Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention  Cancer Health Disparities Conference 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dammann, R.
Right arrow Articles by Pfeifer, G. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dammann, R.
Right arrow Articles by Pfeifer, G. P.
[Cancer Research 61, 3105-3109, April 1, 2001]
© 2001 American Association for Cancer Research


Molecular Biology and Genetics

Hypermethylation of the CpG Island of Ras Association Domain Family 1A (RASSF1A), a Putative Tumor Suppressor Gene from the 3p21.3 Locus, Occurs in a Large Percentage of Human Breast Cancers1

Reinhard Dammann, Glen Yang and Gerd P. Pfeifer2

Department of Biology, Beckman Research Institute, City of Hope Cancer Center, Duarte, California 91010


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The human Ras association domain family 1A gene (RASSF1A), recently cloned from the lung tumor suppressor locus 3p21.3, was shown to be hypermethylated in primary lung tumors, and reexpression of RASSF1A suppressed the growth of lung cancer cells (R. Dammann et al., Nat. Genet., 25: 315–319, 2000). In this study, we analyzed the expression and possible alterations of RASSF1A in breast cancer. In five breast cancer cell lines (MCF7, MDAMB157, MDAMB231, T47D, and ZR75–1), the CpG island and promoter of RASSF1A was completely methylated, and transcription was silenced. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A. In 28 of 45 (62%) primary mammary carcinomas, the promoter of RASSF1A was highly methylated at its CpG sites. Coincident with methylation, the expression level of RASSF1A was lower in tumors compared with matching normal tissues. No somatic mutations were found in the samples that were unmethylated. The data suggest that hypermethylation of the CpG island promoter of RASSF1A may play an important role in breast cancer pathogenesis.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Breast cancer is one of the most common malignancies in the world (1) . Only about 7% of breast cancer cases in the United States are thought to be attributable to the presence of an autosomal dominant susceptibility allele (2) . Two familial breast cancer genes (BRCA1 and BRCA2) have been identified (3) . However, mutations in these genes are relatively rare in the general population (4) , and mutations are extremely uncommon in sporadic breast cancers (5, 6, 7, 8) . Alterations or changes in expression levels have been described for several other genes, including p53, E-cadherin, and HER-2/neu (9) . It is very likely that additional genes contribute to inherited and sporadic breast cancer.

In general, both alleles of a tumor suppressor gene need to be inactivated by genetic alterations such as chromosomal deletions or loss-of-function mutations in the coding region of a gene (10) . As an alternative mechanism, epigenetic alterations of tumor suppressor genes may occur in human cancers resulting in gene inactivation. Recent studies (11, 12, 13) have demonstrated that the CpG islands in the RB, p16, VHL, APC, and BRCA1 genes are frequently methylated in a variety of human cancers.

CpG islands that are hypermethylated in breast cancer are those of the genes coding for estrogen receptor (14, 15, 16) , retinoic acid receptor ß2 (17) , E-cadherin (15 , 18 , 19) , BRCA1 (20, 21, 22, 23) , HIC-1 (24) , 14.3.3 {varsigma} (25) , HOXA5 (26) , and TMS1 (27) .

Loss of genetic material from chromosome 3p21.3 is one of the most common and earliest identified events in the pathogenesis of lung cancer (28) . LOH3 at 3p21.3 is not limited to lung tumors, indicating that this region may harbor a broad-spectrum tumor suppressor gene (29) . In breast cancer, LOH frequencies have been reported that are in the range of 25–35% using 3p21 markers (30, 31, 32, 33, 34, 35) . Frequent LOH and the presence of homozygous deletions suggest a critical role of the region 3p21.3 in tumorigenesis, and recently a region of common homozygous deletion in 3p21.3 was narrowed to 120 kb using several lung cancer cell lines and a breast cancer cell line (36) .

In previous work (37) , we have cloned and characterized the Ras association domain family 1A gene (RASSF1A) located within this minimal homozygous deletion region and found that this gene is epigenetically inactivated in 40% of primary lung cancers. Reexpression of RASSF1A in lung cancer cells reduced colony formation, suppressed anchorage-independent growth, and inhibited tumor formation in nude mice.

In this study, we investigated the methylation status, expression, and mutation of RASSF1A in primary breast tumor samples and in breast cancer cell lines.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Tissues.
The breast cancer cell lines MCF7, MDAMB157, MDAMB231, T47D, and ZR75–1 were obtained from the American Type Culture Collection and were cultured in the recommended growth medium. All of the nonmicrodissected primary frozen breast tumors were classified and obtained from the Pathology Department of the City of Hope National Medical Center (Duarte, CA). Each tumor was scored based on formation of tubules, nuclear pleomorphism, and mitotic activity. Each of these was assigned a value of 1–3, and then the totals were added for a score and grade assignment (38) .

