FLIP Expression and TRAIL Resistance.
Because elevated FLIP levels can inhibit signals from death receptors including those of TRAIL and because elevated FLIP levels have been associated with Fas or TRAIL resistance in some reports (23
, 34
, 35)
, we evaluated the amount of this protein by Western blotting in cellular lysates from two pairs of ESFT cell lines. In the first pair, both lines were sensitive to TRAIL, but one was Fas sensitive (parental SK-N-MC) and the other FR (SK-N-MC-FR). In the second pair, one line (CHP-100 L) was both TRAIL and Fas sensitive, and the other (CHP-100S), both TRAIL and FR (17)
. We found that although the levels of FLIP were elevated in the FR clones (SK-N-MC-FR and CHP-100S), only one of them (CHP-100S) was resistant to TRAIL (Fig. 7A)
. The other (SK-N-MC-FR) was highly sensitive to TRAIL. This finding does not support a causative role for FLIP in the resistance of this line to TRAIL.
|
Cell Surface Expression of DR4 and DR5 in ESFT Cell Lines.
Because reintroduction of DR5 and not treatment with cycloheximide reversed TRAIL resistance in CHP-100S cells, we concluded that there is a defect at the receptor level and not in the downstream signaling pathway. However, because CHP-100S cells expressed DR4 and previous studies have shown that DR4 and DR5 are independently sufficient to transmit apoptotic signals (2
, 3
, 29)
, we hypothesized that DR4 may have been functionally inactivated. We therefore studied its cellular localization by flow cytometry and found that it is absent from the cell surface of CHP-100S cells (Fig. 8A)
, in contrast to HeLa cells that have been previously reported positive for surface DR4 (26)
and served as a positive control (Fig. 8B)
. These data support that the resistance of CHP-100S cells to TRAIL is not only because of their lack of DR5 but also because of their failure to translocate DR4 to the cell surface. We then expanded our analysis in four additional ESFT cell lines that had been positive for DR4 protein by immunoblotting and found that two of them [CHP-100 L (Fig. 8C)
and SK-N-MC (Fig. 8D)
] lacked surface expression for DR4, whereas the other two [TC-71 (Fig. 8E)
and TC-268 (Fig. 8F)
] expressed DR4 on the cell surface. This heterogeneous pattern of cell surface localization and discrepancy between protein levels and cell surface expression were not observed for DR5, as the latter was detected by flow cytometry in all four studied lines that were positive by immunoblotting (Fig. 8, GJ)
.
|
| DISCUSSION |
|---|
|
|
|---|
The observed high sensitivity of ESFT to TRAIL suggests the presence of functional DR4 and DR5. Previous studies have shown expression of DR4 and DR5 transcripts in human tumor cell lines (22 , 25 , 27 , 39) and tissues (30) . We have studied the expression of the DR4 and DR5, not only in ESFT cell lines, but also in tissue sections of 32 ESFT cases. We found that a high percentage of ESFTs expressed the apoptosis-inducing receptors in vivo. Specifically, 72% expressed both DR4 and DR5, 25% expressed only one, and 3% were negative for both. The staining was diffuse within tumor sections and was seen both in the cytoplasm and the cell membranes.
