
[Cancer Research 61, 2704-2712, March 15, 2001]
© 2001 American Association for Cancer Research
Ewings Sarcoma Family Tumors Are Sensitive to Tumor Necrosis Factor-related Apoptosis-inducing Ligand and Express Death Receptor 4 and Death Receptor 5
Nicholas Mitsiades,
Vassiliki Poulaki,
Constantine Mitsiades and
Maria Tsokos1
National Cancer Institute, NIH, Bethesda, Maryland 20892
 |
ABSTRACT
|
|---|
In this study, we investigated the sensitivity of Ewings sarcoma family tumors (ESFTs) of children and adolescents to the tumor necrosis factor-related apoptosis-inducing Ligand (TRAIL). TRAIL binds to death receptors (DRs) DR4, DR5, DcR1, and DcR2. Either DR4 or DR5 can induce apoptosis, whereas DcR1 and DcR2 are considered inhibitory receptors. Nine of 10 ESFT cell lines, including several that were Fas resistant, underwent apoptosis with TRAIL through activation of caspase-10, capase-8 (FLICE), caspase-3, and caspase-9. In contrast to the Fas signaling pathway, caspase-10, but not caspase-8 or the Fas-associated death domain-containing molecule, was recruited to the TRAIL receptor-associated signaling complex. We found that 9 of 10 ESFT cell lines expressed both DR4 and DR5 by Western blotting, whereas the TRAIL-resistant line expressed only DR4. However, DR4 was absent from the cell surface in the resistant and two additional lines (three of five tested lines), suggesting that it may have been nonfunctional. On the contrary, DR5 was located on the cell surface in all four sensitive lines tested, being absent only from the cell surface of the resistant line that was also DR5-negative by Western blotting. In agreement with these findings, the resistance of the line was overcome by restoration of DR5 levels by transfection. Levels of DcR1 and DcR2 or levels of the FLICE-inhibitory protein (FLIP) did not correlate with TRAIL resistance, and protein synthesis inhibition did not sensitize the TRAIL-resistant line to TRAIL. Because these data suggested that sensitivity of ESFTs to TRAIL was mainly based on the presence of DR4/DR5, we investigated the presence of these receptors in 32 ESFT tissue sections by immunohistochemistry. We found that 23 of 32 tumor tissues (72%) expressed both receptors, 8 of 32 (25%) expressed one receptor only, and 1 was negative for both. Our finding of wide expression of DR4/DR5 in ESFT in vivo, in combination with their high sensitivity to TRAIL in vitro and the reported lack of toxicity of TRAIL in mice and monkeys, suggests that TRAIL may be a novel effective agent in the treatment of ESFTs.
 |
INTRODUCTION
|
|---|
Several members of the tumor necrosis factor receptor superfamily, which includes tumor necrosis factor receptor 1, Fas (Apo-1/CD95), and the DRs2
for TRAIL (Apo-2L), regulate programmed cell death (apoptosis). Upon engagement by their respective ligands, tumor necrosis factor receptor 1 and Fas recruit adaptor molecules and activate a cascade of cysteine proteases (caspases), the proteolytic activity of which induces apoptosis (1)
. The TRAIL-activated DR4 (or TRAIL-R1; Ref. 2
) and DR5 (or TRAIL-R2; Refs. 3, 4, 5, 6
) have also been shown to initiate a caspase-mediated apoptotic pathway in transfection experiments (2, 3, 4)
, but the endogenous pathway of TRAIL activation has not been studied. In contrast to DR4 and DR5, DcR1 (TRAIL-R3/TRID) and DcR2 (TRAIL-R4/TRUNDD) are unable to transduce death signals and have been proposed to function as decoy receptors (3
, 4)
. They may also provide inhibitory signals, possibly through activation of nuclear factor-
B (7)
. The DR4, DR5, DcR1, and DcR2 genes are tightly clustered on human chromosome 8p2221 (5
, 7)
, suggesting that they have been derived from a common ancestor by gene duplication. A fifth TRAIL receptor, osteoprotegerin, exists in a soluble form and inhibits apoptosis by interfering with the binding of TRAIL to the DR4 and DR5 receptors (8)
. In contrast to Fas ligand, the expression of which is limited to cells of the immune system (9)
and a few immune-privileged sites (10, 11, 12)
, TRAIL is expressed in a wide range of normal fetal and adult tissues (13)
and induces apoptosis only in transformed and malignant cells (3)
, thus constituting a promising new candidate for cancer treatment.
ESFTs comprise a biologically distinct group of bone and/or soft tissue sarcomas in children and young adults characterized by specific chromosomal translocations. After osteosarcomas, ESFTs are the most common malignant osseous neoplasms in this age group. Patients with recurrent or metastatic disease at presentation have bad outcomes because of poor tumor response to standard chemotherapy (14)
. Therefore, there is a need for novel agents or therapeutic strategies. Our previous studies have shown that ESFTs undergo Fas-mediated apoptosis in vitro, but this response is not universal (15)
. This and the finding that treatment of mice with a Fas-activating monoclonal antibody leads to liver failure from massive hepatocellular apoptosis (16)
suggest that exogenous activation of the Fas pathway may not be as promising as originally thought.
In this study, we explored the effectiveness of human rTRAIL in ESFT cell lines and its possible mode of action. We found that TRAIL induced apoptosis through a caspase-mediated pathway in all but one of the 10 cell lines tested, even in lines that were Fas resistant. The nonresponding line was sensitized after transfection of the missing DR5 receptor. More importantly, we found that the apoptosis-inducing TRAIL receptors, DR4 and DR5, were widely expressed in ESFTs, not only in vitro but also in vivo, suggesting that TRAIL may be applied effectively in the treatment of ESFT.
 |
MATERIALS AND METHODS
|
|---|
Cell Lines
We studied nine well-characterized and previously described ESFT cell lines (TC-248, TC-71, TC-32, A4573, 5838, SK-N-MC, CHP-100 S, CHP-100 L, and TC-268) with variable sensitivity to Fas-mediated apoptosis (15
, 17)
. Specifically, the SK-N-MC and CHP-100 L lines are highly sensitive to Fas cross-linking, the 5838, TC-71 and A4573 exhibit medium to low sensitivity, whereas the TC-248, TC-268, CHP-100S, and TC-32 are Fas resistant. In addition, we studied a clone of the SK-N-MC line that we had made FR, as described previously (17)
, and a primary culture of normal (SK-N-MC-FR) human fibroblasts isolated from uninvolved tissue of an ESFT patient. The cervical adenocarcinoma cell line HeLa was purchased from the American Type Culture Collection (Manassas, VA). All cells were grown in DMEM (BioWhittaker, Walkersville, MD) supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% FCS (Life Technologies, Inc., Gaithersburg, MD).
Tumor Tissues
For the immunohistochemical studies, formalin-fixed, paraffin-embedded tumor tissues from 32 patients with ESFTs were obtained from the files of the Laboratory of Pathology at the National Cancer Institute.
Reagents
Human recombinant His-tagged soluble TRAIL was obtained from Biomol (Plymouth Meeting, PA), and human recombinant LZ-tagged soluble TRAIL was from Immunex (Seattle, WA). Goat polyclonal antibodies for DR4, DR5, DcR1, FADD, and the long form of cellular FLIP (antibody C19) and rabbit polyclonal antibodies for caspase-3 and Fas were purchased from Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA). Monoclonal antibodies for caspase-8 and caspase-10 were purchased from Upstate Biotechnologies (Lake Placid, NY) and for caspase-9 from Santa Cruz Biotechnologies. The anti-DcR2 rabbit polyclonal antibody was purchased from Imgenex (San Diego, CA). The monoclonal antibodies 4E7 and 3F11 that were used in flow cytometry for cell surface detection of DR4 and DR5 (18)
, respectively, were supplied by Dr. A. Ashkenazi (Genentech, San Francisco, CA).
Survival and Death Assays
MTT Colorimetric Assay.
This assay was performed as described previously (15)
. In brief, cells untreated or treated with His-tagged rTRAIL (0.5, 1, or 2 µg/ml) for 18 h in serum-free DMEM at 37°C were incubated with MTT (1 mg/ml; Sigma) for 4 h. Absorbance was measured by spectrophotometry.