Methylation Analysis.
DNA was isolated from cells and tumors, and the methylation status of the RASSF1A promoter region was determined by a bisulfite genomic sequencing protocol (37 , 39) . Briefly, 1 µg of genomic DNA was denatured in 0.3 M sodium hydroxide for 15 min at 37°C. Cytosines were sulfonated in 3.12 M sodium bisulfite (Sigma Chemical Co., St. Louis, MO) and 5 mM hydroquinone (Sigma) in a thermocycler for 16 h at 55°C. The DNA samples were desalted through columns (Wizard DNA Clean-Up System; Promega), desulfonated in 0.3 M sodium hydroxide, and precipitated. DNA sequences were amplified by mixing 100 ng of bisulfite-treated DNA with primers MU379 (5'GTTTTGGTAGTTTAATGAGTTTAGGTTTTTT) and ML730 (5'ACCCTCTTCCTCTAACACAATAAAACTAACC) in 100 µl of reaction buffer containing 200 µM of each dNTP and Taq polymerase (Roche Diagnostics Corp., Indianapolis, IN) and incubated at 95°C for 15 s, 55°C for 15 s, and 74°C for 30 s for 20 cycles. A semi-nested PCR was performed using 1 of 50 of the initially amplified products and an internal primer ML561 (5'CCCCACAATCCCTACACCCAAAT) and primer MU379 with similar conditions as described for the preceding PCR amplification but for 30 cycles. The PCR products were purified using QIAquick PCR purification kits (Qiagen, Valencia, CA). Products were sequenced directly to obtain average methylation levels. PCR products containing bisulfite-resistant cytosines were ligated into the pCR2.1 vector (Invitrogen, Carlsbad, CA), and several clones were sequenced for confirmation. All of the described sequences were determined by cycle sequencing and run on an ABI 377 automated DNA sequencer. The percentage of methylated alleles was estimated from the relative peak heights of the G and A peaks at methylated CpG sequences after normalizing the A peak for the average peak height along the entire sequence and subtracting the background for the G peak.

For the restriction enzyme analysis of PCR products from bisulfite-treated DNA (40) , 50 ng of the PCR products were digested with 10 units of TaqI (New England Biolabs, Beverly, MA) according to conditions specified by the manufacturer of the enzyme and analyzed on a 2.2% Tris-borate EDTA agarose gel.

RT-PCR Analysis.
Total RNA from cells or tissues was isolated by the guanidinium isothiocyanate method (RNAgents; Promega). RT-PCR was essentially performed as described (37) . Briefly, 100 ng of RNA was preassociated with of a lower primer from exon 4. After the reverse transcription reaction, half of the samples were pipetted into tubes containing PCR master mix and an upper primer from exon 2{alpha}ß, and the remaining half were added into tubes containing PCR mix and an upper primer from exon 2{gamma}. These conditions selectively amplify transcripts RASSF1A and RASSF1C, respectively. PCR conditions were 95°C for 30 s, 60°C for 30 s, and 74°C for 1 min for 20 cycles for the RASSF1 gene and 15 cycles for the GAPD gene. These cycle numbers were chosen because they were in the exponential range of product amplification. PCR products were separated on 2% Tris-borate EDTA agarose gels, blotted, hybridized with a labeled probe from exon 3, and visualized by autoradiography.

Reexpression of RASSF1A.
Breast cancer cell lines were treated with 5-Aza-CdR (Sigma). Cells (2 x 106) each were grown for 4 days in the presence of different concentrations of 5-Aza-CdR. RNA was isolated, and RT-PCR was performed as described above.

Mutation Screening.
Exon sequences were amplified by mixing 200 ng of genomic DNA with 16 pmol of each exon-specific primer in 100 µl of reaction buffer containing 200 µM of each dNTP and Taq polymerase (Roche Diagnostics Corp.) and incubated at 95°C for 30 s, 60°C for 30 s, and 74°C for 1 min for 35 cycles. PCR products were purified using QIAquick PCR purification kit (Qiagen), and both strands were sequenced directly without subcloning.

LOH Analysis.
The microsatellite markers used were D3S4615/LUCA8.1 (28) . For PCR amplification, one of the primers was end-labeled with {gamma}[32P]ATP and T4 polynucleotide kinase (New England Biolabs). PCR was carried out in a 25-µl volume containing 50 ng of genomic DNA, 12.5 pmol of each primer, 200 µM of each dNTP, and Taq DNA polymerase (Roche Diagnostics Corp.) at 95°C for 20 s, 54°C for 20 s, and 74°C for 30 s for 35 cycles. PCR products were separated on an 8% denaturing polyacrylamide gel and visualized by autoradiography. LOH was defined as a more than 50% reduction of intensity in one of the two alleles as compared with that seen in the corresponding normal control.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In previous work, we have shown that the transcript of the RASSF1A gene was missing in lung cancer cell lines and that loss of expression correlated with hypermethylation of the CpG island promoter sequence of RASSF1A (37) . To elucidate the status of RASSF1A during breast cancer pathogenesis, we analyzed the methylation pattern of five breast cancer cell lines (MCF7, MDAMB157, MDAMB231, T47D, and ZR75–1). We used bisulfite sequencing of genomic DNA (39) to determine the methylation status of the CpG island, in which RASSF1A transcription initiates. In this method, sodium bisulfite is used to convert all of the unmethylated cytosines to uracils and then to thymines during the subsequent PCR step. Because 5-methylcytosine remains nonreactive, all of the cytosines after sequence analysis represent only methylated cytosines. Therefore, all of the guanines present after sequencing in Fig. 1Citation are derived from methylated cytosines on the complementary strand. We analyzed 16 CpGs in a 205-bp fragment containing three Sp1 consensus binding sites and the transcription and translation initiation sites of RASSF1A. All of the CpG sites in these five breast cancer cell lines were completely methylated (Fig. 1Citation , Fig. 2Citation , and data not shown). Furthermore, we analyzed the methylation status of the RASSF1A promoter in 45 primary breast cancer samples obtained from the City of Hope Medical Center (Fig. 1)Citation . Of the 45 mammary carcinomas analyzed, 28 (62%) were methylated in the promoter region. The methylation data are summarized in Table 1Citation . Forty-one of these 45 cases were ductal carcinomas representing all of the grades of invasion. Of the two lobular carcinomas analyzed, one was methylated, and one colloid carcinoma was methylated. One phyllode cystosarcoma was not methylated. All of the three grade I carcinomas were completely methylated in the RASSF1A promoter region. Of the 15 grade II carcinomas analyzed, 8 (53%) were methylated, and 9 (60%) of the 15 grade III carcinomas were methylated. The grades of 12 breast carcinomas were unknown, and 8 (67%) of these were methylated. From the 45 tumor cases, we analyzed 40 matching normal tissue samples. Three (7.5%) of these normal samples were methylated but at a lower degree than the corresponding tumor samples. In Fig. 1ACitation , a methylated ductal carcinoma (BC11) and its corresponding normal tissue is shown. The sequence of the PCR product of the carcinoma shows approximately 60% bisulfite modification-resistant cytosines at CpGs (shown as G peaks on the complementary strand). One problem with direct sequencing of PCR products from bisulfite-treated DNA is the common presence of an unspecific background signal of Gs in the sequencing scans (Fig. 1)Citation , which is also present in unmethylated samples where all of the Cs are converted. The ABI sequencing software unnaturally increases the G signal at non-CpG sites to somehow preserve a normal distribution of the four nucleotides. One way to eliminate this problem is to subclone the PCR fragments into plasmids. The flanking plasmid sequence has a normal distribution of all of the four nucleotides and, therefore, the data show no background in these samples (Fig. 1a)Citation . The disadvantage of the subcloning is that several subclones must be analyzed to obtain quantitative data. In the case of BC11, three of the seven analyzed subclones (43%) showed a pattern of complete methylation.