We also showed that upon stimulation of ESFT cells with TRAIL, there was initial activation of caspase-10, followed by activation of caspase-8, caspase-3, and caspase-9, indicating that TRAIL induces both receptor-mediated and mitochondrial intrinsic pathways. Furthermore, using an assay that allowed coprecipitation and immunodetection of all endogenous proteins that bind to TRAIL upon activation, we found that caspase-10 is preferentially recruited to the TRASC in ESFT cells. These findings support that caspase-10 is the apical caspase in the TRAIL pathway of ESFT cells, in contrast to caspase-8, which has a prominent role in the Fas and tumor necrosis factor receptor 1 pathways (1) . Interaction of caspase-10 with TRAIL receptors has been shown in cells cotransfected with plasmids encoding the respective genes (3) , but our study shows recruitment of endogenous caspase-10 to the TRASC. Although recent studies have shown recruitment of endogenous caspase-8 to the TRASC (18 , 33) , they were undertaken in other tissues (human B and T cells, colon, breast and lung carcinoma cell lines, and a rhabdomyosarcoma cell line), and thus, the observed differences may be tissue dependent. We also found activation of caspase-8, but this occurred at a later time, suggesting that caspase-8 may be secondarily activated by caspase-10 to amplify the apoptotic signal. The essential role of caspase-10 in TRAIL-induced apoptosis is also supported by the previous finding of only partial inhibition of DR4- or DR5-induced cell death by a dominant-negative caspase-8 and complete inhibition by a dominant-negative caspase-10 (3) and by the finding that inherited caspase-10 mutations in patients with autoimmune lymphoproliferative syndrome type II are associated with resistance of their lymphocytes and dendritic cells to TRAIL (46) . The involvement of the adaptor molecule FADD in the transmission of the death signal by TRAIL has also been controversial. In some studies, FADD was shown to associate with DR4 and DR5 in cotransfection experiments (32) , and overexpression of a dominant-negative FADD construct inhibited TRAIL-induced apoptosis (31 , 32) . Similarly, recruitment of endogenous FADD to the TRASC was found in lymphoma cells also recruiting caspase-8, as discussed above, and FADD-deficient Jurkat cells were resistant to TRAIL-induced apoptosis (18 , 33) . In other studies, however, the dominant-negative FADD construct did not inhibit TRAIL-induced apoptosis (2 , 3) , and endogenous FADD was not recruited to the TRASC (47) , as in this study. Although one could argue that extremely high levels of a dominant-negative FADD protein, such as those obtained by transfection, may initiate nonphysiological interactions with the TRAIL receptors and thus show an inhibitory effect (48) , this would not explain why FADD-deficient Jurkat cells are TRAIL resistant. On the other hand, cells from FADD-deficient mice remained sensitive to TRAIL-induced apoptosis (49) . These conflicting data could be reconciled if one speculated that FADD is used only in some tumors, specifically those recruiting caspase-8 instead of caspase-10 to the TRASC, and that a yet unidentified molecule is responsible for the linkage of TRAIL receptors with caspase-10. However, more studies are necessary to clarify this issue.
Previous studies have shown that inhibition of RNA or protein synthesis may increase the sensitivity to Fas-mediated (50) , or TRAIL-induced (23 , 39) apoptosis in respectively resistant cell lines, suggesting the presence of a short-lived antiapoptotic protein(s) in some tumors (23) . However, in this study we found that cycloheximide did not sensitize the CHP-100S cells to TRAIL, which would speak against the presence of intracellular inhibitory proteins. Therefore, it is not surprising that we found no correlation between levels of FLIP expression and TRAIL sensitivity in the ESFT cell lines. Although we found elevated levels of FLIP in the TRAIL-resistant CHP-100S line, we also found elevated FLIP levels in the TRAIL-sensitive SK-N-MC-FR clone. The role of FLIP in inhibiting TRAIL-induced apoptosis is controversial. Elevated FLIP levels have been shown to inhibit Fas-mediated and TRAIL-induced apoptosis and to correlate with susceptibility to TRAIL on some occasions (23 , 34 , 35) but not in others (27) . Because the inhibitory role of FLIP depends on its recruitment to the receptor complexes through binding with FADD and caspase-8 or caspase-10 (34 , 35 , 51) and because FADD is missing from some TRAIL receptor complexes, as shown here and in previous studies (2 , 3 , 47) , it is possible that FLIP may exert an inhibitory role in some but not all TRAIL pathways. Alternatively, equal levels of FLIP may be inhibitory only in tumors with low DR4 or DR5 receptor levels, as discussed previously (51) .