TUNEL Method.
After treatment with His-tagged rTRAIL (1 µg/ml for 18 h), air-dried cytospins were labeled with the In Situ Cell Death kit-Fluorescence (Roche Molecular Biochemicals, Indianapolis, IN), following the instructions of the manufacturer, and were viewed with a Zeiss standard fluorescence microscope.
Electron Microscopy.
Cells treated with His-tagged rTRAIL (1 µg/ml for 18 h) or untreated were pelleted and fixed in 2.5% glutaraldehyde in phosphate buffer (pH 7.4) for 24 h, postfixed in OsO4, and embedded in Maraglas 655 (Ladd Research Industries, Burlington, VT). Sections were stained with uranyl acetate and lead citrate and examined in a Philips CM10 electron microscope.
Annexin V Labeling.
Early apoptosis was quantified with the Annexin V-PI detection kit (Immunotech/Beckman Coulter, Miami FL). Briefly, 106 SK-N-MC cells before and after treatment with His-tagged rTRAIL (1 µg/ml for 4 h) were labeled with fluorescein-conjugated Annexin V and PI and analyzed by dual-color cytometry using an EPICS-XL-MCL flow cytometer (Coulter, Hialeah, FL). Cells that were PI negative (i.e., with intact cellular membrane) and Annexin V positive were considered as early apoptotic cells. Annexin detects phosphatidylserine, which translocates from the inner to the outer leaflet of the plasma membrane during early apoptosis (19)
.
Apo2.7 Labeling.
Quantification of late apoptosis was determined in SK-N-MC cells before and after treatment with His-tagged rTRAIL (1 µg/ml for 18 h). The cells were immunostained with the Apo2.7 PE-conjugated monoclonal antibody (Immunotech/Beckman-Coulter, Miami, FL) according to the manufacturers instructions and analyzed by flow cytometry. Apo2.7 specifically detects the Mr 38,000 mitochondrial membrane antigen 7A6, which is exclusively exposed on the cell membrane of apoptotic cells and can therefore be used as a late apoptotic marker in nonpermeabilized cells (20
, 21) .
Comparative Treatment with His-tagged and LZ TRAIL
To compare the potency of the His-tagged soluble TRAIL that we used in our experiments to that of the LZ-tagged soluble TRAIL used by others (22
, 23)
, we treated SK-N-MC cells for 18 h with various concentrations of the two available forms of TRAIL and evaluated cell death with the MTT assay. Dose-response curves were drawn, and LD50s were calculated for both forms with the help of the STATISTICA software (StatSoft, Tulsa, OK).
Multiplex RT-PCR
Total RNA was isolated with the Trizol reagent (Life Technologies, Inc.) according to the instructions of the manufacturer. Two µg of the RNA were reversely transcribed into cDNA with the Superscript kit (Life Technologies, Inc.) using random hexamers. To compensate for variations in the quality or quantification of RNA or tube-to-tube variation in the reverse transcription and PCR reactions, we performed multiplex RT-PCR using sets of primers for DR5 and for the 18S RNA, which was used as an internal standard (QuantumRNA 18S internal standards, Ambion, Austin, TX). For DR5, the GGCAAGTCTCTCTCCCAGCGTCTC forward and GGGAGCCGCTCATGAGGAA-GTTGG reverse primers were used. For 18S RNA, we used a mixture of primers and competimers, modified at their 3' ends to block extension by DNA polymerase. By mixing 18S primers with increasing amounts of 18S competimers, the overall PCR amplification efficiency of 18S is reduced to match the amplification efficiency of the less abundant DR5 transcript. We used a 3:7 ratio of primers to competimers, which is suitable for moderately expressed transcripts, such as DR5. Two µl of the transcription reaction were subjected to quantitative multiplex PCR using the above primers. The PCR cycles were: 95°C for 5 min, 35 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, and 72°C for 5 min. The PCR products were subjected to agarose gel electrophoresis and visualized under UV light.
Immunohistochemistry
Immunohistochemical detection of DR4 and DR5 in ESFT tissues was performed as described previously (24)
. The primary goat polyclonal antibodies, anti-DR4 (1:100 dilution) and anti-DR5 (1:50 dilution), respectively, were applied overnight in the presence or absence of a 10-fold excess of the corresponding blocking peptides. The peroxidase reaction was developed with 3,3'-diaminobenzidine, and the slides were counterstained with hematoxylin. Positive staining was evaluated subjectively by two independent observers.
Western Blot Analysis
TRAIL receptor protein expression was evaluated by Western blotting, as described previously (15)
. Blotted membranes were immunostained with anti-DR4, anti-DR5, anti-DcR1, and anti-DcR2 antibodies (1:500). The potential involvement of caspases in TRAIL-induced apoptosis and the kinetics of caspase activation were evaluated in the SK-N-MC cells before and after treatment with 1 µg/ml His-tagged rTRAIL for 0, 0.5, 1, and 4 h. Thirty µg of protein extracted at the above time points were electrophoresed, electroblotted, and immunostained with antibodies against caspase-3, caspase-8, caspase-9, and caspase-10 (1:500). The proteins were visualized with the enhanced chemiluminescence technique (Amersham Pharmacia Biotech, Piscataway, NJ).
Flow Cytometry for DR4 and DR5
Cells (106) cells from the CHP-100S, CHP-100 L, SK-N-MC, TC-71, and TC-268 lines, and the cervical adenocarcinoma HeLa cells which served as a positive control, were incubated for 45 min with the 4E7 and 3F11 monoclonal antibodies against DR4 and DR5 receptors or with their respective isotype controls (5.0 µg/ml). Subsequently, the cells were washed with PBS, incubated for 45 min with goat antimouse IgG FITC-conjugated F(ab')2 fragment (2 µg/ml, Jackson Immunoresearch Laboratories, West Grove, PA), washed, fixed in 1% formaldehyde in PBS, and analyzed by flow cytometry.
TRASC Assay
To study the proteins that are recruited to the TRAIL receptors upon stimulation, SK-N-MC cells unstimulated or treated with 1 µg/ml His-tagged rTRAIL for 30 min were harvested and lysed in a lysis buffer consisting of 20 mM HEPES (pH 7.4), 200 mM NaCl, and 1% Igepal, and supplemented with proteinase inhibitors (1 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 2 µg/ml leupeptin, and 1 µg/ml pepstatin). The samples were cleared by microcentrifugation (14,000 rpm for 30 min at 4°C) and incubated with 1 µg/ml His-tagged rTRAIL for 4 h at 4°C. The His-tagged rTRAIL and all associated proteins were precipitated with Ni2+-conjugated agarose beads (Qiagen, Valencia, CA) for 2 h at 4°C, electrophoresed in a 12% SDS-PAGE, electroblotted onto nitrocellulose membranes, and immunoblotted with antibodies against the DR4 and DR5 receptors, as well as against caspase-8 and caspase-10 and the adaptor molecule FADD.
Protein Synthesis Inhibition and Sensitivity to TRAIL
To investigate the potential involvement of antiapoptotic proteins in the resistance of the CHP-100S cells to TRAIL, we treated these cells with His-tagged rTRAIL (1 µg/ml for 18 h) in the presence or absence of the protein synthesis inhibitor cycloheximide (concentration range, 0.310 µg/ml). Cell survival was evaluated with the MTT assay.
Transfection of DR5 Expression Vector
Because the only TRAIL-resistant ESFT cell line CHP-100S lacked DR5 expression, we studied whether restoration of DR5 expression would sensitize the CHP-100S cells to TRAIL. The cells were plated in six-well plates and transfected with 2 µg of the pcDNA3.1-GeneStorm mammalian expression vector encoding the human DR5 gene (Invitrogen, Carlsbad, CA) or the empty vector, using the Superfect reagent (Qiagen). Forty-eight h later, the cells were treated with His-tagged rTRAIL (1 µg/ml for 18 h), and cell survival was evaluated with the MTT assay.
Statistical Analysis
Statistical comparisons were performed with the one-factor ANOVA method, followed by Duncans test. Significance was set at 0.05.
 |
RESULTS
|
|---|
TRAIL-induced Apoptosis in ESFT Cell Lines.