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 1. Methylation analysis of the RASSF1A gene in breast cancer. Sequences of PCR products from bisulfite-treated DNA for the CpG island spanning the RASSF1A promoter were obtained from different cancer and normal samples. Methylated cytosines appear as a G signal in the complementary strand (bold Gs). The sequence is shown before and after bisulfite conversion at the top. The position of a TaqI restriction site is underlined. Two Sp1 consensus binding sites are boxed. a, sequencing data for two breast cancer cell lines (T47D and ZR75–1) and one primary breast carcinoma (BC11) and its matching normal tissue are shown. Data were obtained by direct sequencing of PCR products from bisulfite-treated DNA or from PCR products subcloned into plasmids. b, sequences of PCR products from bisulfite-treated DNA of 12 primary breast tumors. The percentage of methylated alleles for the three CpG sites (±SD) was estimated from the relative peak heights of the G and A peaks.

 


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 2. Methylation analysis of RASSF1A by restriction digestion with TaqI. PCR products from bisulfite-treated DNA obtained from different cell lines, primary tumors (T), and normal samples (N) were digested (+) or mock-digested (-) with TaqI. The sizes of molecular weight markers (M) are shown on the right in bp.

 

View this table:
[in this window]
[in a new window]
 
Table 1 Summary of the methylation analysis

 
A larger series of sequencing data are shown in Fig. 1bCitation . These nonmicrodissected breast tumors show an estimated frequency of methylated alleles of between 53 and 74%. With the exception of one CpG site in sample BC29, which showed only a low frequency of methylation, all of the other CpG sequences had a similarly uniform range of methylation levels of greater than 50% (Fig. 1bCitation and data not shown).

A second method to analyze the PCR fragments obtained from bisulfite-modified DNA is by further digestion with a restriction enzyme that has a CpG in its consensus sequence (40) . TaqI (5'TCGA-3') will cut only previously methylated DNA after bisulfite treatment and PCR. The consensus sequence will be lost in unmethylated samples. The analyzed 205-bp fragment has two TaqI sites. Restriction digestion of methylated fragments results in three bands (90, 81, and 34 bp; the two larger ones migrating together). PCR fragments from the breast cancer cell lines MCF7 and T47D showed complete methylation at these TaqI sites (Fig. 2)Citation . The restriction digest of MDAMB231, MDAMB157, and ZR75–1 also showed 100% methylation (data not shown). In Fig. 2Citation , we analyzed three primary ductal carcinomas by TaqI restriction (BC10, BC11, and BC12). The tumor samples showed approximately 50–60% methylation of the TaqI sites. The matching normal DNA samples were unmethylated. These data and several others (data not shown) confirm the results obtained by direct sequencing.

We analyzed the expression of RASSF1A in breast cancer cell lines by RT-PCR (Fig. 3)Citation . ZR75–1, T47D, MDAMB231, and MCF7 (Fig. 3)Citation , as well as MDAMB157 (data not shown), showed only traces of expression. At the same time, the alternative transcript RASSF1C (37) was present at high levels in all of the cell lines. Epigenetic inactivation of genes by DNA methylation can be reversed by treatment with the DNA methylation inhibitor 5-Aza-CdR (41) . The four cell lines were treated with this compound for 4 days at various concentrations. 5-Aza-CdR reactivated expression of RASSF1A in all of the four cell lines (Fig. 3)Citation .



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 3. Expression and reexpression of RASSF1A by treatment with 5-Aza-CdR in four breast cancer cell lines. The cell lines were treated for 4 days with the indicated concentrations of 5-Aza-CdR. RASSF1A and RASSF1C were analyzed by RT-PCR. Expression of GAPD was determined as a control for RNA integrity.

 
We also performed RT-PCR on primary tumors (Fig. 4)Citation . This analysis is more difficult because normal cells are present, and the RNA quality is not always very good. We were able to obtain good quality RNA from four matched samples of normal breast tissue and tumor in which the tumor DNA was methylated. In Fig. 4Citation , we show by quantitative RT-PCR that expression of RASSF1A is three to ten times lower in the tumor tissues compared with the normal matching tissues.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 4. Expression of RASSF1A in primary breast cancer samples and matching normal tissue controls. RASSF1A and GAPD were analyzed by RT-PCR using PCR cycle numbers chosen to give product amplification in the exponential range.

 
Mutation analysis was carried out to search for changes in the coding sequence of RASSF1A in those samples that were unmethylated. In the 17 samples analyzed, no base changes were found. A common polymorphism was identified in exon 1 [AAG(Lys21)/CAG(Gln21)].


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In our previous work (37) , we have cloned and characterized RASSF1A. RASSF1A was epigentically inactivated in 40% of the analyzed primary non-small cell lung tumors and in several different cancer cell lines. In this study, we demonstrate that in primary breast tumors the RASSF1A promoter is methylated at an even higher frequency (62%). The degree of methylation at CpG sites in these nonmicrodissected carcinomas ranged from 50 to 75% and was nearly 100% for all of the five analyzed breast cancer cell lines. A degree of methylation of more than 50% would suggest either that both alleles are methylated or that one allele is methylated and the other one is lost. LOH of 3p21 for breast cancer was reported to be between 25 and 35% (30, 31, 32, 33, 34, 35) . Using the microsatellite marker D3S4615/LUCA8.1, which is approximately 140 kb proximal to the RASSF1 gene, we found LOH in 3 of 19 (16%) of informative cases. Two of the samples with LOH were methylated.

Methylation and LOH may be the major loss of function pathways for the RASSF1A gene because somatic mutations appear to be rare in this gene (37) . Interestingly, we could detect a constant methylation frequency of RASSF1A in all of the different grades of the mammary carcinomas. RASSF1A inactivation was already very high in grade I tumors (Table 1)Citation . Thus, methylation of RASSF1A may be an early event during breast cancer pathogenesis. We could detect some methylation in 7.5% of the samples, which were classified as normal tissue removed with tumor surgery. It will be interesting to investigate whether this methylation occurs as part of the aging process, a phenomenon that has been described for other genes (42) .

Hypermethylation of the RASSF1A promoter appears to be the main mechanism of inactivation. Our data support the revised Knudson two-hit theory (12) . In this new hypothesis, epigenetic mechanisms of gene inactivation are included. Epigenetic silencing was shown to be a common mechanism for loss of function for several tumor suppressor genes including p16, VHL, MLH1, and also BRCA1. BRCA1 promoter methylation of sporadic breast carcinomas was at least four times less frequent compared with the hypermethylation of RASSF1A (20, 21, 22, 23) . The precise function of RASSF1A is still unclear, and more biochemical and genetic data are needed to understand its role in tumorigenesis. In a recent study, Vos et al. (43) have shown that RASSF1C binds RAS in a GTP-dependent manner, similar as its closest homologue, the mammalian Ras effector Nore1 (44) . Overexpression of RASSF1C induced apoptosis. Because isoforms RASSF1A and RASSF1C share the identical RAS association domain, it is possible that RASSF1A will bind to RAS in the same manner as RASSF1C. Activated RAS proteins are usually associated with growth enhancement and transformation. However, RAS also can induce growth inhibitory effects manifested by senescence (45) , terminal differentiation (46) , or apoptosis (47) . RASSF1 might be responsible for the RAS-dependent growth inhibition through its proapoptotic function (43) . Loss of RASSF1 expression by methylation in human cancer may shift the balance of RAS activities toward a growth-promoting effect without the necessity of RAS-activating mutations.

None of the genes located within the 3p21.3 homozygous deletion region was found to be mutated in more than 5–10% of lung tumors (48) . This supports the assumption that the putative 3p21.3 tumor suppressor gene is inactivated by mechanisms other than mutation of the coding sequence. The high frequency of epigenetic inactivation of the RASSF1A gene in breast cancer supports its role as a putative tumor suppressor gene.


    ACKNOWLEDGMENTS
 
We thank S. Bates for technical support.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a Grant from the University of California Tobacco Related Disease Research Program (9RT-0175). Back

2 To whom requests for reprints should be addressed, at Department of Biology, Beckman Research Institute, City of Hope Cancer Center, Duarte, CA 91010. Phone: (626) 301-8853; Fax: (626) 358-7703; E-mail: gpfeifer{at}coh.org Back

3 The abbreviations used are: LOH, loss of heterozygosity; dNTP, deoxynucleotide triphosphate; 5-Aza-CdR, 5-aza-2'-deoxycytidine; CpG, 5'-CpG-3' dinucleotide; RT-PCR, reverse-transcription-PCR. Back

Received 8/18/00. Accepted 1/29/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hunter C. P. Epidemiology, stage at diagnosis, and tumor biology of breast carcinoma in multiracial and multiethnic populations. Cancer (Phila.), 88: 1193-1202, 2000.[Medline]
  2. Blackwood M. A., Weber B. L. BRCA1 and BRCA2: from molecular genetics to clinical medicine. J. Clin. Oncol., 16: 1969-1977, 1998.[Abstract]
  3. Ford D., Easton D. F. The genetics of breast and ovarian cancer. Br. J. Cancer, 72: 805-812, 1995.[Medline]
  4. Peto J., Collins N., Barfoot R., Seal S., Warren W., Rahman N., Easton D. F., Evans C., Deacon J., Stratton M. R. Prevalence of BRCA1 and BRCA2 gene mutations in patients with early-onset breast cancer. J. Natl. Cancer Inst. (Bethesda), 91: 943-949, 1999.[Abstract/Free Full Text]
  5. Futreal P. A., Liu Q., Shattuck-Eidens D., Cochran C., Harshman K., Tavtigian S., Bennett L. M., Haugen-Strano A., Swensen J., Miki Y., et al BRCA1 mutations in primary breast and ovarian carcinomas. Science (Washington DC), 266: 120-122, 1994.[Abstract/Free Full Text]
  6. Teng D. H., Bogden R., Mitchell J., Baumgard M., Bell R., Berry S., Davis T., Ha P. C., Kehrer R., Jammulapati S., Chen Q., Offit K., Skolnick M. H., Tavtigian S. V., Jhanwar S., Swedlund B., Wong A. K., Kamb A. Low incidence of BRCA2 mutations in breast carcinoma and other cancers. Nat. Genet., 13: 241-244, 1996.[Medline]
  7. Lancaster J. M., Wooster R., Mangion J., Phelan C. M., Cochran C., Gumbs C., Seal S., Barfoot R., Collins N., Bignell G., Patel S., Hamoudi R., Larsson C., Wiseman R. W., Berchuck A., Iglehart J. D., Marks J. R., Ashworth A., Stratton M. R., Futreal P. A. BRCA2 mutations in primary breast and ovarian cancers. Nat. Genet., 13: 238-240, 1996.[Medline]
  8. Miki Y., Katagiri T., Kasumi F., Yoshimoto T., Nakamura Y. Mutation analysis in the BRCA2 gene in primary breast cancers. Nat. Genet., 13: 245-247, 1996.[Medline]
  9. Ingvarsson S. Molecular genetics of breast cancer progression. Semin. Cancer Biol., 9: 277-288, 1999.[Medline]
  10. Knudson A. G., Jr. Mutation and cancer: statistical study of retinoblastoma. Proc. Natl. Acad. Sci. USA, 68: 820-823, 1971.[Abstract/Free Full Text]
  11. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
  12. Jones P. A., Laird P. W. Cancer epigenetics comes of age. Nat. Genet., 21: 163-167, 1999.[Medline]
  13. Herman J. G., Baylin S. B. Promoter-region hypermethylation and gene silencing in human cancer. Curr. Top. Microbiol. Immunol., 249: 35-54, 2000.[Medline]
  14. Ottaviano Y. L., Issa J. P., Parl F. F., Smith H. S., Baylin S. B., Davidson N. E. Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. Cancer Res., 54: 2552-2555, 1994.[Abstract/Free Full Text]
  15. Nass S. J., Herman J. G., Gabrielson E., Iversen P. W., Parl F. F., Davidson N. E., Graff J. R. Aberrant methylation of the estrogen receptor and E-cadherin 5' CpG islands increases with malignant progression in human breast cancer. Cancer Res., 60: 4346-4348, 2000.[Abstract/Free Full Text]
  16. Yoshida T., Eguchi H., Nakachi K., Tanimoto K., Higashi Y., Suemasu K., Iino Y., Morishita Y., Hayashi S. Distinct mechanisms of loss of estrogen receptor {alpha} gene expression in human breast cancer: methylation of the gene and alteration of trans-acting factors. Carcinogenesis (Lond.), 21: 2193-2201, 2000.[Abstract/Free Full Text]
  17. Widschwendter M., Berger J., Hermann M., Muller H. M., Amberger A., Zeschnigk M., Widschwendter A., Abendstein B., Zeimet A. G., Daxenbichler G., Marth C. Methylation and silencing of the retinoic acid receptor-ß2 gene in breast cancer. J. Natl. Cancer Inst. (Bethesda), 92: 826-832, 2000.[Abstract/Free Full Text]
  18. Graff J. R., Herman J. G., Lapidus R. G., Chopra H., Xu R., Jarrard D. F., Isaacs W. B., Pitha P. M., Davidson N. E., Baylin S. B. E-cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas. Cancer Res., 55: 5195-5199, 1995.[Abstract/Free Full Text]
  19. Graff J. R., Gabrielson E., Fujii H., Baylin S. B., Herman J. G. Methylation patterns of the E-cadherin 5' CpG island are unstable and reflect the dynamic, heterogeneous loss of E-cadherin expression during metastatic progression. J. Biol. Chem., 275: 2727-2732, 2000.[Abstract/Free Full Text]
  20. Rice J. C., Massey-Brown K. S., Futscher B. W. Aberrant methylation of the BRCA1 CpG island promoter is associated with decreased BRCA1 mRNA in sporadic breast cancer cells. Oncogene, 17: 1807-1812, 1998.[Medline]
  21. Catteau A., Harris W. H., Xu C. F., Solomon E. Methylation of the BRCA1 promoter region in sporadic breast and ovarian cancer: correlation with disease characteristics. Oncogene, 18: 1957-1965, 1999.[Medline]
  22. Esteller M., Silva J. M., Dominguez G., Bonilla F., Matias-Guiu X., Lerma E., Bussaglia E., Prat J., Harkes I. C., Repasky E. A., Gabrielson E., Schutte M., Baylin S. B., Herman J. G. Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J. Natl. Cancer Inst. (Bethesda), 92: 564-569, 2000.[Abstract/Free Full Text]
  23. Rice J. C., Ozcelik H., Maxeiner P., Andrulis I., Futscher B. W. Methylation of the BRCA1 promoter is associated with decreased BRCA1 mRNA levels in clinical breast cancer specimens. Carcinogenesis (Lond.), 21: 1761-1765, 2000.[Abstract/Free Full Text]
  24. Fujii H., Biel M. A., Zhou W., Weitzman S. A., Baylin S. B., Gabrielson E. Methylation of the HIC-1 candidate tumor suppressor gene in human breast cancer. Oncogene, 16: 2159-2164, 1998.[Medline]
  25. Ferguson A. T., Evron E., Umbricht C. B., Pandita T. K., Chan T. A., Hermeking H., Marks J. R., Lambers A. R., Futreal P. A., Stampfer M. R., Sukumar S. High frequency of hypermethylation at the 14–3-3 {varsigma} locus leads to gene silencing in breast cancer. Proc. Natl. Acad. Sci. USA, 97: 6049-6054, 2000.[Abstract/Free Full Text]
  26. Raman V., Martensen S. A., Reisman D., Evron E., Odenwald W. F., Jaffee E., Marks J., Sukumar S. Compromised HOXA5 function can limit p53 expression in human breast tumours. Nature (Lond.), 405: 974-978, 2000.[Medline]
  27. Conway K. E., McConnell B. B., Bowring C. E., Donald C. D., Warren S. T., Vertino P. M. TMS1, a novel proapoptotic caspase recruitment domain protein, is a target of methylation-induced gene silencing in human breast cancers. Cancer Res., 60: 6236-6242, 2000.[Abstract/Free Full Text]
  28. Wistuba I. I., Behrens C., Virmani A. K., Mele G., Milchgrub S., Girard L., Fondon J. W., III, Garner H. R., McKay B., Latif F., Lerman M. I., Lam S., Gazdar A. F., Minna J. D. High resolution chromosome 3p allelotyping of human lung cancer and preneoplastic/preinvasive bronchial epithelium reveals multiple, discontinuous sites of 3p allele loss and three regions of frequent breakpoints. Cancer Res., 60: 1949-1960, 2000.[Abstract/Free Full Text]
  29. Kok K., Naylor S. L., Buys C. H. C. M. Deletions of the short arm of chromosome 3 in solid tumors and the search for suppressor genes. Adv. Cancer Res., 71: 27-92, 1997.[Medline]
  30. Sato T., Akiyama F., Sakamoto G., Kasumi F., Nakamura Y. Accumulation of genetic alterations and progression of primary breast cancer. Cancer Res., 51: 5794-5799, 1991.[Abstract/Free Full Text]
  31. Deng G., Chen L. C., Schott D. R., Thor A., Bhargava V., Ljung B. M., Chew K., Smith H. S. Loss of heterozygosity and p53 gene mutations in breast cancer. Cancer Res., 54: 499-505, 1994.[Abstract/Free Full Text]
  32. Matsumoto S., Kasumi F., Sakamoto G., Onda M., Nakamura Y., Emi M. Detailed deletion mapping of chromosome arm 3p in breast cancers: a 2-cM region on 3p14.3–21.1 and a 5-cM region on 3p24.3–25.1 commonly deleted in tumors. Genes Chromosomes Cancer, 20: 268-274, 1997.[Medline]
  33. Driouch K., Briffod M., Bieche I., Champeme M. H., Lidereau R. Location of several putative genes possibly involved in human breast cancer progression. Cancer Res., 58: 2081-2086, 1998.[Abstract/Free Full Text]
  34. Braga E., Pugacheva E., Bazov I., Ermilova V., Kazubskaya T., Mazurenko N., Kisseljov F., Liu J., Garkavtseva R., Zabarovsky E., Kisselev L. Comparative allelotyping of the short arm of human chromosome 3 in epithelial tumors of four different types. FEBS Lett., 454: 215-219, 1999.[Medline]
  35. Osborne R. J., Hamshere M. G. A genome-wide map showing common regions of loss of heterozygosity/allelic imbalance in breast cancer. Cancer Res., 60: 3706-3712, 2000.[Abstract/Free Full Text]
  36. Sekido Y., Ahmadian M., Wistuba I. I., Latif F., Bader S., Wei M-H., Duh F-M., Gazdar A. F., Lerman M. I., Minna J. D. Cloning of a breast cancer homozygous deletion junction narrows the region of search for a 3p21.3 tumor suppressor gene. Oncogene, 16: 3151-3157, 1998.[Medline]
  37. Dammann R., Li C., Yoon J. H., Chin P. L., Bates S., Pfeifer G. P. Epigenetic inactivation of a RAS association domain family protein from the lung tumor suppressor locus 3p21.3. Nat. Genet., 25: 315-319, 2000.[Medline]
  38. Simpson J. F., Page D. L. Status of breast cancer prognostication based on histopathologic data. Am. J. Clin. Pathol., 102: 3s-8s, 1994.
  39. Clark S. J., Harrison J., Paul C. L., Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res., 22: 2990-2997, 1994.[Abstract/Free Full Text]
  40. Xiong Z., Laird P. W. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res., 25: 2532-2534, 1997.[Abstract/Free Full Text]
  41. Jones P. A., Taylor S. M. Cellular differentiation, cytidine analogs, and DNA methylation. Cell, 20: 85-93, 1980.[Medline]
  42. Ahuja N., Li Q., Mohan A. L., Baylin S. B., Issa J. P. Aging and DNA methylation in colorectal mucosa and cancer. Cancer Res., 58: 5489-5494, 1998.[Abstract/Free Full Text]
  43. Vos M. D., Ellis C. A., Bell A., Birrer M. J., Clark G. J. Ras uses the novel tumor suppressor RASSF1 as an effector to mediate apoptosis. J. Biol. Chem., 275: 35669-35672, 2000.[Abstract/Free Full Text]
  44. Vavvas D., Li X., Avruch J., Zhang X-F. Identification of Nore1 as a potential Ras effector. J. Biol. Chem., 273: 5439-5442, 1998.[Abstract/Free Full Text]
  45. Serrano M., Lin A. W., McCurrach M. E., Beach D., Lowe S. W. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell, 88: 593-602, 1997.[Medline]
  46. Bar-Sagi D., Feramisco J. R. Microinjection of the ras oncogene protein into PC12 cells induces morphological differentiation. Cell, 42: 841-848, 1985.[Medline]
  47. Downward J. Ras signaling and apoptosis. Curr. Opin. Genet. Dev., 8: 49-54, 1998.[Medline]
  48. Lerman M. I., Minna J. D. The 630-kb lung cancer homozygous deletion region on human chromosome 3p21.3: identification and evaluation of the resident candidate tumor suppressor genes. The International Lung Cancer Chromosome 3p21.3 Tumor Suppressor Gene Consortium. Cancer Res., 60: 6116-6133, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
M. C. Gongora, H. E. Lob, U. Landmesser, T. J. Guzik, W. D. Martin, K. Ozumi, S. M. Wall, D. S. Wilson, N. Murthy, M. Gravanis, et al.
Loss of Extracellular Superoxide Dismutase Leads to Acute Lung Damage in the Presence of Ambient Air: A Potential Mechanism Underlying Adult Respiratory Distress Syndrome
Am. J. Pathol., October 1, 2008; 173(4): 915 - 926.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Maruyama, K. Akino, M. Toyota, H. Suzuki, T. Imai, M. Ohe-Toyota, E. Yamamoto, M. Nojima, T. Fujikane, Y. Sasaki, et al.
Cytoplasmic RASSF2A is a proapoptotic mediator whose expression is epigenetically silenced in gastric cancer
Carcinogenesis, July 1, 2008; 29(7): 1312 - 1318.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. W. Whitehurst, R. Ram, L. Shivakumar, B. Gao, J. D. Minna, and M. A. White
The RASSF1A Tumor Suppressor Restrains Anaphase-Promoting Complex/Cyclosome Activity during the G1/S Phase Transition To Promote Cell Cycle Progression in Human Epithelial Cells
Mol. Cell. Biol., May 15, 2008; 28(10): 3190 - 3197.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E.-S. Lee, J.-P. Issa, D. B. Roberts, M. D. Williams, R. S. Weber, M. S. Kies, and A. K. El-Naggar
Quantitative Promoter Hypermethylation Analysis of Cancer-Related Genes in Salivary Gland Carcinomas: Comparison with Methylation-Specific PCR Technique and Clinical Significance
Clin. Cancer Res., May 1, 2008; 14(9): 2664 - 2672.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. G. Rivenbark and W. B. Coleman
The Use of Epigenetic Biomarkers for Preclinical Detection of Hepatocellular Carcinoma: Potential for Noninvasive Screening of High-Risk Populations
Clin. Cancer Res., April 15, 2007; 13(8): 2309 - 2312.
[Full Text] [PDF]


Home page
Endocr Relat CancerHome page
J. Geli, N. Kiss, F. Lanner, T. Foukakis, N. Natalishvili, O. Larsson, P. Kogner, A. Hoog, G. J Clark, T. J Ekstrom, et al.
The Ras effectors NORE1A and RASSF1A are frequently inactivated in pheochromocytoma and abdominal paraganglioma
Endocr. Relat. Cancer, March 1, 2007; 14(1): 125 - 134.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
J. Pijnenborg, G. Dam-de Veen, N Kisters, B Delvoux, M van Engeland, J. Herman, and P. Groothuis
RASSF1A methylation and K-ras and B-raf mutations and recurrent endometrial cancer
Ann. Onc., March 1, 2007; 18(3): 491 - 497.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
A. Romano, B. Delvoux, D.-C. Fischer, and P. Groothuis
The PROGINS polymorphism of the human progesterone receptor diminishes the response to progesterone
J. Mol. Endocrinol., February 1, 2007; 38(2): 331 - 350.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
Y. M. Coyle, X.-J. Xie, C. M. Lewis, D. Bu, S. Milchgrub, and D. M. Euhus
Role of Physical Activity in Modulating Breast Cancer Risk as Defined by APC and RASSF1A Promoter Hypermethylation in Nonmalignant Breast Tissue
Cancer Epidemiol. Biomarkers Prev., February 1, 2007; 16(2): 192 - 196.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. D. Williams, N. Chakravarti, M. S. Kies, S.-I. Maruya, J. N. Myers, J. C. Haviland, R. S. Weber, R. Lotan, and A. K. El-Naggar
Implications of Methylation Patterns of Cancer Genes in Salivary Gland Tumors
Clin. Cancer Res., December 15, 2006; 12(24): 7353 - 7358.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. G. Amaar, M. G. Minera, L. K. Hatran, D. D. Strong, S. Mohan, and M. E. Reeves
Ras association domain family 1C protein stimulates human lung cancer cell proliferation
Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1185 - L1190.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Visvanathan, S. Sukumar, and N. E. Davidson
Epigenetic Biomarkers and Breast Cancer: Cause for Optimism.
Clin. Cancer Res., November 15, 2006; 12(22): 6591 - 6593.
[Full Text] [PDF]


Home page
GutHome page
P Minoo, K Baker, R Goswami, G Chong, W D Foulkes, A R Ruszkiewicz, M Barker, D Buchanan, J Young, and J R Jass
Extensive DNA methylation in normal colorectal mucosa in hyperplastic polyposis
Gut, October 1, 2006; 55(10): 1467 - 1474.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Li, T. Rauch, Z.-X. Chen, P. E. Szabo, A. D. Riggs, and G. P. Pfeifer
The Histone Methyltransferase SETDB1 and the DNA Methyltransferase DNMT3A Interact Directly and Localize to Promoters Silenced in Cancer Cells
J. Biol. Chem., July 14, 2006; 281(28): 19489 - 19500.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Vos, A. Dallol, K. Eckfeld, N. P. C. Allen, H. Donninger, L. B. Hesson, D. Calvisi, F. Latif, and G. J. Clark
The RASSF1A Tumor Suppressor Activates Bax via MOAP-1
J. Biol. Chem., February 24, 2006; 281(8): 4557 - 4563.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Dote, D. Cerna, W. E. Burgan, D. J. Carter, M. A. Cerra, M. G. Hollingshead, K. Camphausen, and P. J. Tofilon
Enhancement of In vitro and In vivo Tumor Cell Radiosensitivity by the DNA Methylation Inhibitor Zebularine
Clin. Cancer Res., June 15, 2005; 11(12): 4571 - 4579.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Strunnikova, U. Schagdarsurengin, A. Kehlen, J. C. Garbe, M. R. Stampfer, and R. Dammann
Chromatin Inactivation Precedes De Novo DNA Methylation during the Progressive Epigenetic Silencing of the RASSF1A Promoter
Mol. Cell. Biol., May 15, 2005; 25(10): 3923 - 3933.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Agathanggelou, W. N. Cooper, and F. Latif
Role of the Ras-Association Domain Family 1 Tumor Suppressor Gene in Human Cancers
Cancer Res., May 1, 2005; 65(9): 3497 - 3508.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Tommasi, R. Dammann, Z. Zhang, Y. Wang, L. Liu, W. M. Tsark, S. P. Wilczynski, J. Li, M. You, and G. P. Pfeifer
Tumor Susceptibility of Rassf1a Knockout Mice
Cancer Res., January 1, 2005; 65(1): 92 - 98.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. M. Lewis, L. R. Cler, D.-W. Bu, S. Zochbauer-Muller, S. Milchgrub, E. Z. Naftalis, A. M. Leitch, J. D. Minna, and D. M. Euhus
Promoter Hypermethylation in Benign Breast Epithelium in Relation to Predicted Breast Cancer Risk
Clin. Cancer Res., January 1, 2005; 11(1): 166 - 172.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. Dulaimi, J. Hillinck, I. I. de Caceres, T. Al-Saleem, and P. Cairns
Tumor Suppressor Gene Promoter Hypermethylation in Serum of Breast Cancer Patients
Clin. Cancer Res., September 15, 2004; 10(18): 6189 - 6193.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. J. Fackler, M. McVeigh, J. Mehrotra, M. A. Blum, J. Lange, A. Lapides, E. Garrett, P. Argani, and S. Sukumar
Quantitative Multiplex Methylation-Specific PCR Assay for the Detection of Promoter Hypermethylation in Multiple Genes in Breast Cancer
Cancer Res., July 1, 2004; 64(13): 4442 - 4452.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Widschwendter, K. D. Siegmund, H. M. Muller, H. Fiegl, C. Marth, E. Muller-Holzner, P. A. Jones, and P. W. Laird
Association of Breast Cancer DNA Methylation Profiles with Hormone Receptor Status and Response to Tamoxifen
Cancer Res., June 1, 2004; 64(11): 3807 - 3813.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Mehrotra, M. Vali, M. McVeigh, S. L. Kominsky, M. J. Fackler, J. Lahti-Domenici, K. Polyak, N. Sacchi, E. Garrett-Mayer, P. Argani, et al.
Very High Frequency of Hypermethylated Genes in Breast Cancer Metastasis to the Bone, Brain, and Lung
Clin. Cancer Res., May 1, 2004; 10(9): 3104 - 3109.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Mehrotra, M. M. Ganpat, Y. Kanaan, M. J. Fackler, M. McVeigh, J. Lahti-Domenici, K. Polyak, P. Argani, T. Naab, E. Garrett, et al.
Estrogen Receptor/Progesterone Receptor-Negative Breast Cancers of Young African-American Women Have a Higher Frequency of Methylation of Multiple Genes than Those of Caucasian Women1
Clin. Cancer Res., March 15, 2004; 10(6): 2052 - 2057.
[Abstract] [Full Text] [PDF]