TRAIL resistance in the only ESFT cell line in this study was attributable to regulation at the DR level. Specifically, we found that all TRAIL-sensitive lines expressed significant levels of both DR4 and DR5, whereas the resistant one lacked expression of DR5 protein and RNA. More importantly, restoration of the levels of the DR5 receptor with transfection of a DR5-expressing vector rendered the TRAIL-resistant cell line sensitive to TRAIL. The finding of cell death only in 33% of the DR5-transfected cells can be explained by the nature of the transient transfection, which yields a mixed population of DR5-positive and DR5-negative cells. These data support that restricted DR expression, or lack thereof, may be an important mechanism by which ESFT cells become resistant to TRAIL. The importance of the DRs in TRAIL-induced apoptosis has been reported in other tumors as well. Specifically, previous studies have shown that TRAIL-resistant tumors may lack the DR genes and proteins (27 , 52 , 53) or may exhibit functional inactivation of the receptors, either by lack of expression on the cell surface, as reported for melanomas (27) , or by the presence of structural abnormalities, as in the case of DR5 mutations in head and neck cancers (54) and of the polymorphism at codon 441 in the death domain of DR4, which acts in a dominant-negative fashion (53) . Because DR4 and DR5 are independently sufficient to transmit apoptotic signals, as shown in previous studies (2 , 3 , 18 , 29) , and the TRAIL-resistant line in this study expressed DR4 protein, we hypothesized that the DR4 receptor had been functionally inactivated. This was supported by our finding of absence of DR4 from the surface of the TRAIL-resistant cell line. Interestingly, two additional cell lines from a panel of four tested TRAIL-sensitive lines also lacked surface expression of DR4 but not DR5. Similar results were obtained in a previous study in which DR4 was expressed in the cytoplasm and at the mRNA level but was absent from the cell surface, whereas DR5 did not show such a discrepancy (27) . These findings suggest that posttranslational dysregulation of the DR4 receptor may be yet another mechanism by which tumor cells become resistant to TRAIL, as shown previously for Fas, another member of this receptor superfamily (55) . Although many tumors have been reported to lack DR4 expression, absence of DR5, as shown in this study both in vitro and in vivo (7 of 32 tumors), is a less common phenomenon (18 , 52 , 53 , 56) . Yet DR5 may have higher affinity for TRAIL at physiological temperature (57) and is up-regulated by chemotherapeutic agents (53 , 56 , 58) . Therefore, its absence may have implications in chemotherapy-related tumor cell responses.
Resistance to TRAIL has also been attributed to the presence of DcR1 and DcR2, which cannot transduce the apoptotic signal, thus functioning as decoy receptors (3 , 4 , 6 , 7 , 59, 60, 61) . Although overexpression of either of these proteins protected cells from TRAIL cytotoxicity (3 , 4 , 60) , we found that, in ESFT cell lines, levels of decoy receptor expression did not correlate with resistance to TRAIL. Similar results have been obtained in melanoma and breast carcinoma cell lines (23 , 28) and brain tumor tissues (4 , 30) . Recently, the hypothesis of the decoy receptors was tested with DR4- and DR5-activating antibodies that induced apoptosis only in TRAIL-sensitive lines, regardless of the presence or absence of decoy receptors, thus showing that the decoy receptors are not protective under physiological conditions (29) . Therefore, although we found that both decoy receptors were expressed in a high percentage of ESFT tissue specimens (data not shown), it is unlikely that they will have a significant biological role in vivo.
In conclusion, we have shown that TRAIL effectively and specifically kills ESFT cells by engaging the DR4 and DR5 DRs and activating a cascade of caspases that begins at caspase-10. Caspase-8 is also activated but is not recruited to the TRASC, similarly to the adaptor molecule FADD. These data show that the TRAIL receptor signaling pathway differs from that of Fas (1)
and may be used differentially by ESFT cells. This would explain the susceptibility of the FR ESFT cell lines to TRAIL. Our finding of a wide expression of DR4 and DR5 receptors in ESFTs, both in vitro and in vivo, supports that ESFTs are likely to have a high response rate to TRAIL in vivo. Resistance of ESFTs to TRAIL was rare, and when present, was attributable to the complete absence of one receptor and lack of surface expression of the other. Furthermore, it was not overcome by protein synthesis inhibition but by restoration of the missing DR5 receptor. The above data suggest that TRAIL is a novel agent with excellent therapeutic potential in ESFTs. Because TRAIL has been shown recently to have strong antitumor activity in mice (22
, 62)
and monkeys (37)
and to be nontoxic to normal cells in vitro and in vivo (22
, 37)
, in contrast to the Fas-activating antibody (16)
and to tumor necrosis factor-
(63, 64, 65)
, it appears to have superiority over other apoptosis-inducing agents in the treatment of malignant tumors.