We tested ESFT cell lines for their susceptibility to apoptosis induced by His-tagged rTRAIL at concentrations ranging from 0.5 to 2 µg/ml. We found that rTRAIL induced cell death in 9 of 10 lines, 4 of which were shown previously to be FR (17
, 25)
. The percentage of cell death in the rTRAIL-treated ESFT cell lines with the MTT assay is shown in Fig. 1
. Five cell lines with low to high sensitivity to Fas-mediated apoptosis (SK-N-MC, TC-71, A4573, 5838, and CHP-100 L) and the SK-N-MC-FR clone underwent significant cell death with rTRAIL at all concentrations (7595% at 2 µg/ml, 5092% at 1 µg/ml, and 2390% at 0.5 µg/ml). Three additional FR cell lines (TC-248, TC-268, and TC-32) also exhibited a high percentage of dead cells (5070%) but only at the highest concentration (2 µg/ml) of rTRAIL. Finally, the FR ESFT cell line CHP-100S and the primary culture of normal human fibroblasts were completely resistant to rTRAIL.
The apoptotic nature of TRAIL-induced cell death was shown by the presence of numerous intensely fluorescent nuclei by the TUNEL method (Fig. 2, A and B)
and by the presence of condensed cells with disrupted nuclear membranes and free cytoplasmic clumps of chromatin by electron microscopy (Fig. 2, C and D)
. Flow cytometric evaluation of SK-N-MC cells labeled with Annexin V-FITC/propidium iodide (Fig. 3, A and B)
and Apo2.7-PE monoclonal antibody (Fig. 3, C and D)
independently confirmed the MTT data, showing
80% apoptotic cells after treatment with 1 µg/ml of His-tagged rTRAIL for 4 and 18 h, respectively. This finding indicated that the MTT-obtained values of cell death were representative of apoptotic death.

View larger version (165K):
[in this window]
[in a new window]
|
Fig. 2. SK-N-MC cells untreated (A) or treated with His-tagged rTRAIL (B) and stained with the TUNEL method. Intensely fluorescent nuclei, shown as white dots and indicative of apoptotic cells, are seen only after treatment with TRAIL (1 µg/ml for 18 h; A, x180; B, x260). Untreated (C) and TRAIL-treated TRAIL (1 µg/ml for 18 h; D) SK-N-MC cells were also examined by electron microscopy. The apoptotic cells in Fig. 2D
exhibit dark condensed cytoplasm and fragmented nuclear chromatin lying free in the cytoplasm. The nuclear membranes have been dissolved. C and D, x1250.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3. Quantification of apoptosis in SK-N-MC cells treated with His-tagged rTRAIL. A, B, Annexin V-FITC/PI staining after 4 h of incubation with TRAIL reveals that the majority of TRAIL-treated cells are negative for PI (suggesting an intact plasma membrane) and, in marked contrast to the control, positive for Annexin V-FITC labeling (indicating exposure of phosphatidylserine on the outer leaflet of the plasma membrane), which is consistent with early apoptosis. C, D, SK-N-MC cells before and after 18 h of incubation with TRAIL were incubated with PE-conjugated Apo2.7 monoclonal antibody (shaded surface) or PE-conjugated isotype control (unshaded) and were analyzed by flow cytometry, confirming again that the majority of treated cells, but not control cells, are apoptotic.
|
|
Treatment with His-Tagged versus LZ TRAIL.
The LD50 of SK-N-MC cells incubated with His-tagged TRAIL was 400 ng/ml and with LZ-tagged rTRAIL, 13 ng/ml (Fig. 4)
. Both incubations were performed for 18 h. LZ-TRAIL showed a 30-fold higher potency.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 4. Survival of SK-N-MC cells after treatment for 18 h with various concentrations of His-tagged (A) or LZ-tagged (B) TRAIL. The LD50 of His-tagged TRAIL was calculated at 400 ng/ml, whereas the LD50 of LZ-TRAIL was 13 ng/ml.
|
|
TRAIL Receptor Expression in ESFT Cell Lines.
The high responsiveness of the ESFT cell lines to rTRAIL indicated the expression of at least one of the death-inducing TRAIL receptors (2, 3, 4, 5, 6)
. Using commercially available antibodies directed against the COOH terminus of the human DR4 and DR5, we evaluated the expression of these receptors in ESFT cell lines by Western blot analysis (Fig. 5A)
. We found that all cell lines expressed both DR4 and DR5 proteins, except for the TRAIL-resistant CHP-100S line that expressed only DR4. A single band was detected with the antibody against DR5, whereas three bands (two strong and one weak) were detected with the anti-DR4 antibody. Because DR4 has an N-linked glycosylation site (2)
, in contrast to DR5 (5)
, the three bands could represent variably glycosylated forms of the DR4 protein. Alternatively, they may represent proteins corresponding to the three major DR4 mRNA transcripts (2)
, as opposed to the single DR5 transcript (3, 4, 5)
. Because DcR1 and DcR2 may confer resistance to TRAIL-induced apoptosis functioning as decoy receptors (3
, 4)
, we studied their expression in the ESFT cell lines by Western blotting as well (Fig. 5B)
. An antibody against the NH2 terminus of human DcR1 and against a peptide corresponding to amino acids 249263 of the human DcR2 precursor were used. Decoy receptors had been found predominantly in normal cells (4)
, and therefore, we used normal fibroblasts as a positive control. We detected variable levels of DcR1 in all cell lines, but we found stronger expression in the TRAIL-sensitive SK-N-MC, TC-71, and TC-268 lines. The TRAIL-resistant CHP-100S and the TRAIL-sensitive CHP-100 L lines had equally low levels of DcR1. Therefore, the resistance of the CHP-100S cells to TRAIL cannot be attributed to the levels of expression of the DcR1 receptor. Similarly, we found no correlation between levels of DcR2 and TRAIL resistance. The DcR2 receptor was present at high levels in all TRAIL-sensitive ESFT cell lines. Lowest levels were observed in the TRAIL-resistant line and in normal fibroblasts.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 5. A, Western blot analysis of DR4 and DR5 receptors. All ESFT cell lines express both DR4 and DR5, except for the CHP-100S, which lacks DR5. Interestingly, this was the only TRAIL-resistant line in this study. B, Western blot analysis for DcR1 and DcR2 shows their variable expression in the ESFT cell lines. The receptors were also present in normal fibroblasts that were used as a positive control. There was no correlation between levels of expression of DcR1 and DcR2 and response to TRAIL. By multiplex RT-PCR using primers to amplify the internal 18S and the DR5 RNA simultaneously, we found the 200-bp DR5 amplification product in the HeLa cells and in the ESFT cell lines that expressed DR5 protein but not in the CHP-100S cell line that lacked DR5 protein expression (D). The 500-bp amplification product of the 18S internal RNA standard was present in all cell lines (C). Immunohistochemical detection of DR4 (E, x380) and DR5 (F, x200) in ESFT specimens. A high percentage of tumor cells show cytoplasmic and membranous immunostaining.
|
|
Because DR5 protein was specifically absent in the TRAIL-resistant CHP-100S cell line, we also studied DR5 RNA expression in this line and in four other DR5 protein-expressing ESFT cell lines, as well as in the HeLa cells that were used as a positive control (26)
. We found that the CHP-100S cell line lacked DR5 RNA, in contrast with the other studied cell lines, supporting that absence of DR5 expression in this line is attributable to defective transcription and not to posttranscriptional modifications (Fig. 5, C and D)
.
TRAIL Receptor Expression in ESFT Tissues.
Expression of DR4 and DR5 has been studied at the mRNA level (4
, 23
, 27
, 28)
and recently at the protein level (27
, 29) in tumor cell lines. Tumor tissues were evaluated only in one study (30)
, in which DR4 and DR5 transcripts were studied in a panel of 35 brain tumors by RT-PCR. In the present study, in addition to evaluating expression of TRAIL receptors in ESFT cell lines, we evaluated DR4 and DR5 protein expression in tissue sections from a panel of 32 ESFT tumors, using an immunohistochemical method that allowed the use of archival material and morphological correlations. We found that 23 of 32 tissues (72%) expressed both receptors, and 8 of 32 (25%) expressed one receptor. Specifically, 7 of 32 were positive for DR4 only, and 1 of 32 was positive for DR5 only. One tumor was negative for both receptors. The cellular pattern of immunostaining was cytoplasmic and membranous, whereas the architectural pattern was diffuse for both receptors (Fig. 5, E and F)
. Immunoreactivity for DR4 was overall stronger and more widespread than that for DR5. However, the importance of this observation is unclear, given that it could also be attributable to variable sensitivity of the antibodies. Preincubation of each antibody with the respective blocking peptide completely abolished the immunostaining, confirming the specificity of the technique.
Caspase Activation in TRAIL-induced Apoptosis.
TRAIL-induced apoptosis is characterized by activation of caspase-8, caspase-10, caspase-9, and caspase-3 in transfection experiments (2, 3, 4)
. Because caspase-8 activation preceded caspase-3 activation in TRAIL-sensitive cells, caspase-8 was considered to be one of the proximal components in the TRAIL signaling pathway (23)
. We investigated the endogenous caspase activation in ESFT cells upon TRAIL stimulation. We found that caspase-10 was first to be cleaved at 30 min, followed by cleavage of caspase-8 at 1 h and of caspase-9 and caspase-3 at 4 h. (Fig. 6A)
. Because the cleavage of caspases is an indication of their activation, we concluded that TRAIL-induced apoptosis in ESFTs involves caspase activation, and caspase-10 is more proximal than the other caspases in the signaling pathway.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 6. A, activation of caspases by TRAIL. Western blot analysis of caspase-10, caspase-8, caspase-3, and caspase-9 in SK-N-MC before treatment (0 h) and after treatment with His-tagged rTRAIL (1 µg/ml) for 0.5, 1, and 4 h. Cleavage of caspase-10 was first detected after 0.5 h of treatment with TRAIL. Cleavage of caspase-8 was first detected after 1 h of treatment. Cleavage of caspase-3 and caspase-9 occurred after 4 h of treatment. B, immunoprecipitation of the TRASC. SK-N-MC cells unstimulated (0 min) or stimulated with His-tagged rTRAIL (30 min) were lysed and incubated with His-tagged rTRAIL. The TRASC was then precipitated with Ni2+-conjugated agarose beads and probed sequentially with anti-caspase-10, anti-caspase-8, anti-DR4, anti-DR5, and anti-FADD antibodies. Caspase-10 is recruited to the TRASC upon stimulation. Caspase-8 and FADD were not detected. The receptors DR4 and DR5 were used as controls.
|
|
Protein Recruitment to the TRASC.
Having shown the involvement of caspases in the TRAIL signaling pathway, we proceeded to identify whether one of them functions as an initiator caspase through direct binding with the TRAIL receptor(s), as shown for caspase-8 in the Fas signaling pathway (1)
. Using the TRASC assay, we were able to demonstrate the recruitment of caspase-10, but not caspase-8, to the receptor-ligand complex (Fig. 6B)
. This provides evidence that caspase-10 is the apical caspase in the TRAIL signaling pathway in the ESFT cells. Because caspase binding to the death receptors requires the presence of an adaptor molecule (1
, 3)
and because in previous studies FADD was found to participate in TRAIL receptor signaling (18
, 31, 32, 33)
, we evaluated possible recruitment of FADD to the TRASC using the same assay as for caspase-10. We found that the endogenous FADD is not recruited to the TRASC upon stimulation of the SK-N-MC cells with TRAIL (Fig. 6B)
. This was not attributable to endogenous absence of FADD or its deficient detection, because we detected FADD protein in total cell lysates of this line by Western blotting (data not shown).
FLIP Expression and TRAIL Resistance.
Because elevated FLIP levels can inhibit signals from death receptors including those of TRAIL and because elevated FLIP levels have been associated with Fas or TRAIL resistance in some reports (23
, 34
, 35)
, we evaluated the amount of this protein by Western blotting in cellular lysates from two pairs of ESFT cell lines. In the first pair, both lines were sensitive to TRAIL, but one was Fas sensitive (parental SK-N-MC) and the other FR (SK-N-MC-FR). In the second pair, one line (CHP-100 L) was both TRAIL and Fas sensitive, and the other (CHP-100S), both TRAIL and FR (17)
. We found that although the levels of FLIP were elevated in the FR clones (SK-N-MC-FR and CHP-100S), only one of them (CHP-100S) was resistant to TRAIL (Fig. 7A)
. The other (SK-N-MC-FR) was highly sensitive to TRAIL. This finding does not support a causative role for FLIP in the resistance of this line to TRAIL.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 7. A, levels of the antiapoptotic protein FLIP do not correlate with sensitivity to TRAIL, because they are high both in the FR, TRAIL-sensitive clone SK-N-MC-FR as well as in the FR, TRAIL-resistant line CHP-100S. Low levels are observed in the Fas- and TRAIL-sensitive SK-N-MC and CHP-100 L lines. B, resistance to TRAIL in CHP-100S cells is not overcome by protein synthesis inhibition with cycloheximide. , cells treated with cycloheximide alone; , cells treated with cycloheximide and His-tagged TRAIL (1 µg/ml for 18 h). Transient transfection of the CHP-100S cells with a DR5-encoding vector induced expression of the DR5 receptor protein (C) and a mild decrease in cell survival (D). More importantly, transient forced expression of DR5 sensitized them to TRAIL-induced apoptosis (33.11 ± 9.15% cell death; P < 0.001). Trail, His-tagged TRAIL, 1 µg/ml for 18 h. Bars, SD (n = 3). , cells transfected with empty vector (control, C). , cells transfected with the same vector encoding the human DR5 gene.
|
|
Protein Synthesis Inhibition and DR5 Transfection in the TRAIL-resistant Cell Line.
Cycloheximide treatment did not sensitize the CHP-100S cells to TRAIL-induced apoptosis (Fig. 7B)
, suggesting that resistance to TRAIL is not attributable to the presence of inhibitory proteins and further arguing against an inhibitory role for FLIP in this cell line. On the other hand, transient transfection of CHP-100S cells with the pcDNA3.1-DR5 expression vector induced the expression of DR5 receptor protein (Fig. 7C)
, decreased slightly their survival (10.45 ± 7.6%), and sensitized them to TRAIL-induced apoptosis (33.11 ± 9.15% cell death; P < 0.001). In contrast, cells transfected with the empty vector showed no DR5 expression and no cell death with or without TRAIL (Fig. 7D)
.
Cell Surface Expression of DR4 and DR5 in ESFT Cell Lines.
Because reintroduction of DR5 and not treatment with cycloheximide reversed TRAIL resistance in CHP-100S cells, we concluded that there is a defect at the receptor level and not in the downstream signaling pathway. However, because CHP-100S cells expressed DR4 and previous studies have shown that DR4 and DR5 are independently sufficient to transmit apoptotic signals (2
, 3
, 29)
, we hypothesized that DR4 may have been functionally inactivated. We therefore studied its cellular localization by flow cytometry and found that it is absent from the cell surface of CHP-100S cells (Fig. 8A)
, in contrast to HeLa cells that have been previously reported positive for surface DR4 (26)
and served as a positive control (Fig. 8B)
. These data support that the resistance of CHP-100S cells to TRAIL is not only because of their lack of DR5 but also because of their failure to translocate DR4 to the cell surface. We then expanded our analysis in four additional ESFT cell lines that had been positive for DR4 protein by immunoblotting and found that two of them [CHP-100 L (Fig. 8C)
and SK-N-MC (Fig. 8D)
] lacked surface expression for DR4, whereas the other two [TC-71 (Fig. 8E)
and TC-268 (Fig. 8F)
] expressed DR4 on the cell surface. This heterogeneous pattern of cell surface localization and discrepancy between protein levels and cell surface expression were not observed for DR5, as the latter was detected by flow cytometry in all four studied lines that were positive by immunoblotting (Fig. 8, GJ)
.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 8. Flow cytometric analysis of DR4 and DR5 surface expression in ESFT cells. Staining with the anti-DR4 or anti-DR5 monoclonal antibodies is depicted by the shaded area, whereas the unshaded area represents the isotype control.
|
|
 |
DISCUSSION
|
|---|
Although the ability of TRAIL to induce apoptosis has been studied in a variety of tumors (22
, 36, 37, 38)
, studies on its efficacy in groups of specific tumor types have been limited to melanoma (23
, 27
, 39)
, breast carcinoma (28)
, and malignant glioma (40)
. We evaluated the susceptibility of ESFT cells to TRAIL and found that TRAIL induced apoptosis in all but 1 of the 10 ESFT cell lines, even those that were FR (15
, 25)
. Specifically, 1 µg/ml of His-tagged TRAIL induced 5092% apoptosis in all Fas-sensitive lines, similarly to other tumor types (13
, 39) . The required higher concentration (2 µg/ml) in the FR lines in this study suggests that the biological activity of TRAIL may be increased by more efficient cross-linking, which can be accomplished by higher concentrations of TRAIL promoting spontaneous oligomerization. Alternatively, variants that facilitate and stabilize oligomerization, such as the LZ-tagged TRAIL, may also increase cross-linking and thus be much more potent, as shown in this and a previous study (22)
. Susceptibility of Fas-resistant cells to TRAIL suggests engagement of different signaling pathways for the Fas and TRAIL receptors and has been reported in melanoma cell lines, as well (39)
. However, this may not be a universal phenomenon, because overlapping patterns of resistance to Fas ligand and TRAIL have been reported in glioma cell lines (40)
. The fact that all TRAIL-sensitive ESFT cell lines in this study carry p53 mutations or deletions (41
, 42) , known to confer resistance to chemotherapeutic drugs and irradiation (43)
, suggests that TRAIL-induced apoptosis is independent of p53. It has been reported that wild-type p53 can induce transcriptional regulation of the DR5 TRAIL receptor in cells undergoing apoptosis (44)
, and ectopic expression of wild-type p53 can enhance TRAIL-induced apoptosis in malignant gliomas (40)
. However, DR5 can also be regulated in a p53-independent manner (45)
, and the p53 genetic status did not correlate with TRAIL-induced apoptosis in malignant gliomas (40)
, similar to the ESFTs in this study.
The observed high sensitivity of ESFT to TRAIL suggests the presence of functional DR4 and DR5. Previous studies have shown expression of DR4 and DR5 transcripts in human tumor cell lines (22
, 25
, 27
, 39)
and tissues (30)
. We have studied the expression of the DR4 and DR5, not only in ESFT cell lines, but also in tissue sections of 32 ESFT cases. We found that a high percentage of ESFTs expressed the apoptosis-inducing receptors in vivo. Specifically, 72% expressed both DR4 and DR5, 25% expressed only one, and 3% were negative for both. The staining was diffuse within tumor sections and was seen both in the cytoplasm and the cell membranes.
We also showed that upon stimulation of ESFT cells with TRAIL, there was initial activation of caspase-10, followed by activation of caspase-8, caspase-3, and caspase-9, indicating that TRAIL induces both receptor-mediated and mitochondrial intrinsic pathways. Furthermore, using an assay that allowed coprecipitation and immunodetection of all endogenous proteins that bind to TRAIL upon activation, we found that caspase-10 is preferentially recruited to the TRASC in ESFT cells. These findings support that caspase-10 is the apical caspase in the TRAIL pathway of ESFT cells, in contrast to caspase-8, which has a prominent role in the Fas and tumor necrosis factor receptor 1 pathways (1)
. Interaction of caspase-10 with TRAIL receptors has been shown in cells cotransfected with plasmids encoding the respective genes (3)
, but our study shows recruitment of endogenous caspase-10 to the TRASC. Although recent studies have shown recruitment of endogenous caspase-8 to the TRASC (18
, 33)
, they were undertaken in other tissues (human B and T cells, colon, breast and lung carcinoma cell lines, and a rhabdomyosarcoma cell line), and thus, the observed differences may be tissue dependent. We also found activation of caspase-8, but this occurred at a later time, suggesting that caspase-8 may be secondarily activated by caspase-10 to amplify the apoptotic signal. The essential role of caspase-10 in TRAIL-induced apoptosis is also supported by the previous finding of only partial inhibition of DR4- or DR5-induced cell death by a dominant-negative caspase-8 and complete inhibition by a dominant-negative caspase-10 (3)
and by the finding that inherited caspase-10 mutations in patients with autoimmune lymphoproliferative syndrome type II are associated with resistance of their lymphocytes and dendritic cells to TRAIL (46)
. The involvement of the adaptor molecule FADD in the transmission of the death signal by TRAIL has also been controversial. In some studies, FADD was shown to associate with DR4 and DR5 in cotransfection experiments (32)
, and overexpression of a dominant-negative FADD construct inhibited TRAIL-induced apoptosis (31
, 32)
. Similarly, recruitment of endogenous FADD to the TRASC was found in lymphoma cells also recruiting caspase-8, as discussed above, and FADD-deficient Jurkat cells were resistant to TRAIL-induced apoptosis (18
, 33)
. In other studies, however, the dominant-negative FADD construct did not inhibit TRAIL-induced apoptosis (2
, 3)
, and endogenous FADD was not recruited to the TRASC (47)
, as in this study. Although one could argue that extremely high levels of a dominant-negative FADD protein, such as those obtained by transfection, may initiate nonphysiological interactions with the TRAIL receptors and thus show an inhibitory effect (48)
, this would not explain why FADD-deficient Jurkat cells are TRAIL resistant. On the other hand, cells from FADD-deficient mice remained sensitive to TRAIL-induced apoptosis (49)
. These conflicting data could be reconciled if one speculated that FADD is used only in some tumors, specifically those recruiting caspase-8 instead of caspase-10 to the TRASC, and that a yet unidentified molecule is responsible for the linkage of TRAIL receptors with caspase-10. However, more studies are necessary to clarify this issue.
Previous studies have shown that inhibition of RNA or protein synthesis may increase the sensitivity to Fas-mediated (50)
, or TRAIL-induced (23
, 39)
apoptosis in respectively resistant cell lines, suggesting the presence of a short-lived antiapoptotic protein(s) in some tumors (23)
. However, in this study we found that cycloheximide did not sensitize the CHP-100S cells to TRAIL, which would speak against the presence of intracellular inhibitory proteins. Therefore, it is not surprising that we found no correlation between levels of FLIP expression and TRAIL sensitivity in the ESFT cell lines. Although we found elevated levels of FLIP in the TRAIL-resistant CHP-100S line, we also found elevated FLIP levels in the TRAIL-sensitive SK-N-MC-FR clone. The role of FLIP in inhibiting TRAIL-induced apoptosis is controversial. Elevated FLIP levels have been shown to inhibit Fas-mediated and TRAIL-induced apoptosis and to correlate with susceptibility to TRAIL on some occasions (23
, 34
, 35)
but not in others (27)
. Because the inhibitory role of FLIP depends on its recruitment to the receptor complexes through binding with FADD and caspase-8 or caspase-10 (34
, 35
, 51)
and because FADD is missing from some TRAIL receptor complexes, as shown here and in previous studies (2
, 3
, 47)
, it is possible that FLIP may exert an inhibitory role in some but not all TRAIL pathways. Alternatively, equal levels of FLIP may be inhibitory only in tumors with low DR4 or DR5 receptor levels, as discussed previously (51)
.
TRAIL resistance in the only ESFT cell line in this study was attributable to regulation at the DR level. Specifically, we found that all TRAIL-sensitive lines expressed significant levels of both DR4 and DR5, whereas the resistant one lacked expression of DR5 protein and RNA. More importantly, restoration of the levels of the DR5 receptor with transfection of a DR5-expressing vector rendered the TRAIL-resistant cell line sensitive to TRAIL. The finding of cell death only in 33% of the DR5-transfected cells can be explained by the nature of the transient transfection, which yields a mixed population of DR5-positive and DR5-negative cells. These data support that restricted DR expression, or lack thereof, may be an important mechanism by which ESFT cells become resistant to TRAIL. The importance of the DRs in TRAIL-induced apoptosis has been reported in other tumors as well. Specifically, previous studies have shown that TRAIL-resistant tumors may lack the DR genes and proteins (27
, 52
, 53)
or may exhibit functional inactivation of the receptors, either by lack of expression on the cell surface, as reported for melanomas (27)
, or by the presence of structural abnormalities, as in the case of DR5 mutations in head and neck cancers (54)
and of the polymorphism at codon 441 in the death domain of DR4, which acts in a dominant-negative fashion (53)
. Because DR4 and DR5 are independently sufficient to transmit apoptotic signals, as shown in previous studies (2
, 3
, 18
, 29)
, and the TRAIL-resistant line in this study expressed DR4 protein, we hypothesized that the DR4 receptor had been functionally inactivated. This was supported by our finding of absence of DR4 from the surface of the TRAIL-resistant cell line. Interestingly, two additional cell lines from a panel of four tested TRAIL-sensitive lines also lacked surface expression of DR4 but not DR5. Similar results were obtained in a previous study in which DR4 was expressed in the cytoplasm and at the mRNA level but was absent from the cell surface, whereas DR5 did not show such a discrepancy (27)
. These findings suggest that posttranslational dysregulation of the DR4 receptor may be yet another mechanism by which tumor cells become resistant to TRAIL, as shown previously for Fas, another member of this receptor superfamily (55)
. Although many tumors have been reported to lack DR4 expression, absence of DR5, as shown in this study both in vitro and in vivo (7 of 32 tumors), is a less common phenomenon (18
, 52
, 53
, 56)
. Yet DR5 may have higher affinity for TRAIL at physiological temperature (57)
and is up-regulated by chemotherapeutic agents (53
, 56
, 58)
. Therefore, its absence may have implications in chemotherapy-related tumor cell responses.
Resistance to TRAIL has also been attributed to the presence of DcR1 and DcR2, which cannot transduce the apoptotic signal, thus functioning as decoy receptors (3
, 4
, 6
, 7
, 59, 60, 61)
. Although overexpression of either of these proteins protected cells from TRAIL cytotoxicity (3
, 4
, 60)
, we found that, in ESFT cell lines, levels of decoy receptor expression did not correlate with resistance to TRAIL. Similar results have been obtained in melanoma and breast carcinoma cell lines (23
, 28) and brain tumor tissues (4
, 30)
. Recently, the hypothesis of the decoy receptors was tested with DR4- and DR5-activating antibodies that induced apoptosis only in TRAIL-sensitive lines, regardless of the presence or absence of decoy receptors, thus showing that the decoy receptors are not protective under physiological conditions (29)
. Therefore, although we found that both decoy receptors were expressed in a high percentage of ESFT tissue specimens (data not shown), it is unlikely that they will have a significant biological role in vivo.
In conclusion, we have shown that TRAIL effectively and specifically kills ESFT cells by engaging the DR4 and DR5 DRs and activating a cascade of caspases that begins at caspase-10. Caspase-8 is also activated but is not recruited to the TRASC, similarly to the adaptor molecule FADD. These data show that the TRAIL receptor signaling pathway differs from that of Fas (1)
and may be used differentially by ESFT cells. This would explain the susceptibility of the FR ESFT cell lines to TRAIL. Our finding of a wide expression of DR4 and DR5 receptors in ESFTs, both in vitro and in vivo, supports that ESFTs are likely to have a high response rate to TRAIL in vivo. Resistance of ESFTs to TRAIL was rare, and when present, was attributable to the complete absence of one receptor and lack of surface expression of the other. Furthermore, it was not overcome by protein synthesis inhibition but by restoration of the missing DR5 receptor. The above data suggest that TRAIL is a novel agent with excellent therapeutic potential in ESFTs. Because TRAIL has been shown recently to have strong antitumor activity in mice (22
, 62)
and monkeys (37)
and to be nontoxic to normal cells in vitro and in vivo (22
, 37)
, in contrast to the Fas-activating antibody (16)
and to tumor necrosis factor-
(63, 64, 65)
, it appears to have superiority over other apoptosis-inducing agents in the treatment of malignant tumors.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 To whom requests for reprints should be addressed, at Laboratory of Pathology, NIH, Building 10, Room 2A-10, Bethesda, MD 20892. Phone: (301) 496-3159; Fax: (301) 480-9197; E-mail: mtsokos{at}box-m.nih.gov 
2 The abbreviations used are: DR, death receptor; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; rTRAIL, recombinant TRAIL; ESFT, Ewings sarcoma family tumor; FR, Fas resistant; LZ, leucine-zipper; FLIP, FLICE inhibitory protein; FADD, Fas-associated death domain; TRASC, TRAIL-associated signaling complex; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PI, propidium iodide; PE, phycoerythrin; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP end-labeling; RT-PCR, reverse transcription-PCR. 
Received 1/27/00.
Accepted 1/11/01.
 |
REFERENCES
|
|---|
-
Schulze-Osthoff K., Ferrari D., Los M., Wesselborg S., Peter M. E. Apoptosis signaling by death receptors. Eur. J. Biochem., 254: 439-459, 1998.[Medline]
-
Pan G., ORourke K., Chinnaiyan A. M., Gentz R., Ebner R., Ni J., Dixit V. M. The receptor for the cytotoxic ligand TRAIL. Science (Washington DC), 276: 111-113, 1997.[Abstract/Free Full Text]
-
Pan G., Ni J., Wei Y. F., Yu G., Gentz R., Dixit V. M. An antagonist decoy receptor and a death domain-containing receptor for TRAIL. Science (Washington DC), 277: 815-818, 1997.[Abstract/Free Full Text]
-
Sheridan J. P., Marsters S. A., Pitti R. M., Gurney A., Skubatch M., Baldwin D., Ramakrishnan L., Gray C. L., Baker K., Wood W. I., Goddard A. D., Godowski P., Ashkenazi A. Control of TRAIL-induced apoptosis by a family of signaling and decoy receptors. Science (Washington DC), 277: 818-821, 1997.[Abstract/Free Full Text]
-
Walczak H., Degli-Esposti M. A., Johnson R. S., Smolak P. J., Waugh J. Y., Boiani N., Timour M. S., Gerhart M. J., Schooley K. A., Smith C. A., Goodwin R. G., Rauch C. T. TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J., 16: 5386-5397, 1997.[Medline]
-
Schneider P., Bodmer J. L., Thome M., Hofmann K., Holler N., Tschopp J. Characterization of two receptors for TRAIL. FEBS Lett., 416: 329-334, 1997.[Medline]
-
Degli-Esposti M. A., Dougall W. C., Smolak P. J., Waugh J. Y., Smith C. A., Goodwin R. G. The novel receptor TRAIL-R4 induces NF-
B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity, 7: 813-820, 1997.[Medline]
-
Emery J. G., McDonnell P., Burke M. B., Deen K. C., Lyn S., Silverman C., Dul E., Appelbaum E. R., Eichman C., DiPrinzio R., Dodds R. A., James I. E., Rosenberg M., Lee J. C., Young P. R. Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J. Biol. Chem., 273: 14363-14367, 1998.[Abstract/Free Full Text]
-
Suda T., Takahashi T., Golstein P., Nagata S. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell, 75: 1169-1178, 1993.[Medline]
-
Runic R., Lockwood C. J., Ma Y., Dipasquale B., Guller S. Expression of Fas ligand by human cytotrophoblasts: implications in placentation and fetal survival. J. Clin. Endocrinol. Metab., 81: 3119-3122, 1996.[Abstract]
-
Griffith T. S., Brunner T., Fletcher S. M., Green D. R., Ferguson T. A. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science (Washington DC), 270: 1189-1192, 1995.[Abstract/Free Full Text]
-
Bellgrau D., Gold D., Selawry H., Moore J., Franzusoff A., Duke R. C. A role for CD95 ligand in preventing graft rejection. Nature (Lond.), 377: 630-632, 1995.[Medline]
-
Pitti R. M., Marsters S. A., Ruppert S., Donahue C. J., Moore A., Ashkenazi A. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J. Biol. Chem., 271: 12687-12690, 1996.[Abstract/Free Full Text]
-
Horowitz M. E., DeLaney T. F., Malawar M. M., Tsokos M. G. Ewings sarcoma family of tumors: Ewings sarcoma of bone and soft tissue and the peripheral primitive neuroectodermal tumors Pizzo P. A. Poplack D. G. eds. . Principles and Practice of Pediatric Oncology, : 795-821, J. B. Lippincott Philadelphia 1993.
-
Mitsiades N., Poulaki V., Kotoula V., Leone A., Tsokos M. Fas ligand is present in tumors of the Ewings sarcoma family and is cleaved into a soluble form by a metalloproteinase. Am. J. Pathol., 153: 1947-1956, 1998.[Abstract/Free Full Text]
-
Ogasawara J., Watanabe-Fukunaga R., Adachi M., Matsuzawa A., Kasugai T., Kitamura Y., Itoh N., Suda T., Nagata S. Lethal effect of the anti-Fas antibody in mice. Nature (Lond.), 364: 806-809, 1993.[Medline]
-
Mitsiades N., Poulaki V., Leone A., Tsokos M. Fas-mediated apoptosis in Ewings sarcoma cell lines by metalloproteinase inhibitors. J. Natl. Cancer Inst., 91: 1678-1684, 1999.[Abstract/Free Full Text]
-
Kischkel F. C., Lawrence D. A., Chuntharapai A., Schow P., Kim K. J., Ashkenazi A. Apo2L/TRAIL-dependent recruitment of endogenous FADD and caspase-8 to death receptors 4 and 5. Immunity, 12: 611-620, 2000.[Medline]
-
Bacso Z., Everson R. B., Eliason J. F. The DNA of Annexin V-binding apoptotic cells is highly fragmented. Cancer Res., 60: 4623-4628, 2000.[Abstract/Free Full Text]
-
Zhang C., Ao Z., Seth A., Schlossman S. F. A mitochondrial membrane protein defined by a novel monoclonal antibody is preferentially detected in apoptotic cells. J. Immunol., 157: 3980-3987, 1996.[Abstract]
-
Seth A., Zhang C., Letvin N. L., Schlossman S. F. Detection of apoptotic cells from peripheral blood of HIV-infected individuals using a novel monoclonal antibody. Aids, 11: 1059-1061, 1997.[Medline]
-
Walczak H., Miller R. E., Ariail K., Gliniak B., Griffith T. S., Kubin M., Chin W., Jones J., Woodward A., Le T., Smith C., Smolak P., Goodwin R. G., Rauch C. T., Schuh J. C., Lynch D. H. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat Med., 5: 157-163, 1999.[Medline]
-
Griffith T. S., Chin W. A., Jackson G. C., Lynch D. H., Kubin M. Z. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol., 161: 2833-2840, 1998.[Abstract/Free Full Text]
-
Mitsiades N., Poulaki V., Kotoula V., Mastorakos G., Tseleni-Balafouta S., Koutras D. A., Tsokos M. Fas/Fas ligand up-regulation and Bcl-2 down-regulation may be significant in the pathogenesis of Hashimotos thyroiditis. J. Clin. Endocrinol. Metab., 83: 2199-2203, 1998.[Abstract/Free Full Text]
-
Tsokos M., Vassilopoulos D., Szentendrei T., Quezado M., Karameris A., Tsokos G. Fas-mediated apoptosis in peripheral primitive neuroectodermal tumor (PNET)/Ewings sarcoma (ES). FASEB J., 10: A1009 1996.
-
Muhlenbeck F., Schneider P., Bodmer J. L., Schwenzer R., Hausser A., Schubert G., Scheurich P., Moosmayer D., Tschopp J., Wajant H. TRAIL-R1 and TRAIL-R2 have distinct cross-linking requirements for initiation of apoptosis and are non-redundant in JNK activation. J. Biol. Chem., 275: 32208-32213, 2000.[Abstract/Free Full Text]
-
Zhang X. D., Franco A., Myers K., Gray C., Nguyen T., Hersey P. Relation of TNF-related apoptosis-inducing ligand (TRAIL) receptor and FLICE-inhibitory protein expression to TRAIL-induced apoptosis of melanoma. Cancer Res., 59: 2747-2753, 1999.[Abstract/Free Full Text]
-
Keane M. M., Ettenberg S. A., Nau M. M., Russell E. K., Lipkowitz S. Chemotherapy augments TRAIL-induced apoptosis in breast cell lines. Cancer Res., 59: 734-741, 1999.[Abstract/Free Full Text]
-
Griffith T. S., Rauch C. T., Smolak P. J., Waugh J. Y., Boiani N., Lynch D. H., Smith C. A., Goodwin R. G., Kubin M. Z. Functional analysis of TRAIL receptors using monoclonal antibodies. J. Immunol., 162: 2597-2605, 1999.[Abstract/Free Full Text]
-
Frank S., Kohler U., Schackert G., Schackert H. K. Expression of TRAIL and its receptors in human brain tumors. Biochem. Biophys. Res. Commun., 257: 454-459, 1999.[Medline]
-
Chaudhary P. M., Eby M., Jasmin A., Bookwalter A., Murray J., Hood L. Death receptor 5, a new member of the TNFR family, and DR4 induce FADD-dependent apoptosis and activate the NF-
B pathway. Immunity, 7: 821-830, 1997.[Medline]
-
Schneider P., Thome M., Burns K., Bodmer J. L., Hofmann K., Kataoka T., Holler N., Tschopp J. TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-
B. Immunity, 7: 831-836, 1997.[Medline]
-
Sprick M. R., Weigand M. A., Rieser E., Rauch C. T., Juo P., Blenis J., Krammer P. H., Walczak H. FADD/MORT1 and caspase-8 are recruited to TRAIL receptors 1 and 2 and are essential for apoptosis mediated by TRAIL receptor 2. Immunity, 12: 599-609, 2000.[Medline]
-
Irmler M., Thome M., Hahne M., Schneider P., Hofmann K., Steiner V., Bodmer J. L., Schroter M., Burns K., Mattmann C., Rimoldi D., French L. E., Tschopp J. Inhibition of death receptor signals by cellular FLIP. Nature (Lond.), 388: 190-195, 1997.[Medline]
-
Hu S., Vincenz C., Ni J., Gentz R., Dixit V. M. I-FLICE, a novel inhibitor of tumor necrosis factor receptor-1- and CD-95-induced apoptosis. J. Biol. Chem., 272: 17255-17257, 1997.[Abstract/Free Full Text]
-
Wiley S. R., Schooley K., Smolak P. J., Din W. S., Huang C. P., Nicholl J. K., Sutherland G. R., Smith T. D., Rauch C., Smith C. A., et al Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity, 3: 673-682, 1995.[Medline]
-
Ashkenazi A., Pai R. C., Fong S., Leung S., Lawrence D. A., Marsters S. A., Blackie C., Chang L., McMurtrey A. E., Hebert A., DeForge L., Koumenis I. L., Lewis D., Harris L., Bussiere J., Koeppen H., Shahrokh Z., Schwall R. H. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Investig., 104: 155-162, 1999.[Medline]
-
Treon S., Chauhan D., Raje N., Teoh G., Webb I., Anderson K. Recombinant human TNF-related apoptosis inducing ligand (hu TRAIL) induces apoptosis of human multiple myeloma (MM) cells. Blood, 92: 2614 1998.
-
Thomas W. D., Hersey P. TNF-related apoptosis-inducing ligand (TRAIL) induces apoptosis in Fas ligand-resistant melanoma cells and mediates CD4 T cell killing of target cells. J. Immunol., 161: 2195-2200, 1998.[Abstract/Free Full Text]
-
Rieger J., Naumann U., Glaser T., Ashkenazi A., Weller M. APO2 ligand: a novel lethal weapon against malignant glioma?. FEBS Lett., 427: 124-128, 1998.[Medline]
-
Kovar H., Auinger A., Jug G., Aryee D., Zoubek A., Salzer-Kuntschik M., Gadner H. Narrow spectrum of infrequent p53 mutations and absence of MDM2 amplification in Ewing tumours. Oncogene, 8: 2683-2690, 1993.[Medline]
-
Quezado M., Gosnay R., Abaza M., Tsokos M. P53 mutations in Ewings sarcoma, primitive neuroectodermal tumors and neuroblastoma. Lab. Investig., 70: A147-A147, 1994.
-
Hunt K. K., Feig B. W. Preclinical experimental therapeutic approaches in soft tissue sarcoma. Semin. Surg. Oncol., 17: 78-82, 1999.[Medline]
-
Wu G. S., Burns T. F., McDonald E. R., III, Meng R. D., Kao G., Muschel R., Yen T., el-Deiry W. S. Induction of the TRAIL receptor KILLER/DR5 in p53-dependent apoptosis but not growth arrest. Oncogene, 18: 6411-6418, 1999.[Medline]
-
Sheikh M. S., Burns T. F., Huang Y., Wu G. S., Amundson S., Brooks K. S., Fornace A. J., Jr., el-Deiry W. S. p53-dependent and -independent regulation of the death receptor KILLER/DR5 gene expression in response to genotoxic stress and tumor necrosis factor
. Cancer Res., 58: 1593-1598, 1998.[Abstract/Free Full Text]
-
Wang J., Zheng L., Lobito A., Chan F. K., Dale J., Sneller M., Yao X., Puck J. M., Straus S. E., Lenardo M. J. Inherited human caspase 10 mutations underlie defective lymphocyte and dendritic cell apoptosis in autoimmune lymphoproliferative syndrome type II. Cell, 98: 47-58, 1999.[Medline]
-
Lin Y., Devin A., Cook A., Keane M. M., Kelliher M., Lipkowitz S., Liu Z. The death domain kinase RIP is essential for TRAIL (Apo2L)-induced activation of I
B kinase and c-Jun N-terminal kinase. Mol. Cell. Biol., 20: 6638-6645, 2000.[Abstract/Free Full Text]
-
Bonavida B., Ng C. P., Jazirehi A., Schiller G., Mizutani Y. Selectivity of TRAIL-mediated apoptosis of cancer cells and synergy with drugs: the trail to non-toxic cancer therapeutics (review). Int. J. Oncol., 15: 793-802, 1999.[Medline]
-
Yeh W. C., Pompa J. L., McCurrach M. E., Shu H. B., Elia A. J., Shahinian A., Ng M., Wakeham A., Khoo W., Mitchell K., El-Deiry W. S., Lowe S. W., Goeddel D. V., Mak T. W. FADD: essential for embryo development and signaling from some, but not all, inducers of apoptosis. Science (Washington DC), 279: 1954-1958, 1998.[Abstract/Free Full Text]
-
Mitsiades N., Poulaki V., Mastorakos G., Tseleni-Balafouta S. T., Kotoula V., Koutras D. A., Tsokos M. Fas ligand expression in thyroid carcinomas: a potential mechanism of immune evasion. J. Clin. Endocrinol. Metab., 84: 2924-2932, 1999.[Abstract/Free Full Text]
-
Scaffidi C., Schmitz I., Zha J., Korsmeyer S. J., Krammer P. H., Peter M. E. Differential modulation of apoptosis sensitivity in CD95 type I and type II cells. J. Biol. Chem., 274: 22532-22538, 1999.[Abstract/Free Full Text]
-
Ozoren N., Fisher M. J., Kim K., Liu C. X., Genin A., Shifman Y., Dicker D. T., Spinner N. B., Lisitsyn N. A., El-Deiry W. S. Homozygous deletion of the death receptor DR4 gene in a nasopharyngeal cancer cell line is associated with TRAIL resistance. Int. J. Oncol., 16: 917-925, 2000.[Medline]
-
Kim K., Fisher M. J., Xu S. Q., el-Deiry W. S. Molecular determinants of response to TRAIL in killing of normal and cancer cells. Clin. Cancer Res., 6: 335-346, 2000.[Abstract/Free Full Text]
-
Pai S. I., Wu G. S., Ozoren N., Wu L., Jen J., Sidransky D., El-Deiry W. S. Rare loss-of-function mutation of a death receptor gene in head and neck cancer. Cancer Res., 58: 3513-3518, 1998.[Abstract/Free Full Text]
-
Nambu Y., Hughes S. J., Rehemtulla A., Hamstra D., Orringer M. B., Beer D. G. Lack of cell surface Fas/APO-1 expression in pulmonary adenocarcinomas. J. Clin. Investig., 101: 1102-1110, 1998.[Medline]
-
Nagane M., Pan G., Weddle J. J., Dixit V. M., Cavenee W. K., Huang H. J. Increased death receptor 5 expression by chemotherapeutic agents in human gliomas causes synergistic cytotoxicity with tumor necrosis factor-related apoptosis-inducing ligand in vitro and in vivo. Cancer Res., 60: 847-853, 2000.[Abstract/Free Full Text]
-
Truneh A., Sharma S., Silverman C., Khandekar S., Reddy M. P., Deen K. C., McLaughlin M. M., Srinivasula S. M., Livi G. P., Marshall L. A., Alnemri E. S., Williams W. V., Doyle M. L. Temperature-sensitive differential affinity of TRAIL for its receptors DR5 is the highest affinity receptor. J. Biol. Chem., 275: 23319-23325, 2000.[Abstract/Free Full Text]
-
Wu G. S., Burns T. F., McDonald E. R., III, Jiang W., Meng R., Krantz I. D., Kao G., Gan D-D., Zhou J-Y., Muschel R., Hamilton S. R., Spinner N. B., Markowitz S., Gary Wu G., El-Deiry W. S. KILLER/DR5 is a DNA damage/inducible p53-regulated death receptor gene. Nat. Genet., 17: 141-143, 1997.[Medline]
-
Degli-Esposti M. A., Smolak P. J., Walczak H., Waugh J., Huang C. P., DuBose R. F., Goodwin R. G., Smith C. A. Cloning and characterization of TRAIL-R3, a novel member of the emerging TRAIL receptor family. J. Exp. Med., 186: 1165-1170, 1997.[Abstract/Free Full Text]
-
Pan G., Ni J., Yu G., Wei Y. F., Dixit V. M. TRUNDD, a new member of the TRAIL receptor family that antagonizes TRAIL signalling. FEBS Lett., 424: 41-45, 1998.[Medline]
-
Marsters S. A., Sheridan J. P., Pitti R. M., Huang A., Skubatch M., Baldwin D., Yuan J., Gurney A., Goddard A. D., Godowski P., Ashkenazi A. A novel receptor for Apo2L/TRAIL contains a truncated death domain. Curr. Biol., 7: 1003-1006, 1997.[Medline]
-
Gliniak B., Le T. Tumor necrosis factor-related apoptosis-inducing ligands antitumor activity in vivo is enhanced by the chemotherapeutic agent CPT-11. Cancer Res., 59: 6153-6158, 1999.[Abstract/Free Full Text]
-
Schirmer W. J., Schirmer J. M., Fry D. E. Recombinant human tumor necrosis factor produces hemodynamic changes characteristic of sepsis and endotoxemia. Arch. Surg., 124: 445-448, 1989.[Abstract]
-
Schiller J. H., Storer B. E., Witt P. L., Alberti D., Tombes M. B., Arzoomanian R., Proctor R. A., McCarthy D., Brown R. R., Voss S. D., et al Biological and clinical effects of intravenous tumor necrosis factor-
administered three times weekly. Cancer Res., 51: 1651-1658, 1991.[Abstract/Free Full Text]
-
Spriggs D. R., Sherman M. L., Michie H., Arthur K. A., Imamura K., Wilmore D., Frei E. D., Kufe D. W. Recombinant human tumor necrosis factor administered as a 24-hour intravenous infusion. A Phase I and pharmacologic study. J. Natl. Cancer Inst., 80: 1039-1044, 1988.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Mongiat, G. Ligresti, S. Marastoni, E. Lorenzon, R. Doliana, and A. Colombatti
Regulation of the Extrinsic Apoptotic Pathway by the Extracellular Matrix Glycoprotein EMILIN2
Mol. Cell. Biol.,
October 15, 2007;
27(20):
7176 - 7187.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yoshida, T. Maoka, S. K. Das, K. Kanazawa, M. Horinaka, M. Wakada, Y. Satomi, H. Nishino, and T. Sakai
Halocynthiaxanthin and Peridinin Sensitize Colon Cancer Cell Lines to Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand
Mol. Cancer Res.,
June 1, 2007;
5(6):
615 - 625.
[Abstract]
[Full Text]
[PDF]
|
 |
|