| FOOTNOTES |
|---|
1 To whom requests for reprints should be addressed, at Laboratory of Pathology, NIH, Building 10, Room 2A-10, Bethesda, MD 20892. Phone: (301) 496-3159; Fax: (301) 480-9197; E-mail: mtsokos{at}box-m.nih.gov ![]()
2 The abbreviations used are: DR, death receptor; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; rTRAIL, recombinant TRAIL; ESFT, Ewings sarcoma family tumor; FR, Fas resistant; LZ, leucine-zipper; FLIP, FLICE inhibitory protein; FADD, Fas-associated death domain; TRASC, TRAIL-associated signaling complex; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PI, propidium iodide; PE, phycoerythrin; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP end-labeling; RT-PCR, reverse transcription-PCR. ![]()
Received 1/27/00. Accepted 1/11/01.
| REFERENCES |
|---|
|
|
|---|
B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity, 7: 813-820, 1997.[Medline]
B pathway. Immunity, 7: 821-830, 1997.[Medline]
B. Immunity, 7: 831-836, 1997.[Medline]
. Cancer Res., 58: 1593-1598, 1998.
B kinase and c-Jun N-terminal kinase. Mol. Cell. Biol., 20: 6638-6645, 2000.
administered three times weekly. Cancer Res., 51: 1651-1658, 1991.This article has been cited by other articles:
![]() |
C.-C. Yeh, Y.-T. Deng, D.-Y. Sha, M. Hsiao, and M. Y.-P. Kuo Suberoylanilide hydroxamic acid sensitizes human oral cancer cells to TRAIL-induced apoptosis through increase DR5 expression Mol. Cancer Ther., September 1, 2009; 8(9): 2718 - 2725. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mongiat, G. Ligresti, S. Marastoni, E. Lorenzon, R. Doliana, and A. Colombatti Regulation of the Extrinsic Apoptotic Pathway by the Extracellular Matrix Glycoprotein EMILIN2 Mol. Cell. Biol., October 15, 2007; 27(20): 7176 - 7187. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida, T. Maoka, S. K. Das, K. Kanazawa, M. Horinaka, M. Wakada, Y. Satomi, H. Nishino, and T. Sakai Halocynthiaxanthin and Peridinin Sensitize Colon Cancer Cell Lines to Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Mol. Cancer Res., June 1, 2007; 5(6): 615 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lissat, T. Vraetz, M. Tsokos, R. Klein, M. Braun, N. Koutelia, P. Fisch, M. E. Romero, L. Long, P. Noellke, et al. Interferon-{gamma} Sensitizes Resistant Ewing's Sarcoma Cells to Tumor Necrosis Factor Apoptosis-Inducing Ligand-Induced Apoptosis by Up-Regulation of Caspase-8 Without Altering Chemosensitivity Am. J. Pathol., June 1, 2007; 170(6): 1917 - 1930. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S.K. de Hooge, D. Berghuis, S. J. Santos, E. Mooiman, S. Romeo, J. A. Kummer, R. M. Egeler, M. J.D. van Tol, C. J.M. Melief, P. C.W. Hogendoorn, et al. Expression of Cellular FLICE Inhibitory Protein, Caspase-8, and Protease Inhibitor-9 in Ewing Sarcoma and Implications for Susceptibility to Cytotoxic Pathways Clin. Cancer Res., January 1, 2007; 13(1): 206 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nakata, T. Yoshida, T. Shiraishi, M. Horinaka, J. Kouhara, M. Wakada, and T. Sakai 15-Deoxy-{Delta}12,14-prostaglandin J2 induces death receptor 5 expression through mRNA stabilization independently of PPAR{gamma} and potentiates TRAIL-induced apoptosis. Mol. Cancer Ther., July 1, 2006; 5(7): 1827 - 1835. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Horinaka, T. Yoshida, T. Shiraishi, S. Nakata, M. Wakada, and T. Sakai The dietary flavonoid apigenin sensitizes malignant tumor cells to tumor necrosis factor-related apoptosis-inducing ligand. Mol. Cancer Ther., April 1, 2006; 5(4): 945 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lane, M. Cote, R. Grondin, M.-C. Couture, and A. Piche Acquired resistance to TRAIL-induced apoptosis in human ovarian cancer cells is conferred by increased turnover of mature caspase-3. Mol. Cancer Ther., March 1, 2006; 5(3): 509 - 521. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Rowinsky Targeted Induction of Apoptosis in Cancer Management: The Emerging Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Receptor Activating Agents J. Clin. Oncol., December 20, 2005; 23(36): 9394 - 9407. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. H. Engels, G. Totzke, U. Fischer, K. Schulze-Osthoff, and R. U. Janicke Caspase-10 Sensitizes Breast Carcinoma Cells to TRAIL-Induced but Not Tumor Necrosis Factor-Induced Apoptosis in a Caspase- 3-Dependent Manner Mol. Cell. Biol., April 1, 2005; 25(7): 2808 - 2818. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Merchant, X. Yang, F. Melchionda, M. Romero, R. Klein, C. J. Thiele, M. Tsokos, H. U. Kontny, and C. L. Mackall Interferon {gamma} Enhances the Effectiveness of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Receptor Agonists in a Xenograft Model of Ewing's Sarcoma Cancer Res., November 15, 2004; 64(22): 8349 - 8356. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Spierings, E. G. de Vries, E. Vellenga, F. A. van den Heuvel, J. J. Koornstra, J. Wesseling, H. Hollema, and S. de Jong Tissue Distribution of the Death Ligand TRAIL and Its Receptors J. Histochem. Cytochem., June 1, 2004; 52(6): 821 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gorlick, P. Anderson, I. Andrulis, C. Arndt, G. P. Beardsley, M. Bernstein, J. Bridge, N.-K. Cheung, J. S. Dome, D. Ebb, et al. Biology of Childhood Osteogenic Sarcoma and Potential Targets for Therapeutic Development: Meeting Summary Clin. Cancer Res., November 15, 2003; 9(15): 5442 - 5453. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. J. Spierings, E. G. E. de Vries, W. Timens, H. J. M. Groen, H. M. Boezen, and S. de Jong Expression of TRAIL and TRAIL Death Receptors in Stage III Non-Small Cell Lung Cancer Tumors Clin. Cancer Res., August 1, 2003; 9(9): 3397 - 3405. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yang, M. S. Merchant, M. E. Romero, M. Tsokos, L. H. Wexler, U. Kontny, C. L. Mackall, and C. J. Thiele Induction of Caspase 8 by Interferon {gamma} Renders Some Neuroblastoma (NB) Cells Sensitive to Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) but Reveals That a Lack of Membrane TR1/TR2 Also Contributes to TRAIL Resistance in NB Cancer Res., March 1, 2003; 63(5): 1122 - 1129. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Poulaki, C. S. Mitsiades, V. Kotoula, S. Tseleni-Balafouta, A. Ashkenazi, D. A. Koutras, and N. Mitsiades Regulation of Apo2L/Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Induced Apoptosis in Thyroid Carcinoma Cells Am. J. Pathol., August 1, 2002; 161(2): 643 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mitsiades, C. S. Mitsiades, V. Poulaki, K. C. Anderson, and S. P. Treon Intracellular regulation of tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in human multiple myeloma cells Blood, March 15, 2002; 99(6): 2162 - 2171. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |