
[Cancer Research 61, 3110-3118, April 1, 2001]
© 2001 American Association for Cancer Research
Molecular Biology and Genetics |
The Retinoblastoma Gene Regulates Somatic Growth during Mouse Development1
Alexander Yu. Nikitin2,
Bei Shan3,
Andrea Flesken-Nikitin2,
Kai-Hsuan Chang4 and
Wen-Hwa Lee5
Department of Molecular Medicine/Institute of Biotechnology, The University of Texas Health Science Center, San Antonio, Texas 78245-3207
 |
ABSTRACT
|
|---|
Overexpression of the retinoblastoma gene (Rb) in mice leads to the dwarf phenotype. To explore the potential mechanism of Rb effects on the somatic growth, bitransgenic mice with tetracycline-regulated Rb expression were generated, and their phenotypes were compared with those of previously established Rb mouse models. By gestational day 12.5, embryos lacking Rb and those expressing twice the regular amount of Rb are 15% larger and 1030% smaller, respectively, compared with their wild-type littermates. The dwarf phenotype is associated with increased plasma levels of insulin-like growth factor-I (IGF-I) but not with growth hormone and glucose concentrations. Down-regulation of the Rb transgene expression results in a reduction of the IGF-I plasma concentrations to normalcy and an increase of somatic growth prenatally and postnatally. Consistent with the in vivo results, cells overexpressing Rb require higher thresholds of IGF-I to stimulate proliferation. Thus, Rb plays an integral role for mouse somatic growth and maintenance during ontogenesis, and IGF-I pathway is likely to be a target for such regulation.
 |
INTRODUCTION
|
|---|
The Rb6
susceptibility gene (Rb) encodes a nuclear phosphoprotein with DNA-binding properties. Defects in Rb-associated pathways are considered to be among the most common mechanisms contributing to cancer (1, 2, 3, 4)
. Reconstitution of Rb results in suppression of the malignant phenotype both ex vivo and in vivo (4, 5, 6, 7, 8)
. A better understanding of how Rb functions in vivo may directly facilitate the rational design of Rb gene therapy and prevention, as well as forecast potential tissue-specific effects of such treatments.
Ex vivo studies indicate pleiotropic functions of Rb in restriction of cell cycle progression, mediation of terminal differentiation, and control of cell survival (7
, 9, 10, 11, 12, 13, 14, 15, 16, 17)
. Consistently, these biological functions of Rb were also revealed in animal studies. The complete absence of Rb leads to mouse death by GD 14.5 (18, 19, 20)
. By this stage, Rb-/- mice exhibit ectopic deregulated proliferation, excessive apoptosis, aberrant differentiation in the neural tissues and ocular lenses, and defects in erythropoiesis (12
, 18, 19, 20, 21, 22, 23)
. Mice expressing <50% of the amount of Rb in wild-type littermates survive until birth but have defects in skeletal muscle development (24)
. Moreover, chimeric animals with an extensive contribution from Rb-deficient cells develop normally (25
, 26)
. These findings indicate an essential role of microenvironment in the survival and growth of Rb-deficient chimeras. Compared with their wild-type littermates, Rb+/- mice are larger, and their tissues contain approximately 60% of Rb present in wild-type littermates (1
, 27)
. Conversely, overexpression of Rb in transgenic mice results in dose-dependent reduction in weight (28
, 29)
. The timing of the influence of Rb during development and its contribution to the general maintenance of somatic growth remain unclear. Because Rb has pleiotropic functions in various cell lineages, its influence on body growth and weight may result from either central or peripheral mechanisms. In one scenario, alterations of Rb expression in neurogenesis might result in specific defects in cells responsible for growth regulation, e.g., neurons producing growth hormone-releasing factor (30)
or hepatocytes producing serum IGF-I. In this case, expression of pertinent growth stimulatory factors, GH or IGF-I, might be lower than normal. Alternatively, Rb may influence the differentiation of specific tissues or cell types, e.g., adipocytes (16)
, serve as a general negative regulator of cell proliferation, or perhaps perform both functions. Such peripheral Rb functions would be expected to increase the amount of growth/differentiation-promoting factors because of feedback mechanisms.
To address how Rb regulates somatic growth, mice with conditionally regulated Rb were prepared. Tetracycline-mediated transgene regulation offers advantages over constitutive, continuous expression of exogenous gene, for it allows the evaluation of dosage-specific effects of the gene expression during a defined window of the time (31, 32, 33, 34, 35, 36, 37)
. Thus, the complexities of the whole organism in growth regulation and maintenance of homeostasis can be alleviated considerably. Using this mouse model, the results described in this study suggest that Rb plays an integral role for mouse somatic growth and maintenance during ontogenesis, and IGF-I is likely to be an important mediator for this process.
 |
MATERIALS AND METHODS
|
|---|
Constructs.
To construct RBp-tTA, the SV40 late polyadenylation signal BamHI-HindIII fragment of pUHD151, containing tetR-VP-16 (tTA) chimeric gene (31)
, was substituted with the 300-bp bovine growth hormone polyadenylation site (38)
derived from pGKneo (18)
resulting in construct pGK6. The 1.6-kb EcoRI-HindIII RB promoter derived from plasmid pRB-CAT (39)
was cloned to pBluescript II SK+/-, resulting in construct pBSK-RBp. The SalI-EcoRI 0.6-kb fragment containing the rabbit ß-globin intron from pCMV-Neo Bam (40)
and the 1.3-kb EcoRI-XhoI tTA-bpA from pGK6 were ligated to the SalI-digested pBSK-RBp, resulting in RBp-tTA. To generate hCMV*-1p-RB, the 2.8-kb BamHI fragment of pRB442 containing full length RB cDNA (28
, 41)
and the 1.6-kb BamHI-HindIII ß-globin polyadenylation site (28)
were ligated into BamHI-HindIII restricted pUHD 10-3 (31)
.
Experimental Animals.
To prepare transgenic mice, either the 4.9-kb XhoI-HindIII fragment of hCMV*-1p-RB or 3.6-kb PstI-XhoI fragment of RBp-tTA (Fig. 1, A and B)
were isolated with GELase (Epicentre Technologies, Madison, WI) and injected into fertilized eggs of superovulated C57BL mice at a concentration of 2 ng/µl. One-cell embryos were transferred to the oviducts of pseudopregnant CBA females according to Hogan et al. (42)
. Bitransgenic mice with conditionally regulated RB transgene were obtained as a result of a cross between transgenic hCMV*-1-RB and RBp-tTA animals. All of the animals were screened for transgene integration by PCR analyses of DNA from digits (Fig. 1C
and below). Copy number, structure, and orientation of the transgenes were analyzed by Southern hybridization of genomic DNA after endonuclease restriction.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1. Preparation of mice with regulated expression of the human RB transgene. A, RBp-tTA transgene consists of the RB promoter fused to the ß-globin intron, followed by tetR/VP16 transactivator (tTA) and the bovine growth hormone polyadenylation site (bGH pA). B, hCMV*-1p-RB transgene consists of the minimal CMV promoter/tet activator (hCMV*-1 promoter), RB cDNA, and the ß-globin polyadenylation site (pA). C, identification of RBp-tTA (upper panel) and CMV*-1p-RB (lower panel) transgenic animals by PCR genotyping. 284-bp, 160-bp, 194-bp, and 114-bp fragments are diagnostic for the mouse Brca1 gene, tTA, mouse Rb gene, and human RB cDNA, respectively. Wild-type (Lanes 1 and 4), Tg RBp-tTA (Lane 5), Tg hCMV*-1p-RB (Lanes 6 and 8), and bitransgenic RBp-tTA/hCMV*-1p-RB (Lanes 2, 3, and 7) mice are identified. D, luciferase activity in primary mouse tail fibroblasts transfected with luciferase reporter plasmid pUHC-13-3. Average luminescence in transfected wild-type cell lysates (n = 10) was defined as one RU. All of the measurements were repeated twice in triplicates.
|
|
Preparation and characterization of mice with a mutant copy of the Rb gene (18)
and mice containing the human RB transgene under control of the RB promoter (28)
have been described previously. To exclude possible inadvertent effects of a mixed genetic background, all of the mice were intercrossed for more than 10 generations. All of the mice were maintained identically, following the recommendations of the Institutional Laboratory Animal Use and Care Committee. Animals were housed under minimum stress conditions and a circadian pattern that included light from 5:00 a.m. to 7:00 p.m. GD 1 and P 1 were considered completed at midnight of the day after mating and 24 h after birth, respectively.
Genotyping.
Rb+/+, Rb+/-, and Rb-/- mice were identified by PCR genotyping essentially as described (43)
. RB transgenic mice were identified with primers corresponding to sequences of RB/Rb exons 15 and 16, RB15,5'/Rb15,5', and RB16,3'/Rb16,3' (44)
. An intron of 80 bp separates exons 15 and 16 (39)
. Therefore, PCR amplification of genomic Rb gene sequences and transgenic RB cDNA results in 196-bp and 116-bp DNA fragments, respectively. The PCR temperature profile was 94°C for 30 s, 60°C for 1 min, and 72°C for 2 min. Transgenic (Tg) RBp-tTA animals were detected with primers corresponding to sequences of tTA and bovine growth hormone polyadenylation site, tet,5' (5'TTACCGATGCCCTTGGAATTGACGA 3') and bpA,3' (5'TGGGAGTGGCACCTTCCAGGGTCAA3'). Primers recognizing mouse Brca1, Brca1,5' (5'CAGCCTGAGACCAGCAGTTTATTG3'), and Brca1,3' (5'GCTGCTATTTAGTGTTATCCAAG3') were used for internal control of gene amplification efficiency.
The PCR reaction mixture includes 50 mM KCl, 10 mM Tris-HCl (pH 8.3 at 25°C), 1.5 mM MgCl2, 0.001% gelatin, deoxynucleotide triphosphates (200 µM of each), primers (0.4 µM of each), and 0.5 units of recombinant Taq polymerase (AmpliTaq; Perkin-Elmer, Boston, MA) in a final volume of 25 µl. Amplifications were performed in 30 cycles with temperature profile: 94°C, 30 s; 65°C, 1 min; 72°C, 2 min with elongation of the terminal extension step to 10 min at 72°C. The resulting DNA fragments were electrophoresed for 30 min on 4% NuSieve:SeaKem (3:1) composite gel.
Tetracycline Administration.
Tetracycline hydrochloride (Sigma Chemical Co., St. Louis, MO) was applied either in drinking water (1 mg/ml, with the addition of 5% sucrose) or by slow release pellet (35 mg/pellet for 21 days; Innovative Research of America, Sarasota, FL). Similar results were observed in both systems as well as after administration of doxycycline hydrochloride (200 µg/ml; Sigma Chemical Co.).
Hormone and Glucose Measurements.
Repeated 100-µl blood samples were collected from the retrorbital venous plexus in heparinized tubes, whereas animals were anesthetized with chloral hydrate (400 µg/g body weight) at either 9:00 a.m. or 4:00 p.m. After centrifugation at 4°C, plasma samples were stored at -80°C until assayed. Growth hormone was quantified with a rat growth hormone 125I-labeled assay system, using magnetic separation according to the manufacturers instructions (Amersham Corp., Arlington Heights, IL). Plasma IGF-I levels were measured by RIA with an IGF-I-RIA kit (Peninsula Laboratories, San Carlos, CA). Blood glucose concentrations were determined with One Touch quantitative test based on a colorimetric assay (Lifescan, Milpitas, CA).
Body Weight and Skeleton Analyses.
Fetuses, placentas, and internal organs of adult animals were fixed in 4% paraformaldehyde and washed in PBS. Upon the elimination of excess of liquid, the mass of samples was estimated with precision to four significant figures. Weighing of living animals was performed at 4 p.m.
Morphological Analyses and Immunostainings.
All of the mouse tissues were either immersed in Bouins fluid or fixed in phosphate-buffered 4% paraformaldehyde by perfusion at 90 mm of Hg in mice anesthetized with avertin. After evaluation and dissection under a stereo operation microscope (Nikon), all of the samples were embedded in paraffin (Paraplast X-TRA; Fisher), sectioned at 4 µm, and stained with Mayers hemalum and eosin. Immunohistochemical detections of human and mouse Rb on paraffin sections of paraformaldehyde-fixed material were performed essentially as described earlier (7
, 43)
.
Protein Analyses.
Immunoprecipitations were performed as in Bignon et al. (28)
. Briefly, subconfluent cells or snap-frozen tissues were washed three times with ice-cold PBS and lysed in 250 buffer [50 mM Tris-HCl (pH 7.4); 250 mM NaCl; 5 mM EDTA; 0.1% NP40; 50 mM NaF; 1 mM phenylmethylsulfonyl fluoride; 1 mM DTT; 50 µg/ml aprotinin;1 µg/ml antipain; 1 µg/ml pepstatin A; and 1 µg/ml leupeptin]. After a freeze-thaw cycle, precleared supernatants were immunoprecipitated with either rabbit polyclonal immunoglobulin fraction C-15 (Santa Cruz Biotechnology; Santa Cruz, CA) or Mab 11D7 (45)
, followed by protein Sepharose CL-4B (Pharmacia Biotech; Peapack, NJ). Western immunoblotting was performed with Mab 245 (46)
.
Primary Cell Culture.
Tail fragments of 2 cm in length were collected from adult mice, minced, and incubated in 10 ml of cDMEM containing 1 mg/ml dispase for 1 h at 37°C. Dispersed cells were then plated on two 10-cm dishes with fresh cDMEM. Medium was changed daily, and outgrown cells were passed on the seventh day of culture.
Cell Transfection.
Forty eight h after transfection with pUHC-13-3 (31)
, cells were collected and processed for luciferase detection assay according to the manufacturers protocol (Promega, Madison, WI).
Analysis of IGF Effects on Cells in Culture.
Primary tail fibroblasts were continuously kept in cDMEM with 1 µg/ml of tetracycline hydrochloride. For analyses, cells were split onto 12-well plates (0 22 mm; Corning). In the test group, medium was changed for cDMEM without tetracycline 4 h after passage. Twenty h later, medium was changed for serum-free DMEM (Life Technologies, Inc.) containing 50 µg/ml transferrin (Sigma Chemical Co.) and 0.1% BSA Fraction V (Sigma Chemical Co.) with and without tetracycline. After 48 h, cells were exposed to growth factors and 10 µg/ml BrdUrd (Sigma Chemical Co.) as described in Fig. 6
. After incubation for 16 h, cells were washed with PBS, fixed in 4% paraformaldehyde for 30 min at 4°C, treated with 4 N HCl for 10 min to denature the DNA, and stained according to the regular immunohistochemical protocol (43)
. For estimation of BrdUrd index, at least 200 cells were counted in triplicate, and all of the experiments were repeated twice.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 6. Effect of Rb expression on IGF-induced DNA synthesis in primary mouse tail fibroblasts. A, regulation of RB expression in primary tail fibroblasts by tetracycline. The IP-WB procedure is described in Fig. 2B
, wild-type and RTg primary tail fibroblasts were kept in serum-free medium with and without tetracycline, Tet+ and Tet-, respectively. They were exposed to 5, 20, 50, or 100 ng/ml IGF-I (human, recombinant; Life Technologies, Inc.) in combination with 5 ng/ml platelet-derived growth factor-BB (human, recombinant; Life Technologies, Inc.) for 16 h. The BrdUrd index was estimated as described in "Material and Methods." RU were estimated after normalization for values of wild-type fibroblasts treated identically.
|
|
Statistical Analyses.
All of the statistical analyses were performed with programs InStat, InPlot, and Prism (GraphPad, San Diego, CA). The life spans of animals were determined as the intervals from birth until natural death. Survival curves were compared by log rank Mantel-Haenszel tests. Two-tailed Fishers and Students t tests were used to compare mean values when appropriate. Survival fractions were calculated using the Kaplan-Meier method.
 |
RESULTS
|
|---|
Generation of Mice with Conditional Regulation of RB Expression.
To establish an animal model in which human RB gene expression could be regulated, two groups of transgenic mice were prepared. In the first group, mice harbor a transgene consisting of the 1.6-kb human RB promoter driving expression of the chimeric transcription transactivator tetR/VP16 (Tg tetR/VP16; Fig. 1, A and C
). Tissue-specific and developmentally adequate patterns of expression provided by this RB regulatory element have been demonstrated earlier (28
, 39)
. In the second group, mice harbor a transgene consisting of a minimal CMV promoter-tet operator fused to the wild-type human RB cDNA (Tg hCMV*-1p-RB; Fig. 1, B and C
). The potential for leakage of the minimal CMV promoter was reduced by designing the hCMV*-1p/RB junction portion devoid of additional translation initiation sites. Because the minimal CMV promoter-tet operator becomes activated only upon binding of the tetR/VP16, expression of this transgene will be detected only in bitransgenic mice derived from the cross between Tg tetR/VP16 and Tg hCMV*-1p-RB. Tetracycline or its analogues inactivate the chimeric transcription transactivator tetR/VP16; therefore, their administration allows for conditional regulation of RB expression in the bitransgenic mice.
In the preliminary screen for tetR/VP16 expression, transgenic mouse tail fibroblasts were transfected with luciferase reporter plasmid pUHC-13-3 (31)
. In cells from four of six transgenic lines, luciferase activity was more than 4-fold higher compared with transfected cells derived from nontransgenic fibroblasts (Fig. 1D)
. To evaluate possible adverse biological side effects of tetR/VP16, growth, body weight, fertility, and feeding habits of Tg RBp-tTA mice were evaluated (Table 1
and data not shown). In five of six Tg RBp-tTA lines, no obvious toxic effects of tetR/VP16 on development were observed.
Because of the significant transactivating activity observed in primary tail fibroblast cell culture transfection assays (Fig. 1D)
and the lack of detectable influence on the body weight (Table 1)
, the Tg RBp-tTA L14 founder line (Tg L14) was selected for subsequent crosses with Tg hCMV*-1p-RB lines. Compared with nontransgenic and single-transgenic littermates, bitransgenic mice in two of eight Tg hCMV*-1-RB lines crossed with Tg L14 were significantly smaller (Table 1)
. The Tg hCMV*-1p-RB L9 line (Tg L9) was used further to screen the remaining Tg RBp-tTA mice. Bitransgenic mice with either Tg hCMV*-1p-RB L9 or L10, and either Tg RBp-tTA L14 or L15 were chosen for subsequent analyses based on their obvious dwarf phenotypes and abundant expression of exogenous RB (Table 1
; Fig. 2
). Mice with these transgene combinations are almost identical in their phenotype and hereafter will be described together as mice with regulated expression of RB transgene (RTg). In pilot experiments, similar results were observed both in females and in males. To reduce the number of animals required for study, the majority of the subsequent experiments were performed on females.
Exogenous RB Gene Is Biologically Effective and Can Be Tightly Regulated.
RB expression was demonstrated by IP-WB analyses in all of the tissues of bitransgenic mice but not Tg hCMV*-1p-RB mice (Fig. 2)
. Similar to a line of mice (RB3) expressing the human RB transgene constitutively (Table 1
; Refs. 27
, 28
), bitransgenic mice with 1525% body weight reduction expressed exogenous RB at 80100% of endogenous levels (Fig. 2
; Table 1
). In concert with endogenous Rb, transgenic RB is hypo- and hyper-phosphorylated in brain and spleen, respectively (Fig. 2)
. At the cellular level, expression patterns of exogenous and endogenous RB/Rb were very similar; e.g., in the brain, both Rb and RB were located in the nuclei of neuronal and glial cells (Fig. 3, BD and F)
. Endothelial cells contained undetectable amounts of both proteins (Fig. 3, BD and F)
, as observed previously (43)
.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2. RB expression in brain, lung, and spleen tissues before and after tetracycline treatment (Tet- and Tet+, respectively) in 30-day old mice containing either one (hCMV*-1-RB) or both transgenes (hCMV*-1-RB and RBp-tTA). Mab 11D7 (45)
is specific for the human RB protein. Mab 245 (46)
and C-15 antiserum recognize both human and mouse RB.
|
|

View larger version (209K):
[in this window]
[in a new window]
|
Fig. 3. Immunohistochemical characterization of RB transgene expression in paraformaldehyde-fixed, paraffin-embedded sections of the lateral subcortical brain areas collected from 30-day-old mice carrying either hCMV*-1p-RB transgene alone (A and B) or both pRBtTA and hCMV*-1p-RB transgenes (CF) after treatment with vehicle (AD) or tetracycline (E and F). RB protein was detected with either human specific polyclonal antibody .495 (A, C, and E) or with antimouse/human C-15 serum (B, D, and F). Note nuclear location of endogenous and exogenous protein (arrows) in neuronal and glial cells but not in endothelial cells (arrowheads). A, C, and E, 4',6-diamidino-2-phenylindole counterstain. B, D, and F, methyl green counterstain. Calibration bar, 50 µm.
|
|
As an additional important test for exogenous, transgenic RB function, carcinogenesis in transgenic mice carrying a single copy of endogenous Rb was studied. Nontransgenic mice carrying a single allele of the Rb gene develop multiple neuroendocrine tumors and die prematurely at a mean of 346 ± 5 days (SE; median, 346 days; 7, 8, 43, 44). The mean survivals ± SE of Rb+/- mice with either Tg hCMV*-1p-RB (n = 11) or Tg RBp-tTA (n = 12) were 345 ± 15 days (median, 355 days) or 345 ± 25 days (median, 354 days), respectively. In contrast, all of the 12 bitransgenic Rb+/- mice survived over 440 days without developing tumors. Thus, the 1.6-kb fragment of RB promoter of Tg RBp-tTA is sufficient to direct a pattern of expression similar to that of endogenous Rb and to rescue the malignant phenotype in Rb+/- mice, as described previously (27
, 28)
. Because a 10% increase in the amount of exogenous Rb is sufficient for prevention of tumor formation (27)
, the above results indicate no significant leakage of the RB transgene under the control of the CMV minimal promoter. Furthermore, they argue against inadvertent effects on carcinogenesis by the chimeric transactivator Tg RBp-tTA itself. The expected patterns of expression, nuclear localization, appropriate phosphorylation, and efficient rescue of malignant phenotypes all indicate the biological competence of the exogenous RB in the established mouse bitransgenic model.
To test whether RB expression could be conditionally regulated, tetracycline was administered to mice, either in drinking water or by drug pellets (see "Materials and Methods"). In agreement with earlier observations on the tetracycline-mediated regulation of transgene expression (33
, 35
, 36
, 47)
, tetracycline administration for 3 days was sufficient for complete repression of transgene expression, as determined by both IP-WB and immunohistochemistry (Fig. 2
; Fig. 3, AF
; and Fig. 6A
). A period of 7 days was required to observe an increase in the amount of RB after tetracycline withdrawal (data not shown). Thus, RB expression can be tightly controlled by treatment with tetracycline.
RB Is Involved in Regulation of Somatic Growth.
The present work on RTg mice and previous work (27
, 28)
on mice carrying an RB minitransgene (RB3) demonstrated dwarf phenotypes in mice overexpressing RB. To determine whether somatic growth retardation reflects a specific physiological function of Rb or is a potentially harmful consequence of gene overexpression, we evaluated weight of embryos and placentas expressing different amounts of RB during development. No difference was observed in animals with any genotype by GD 11.5 (Fig. 4, A and B)
. However, on the GD 12.5, the body weight of Rb-/- mice increased by 15% (115% ± 2; n = 12; P < 0.0001), as compared with their wild-type littermates (100% ± 2; n = 17). At the same time, Rb+/- mice expressing about 5060% of Rb were slightly lighter (105% ± 2; n = 12; P = 0.0906), whereas RTg and RB3 embryos, all of which overexpress RB, became lighter (89% ± 6; n = 8; P = 0.0374; and 92% ± 3; n = 14; P = 0.0297, respectively). Thus, a relative amount of total RB expression correlates with the weight of the mouse embryos. By GD 14.5, body weight was about 1525% lower in the RTg and RB3 embryos compared with wild-type or single transgene littermates. According to histological and skeletal analyses, no retardation in differentiation and development of tissues was observed (data not shown). Notably, although Rb is expressed in the placenta (48)
,7
no significant correlation between RB amount and placenta weight was observed (Fig. 4B)
. To address whether the observed results reflect RB functions, as opposed to nonspecific effects of transgene integration and expression, RB expression was reduced by administration of tetracycline (Fig. 4, A and B)
during the entire embryonic development period until body weights were measured. RTg mice were almost identical to their nontransgenic littermates on GDs 14.5 and 16.5, as well as on P 1 and P 8 (Fig. 4C)
. No significant changes in placenta weights were observed. A specific influence of Rb expression on embryonic, as opposed to placental, development indicates involvement of Rb in the control of individual signal transduction pathways. Taken together, these data support physiological involvement of Rb protein in regulation of the somatic as opposed to placental growth, beginning at GD 12.5.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4. Conditional regulation of growth by Rb. Body (A) and placental (B) weights of mice without (Rb-/-, Rb+/-, Rb+/+, RB3, and RTg Tet-) and with (RTg Tet+) exposure to tetracycline from the time of fertilization. Lethality prevented collection of Rb-/- embryos from GD 13.5. Because of normally large individual deviations (64)
, placental weights were not determined after GD 16.5. C, body weights after temporary perinatal tetracycline administration. Animals were either not exposed to tetracycline (Rb+/+, RB3, and RTg Tet-), exposed from fertilization until the time of body weight measurement (RTg Tet+), exposed until GD 14.5 (RTg Tet-14), or exposed beginning at GD 14.5 (RTg Tet+14). All of the values (mean ± SE) represent normalized RUs, defined as a percentage of values for wild-type littermates subjected to identical exposure to tetracycline. D, transgenic/nontransgenic weight ratio (percentage) of L9L14 (RTg) mice without (RB3, RTg Tet-) and with (RTg Tet+) administration of tetracycline applied starting at P 24 (arrow). Representative examples from each group of at least 12 animals are presented. All of the animals were evaluated with matched wild-type and single transgenic littermates as controls.
|
|
Growth Regulatory Effects of Rb on Somatic Growth Are Reversible.
To determine whether quantitative effects of RB expression on mouse growth are limited to a certain period of mouse development or persistent, tetracycline administration was used to control RB amounts temporally. To test for the role of Rb during embryonic development, tetracycline was given to pregnant mothers from the time of fertilization until GD 14.5. Body weights of either fetuses or pups were then determined on GDs 14.5 and 16.5 or on P 1 and 8. The removal of tetracycline and the following decrease in RB amounts resulted in complete rescue of the dwarf phenotype by the P 1 (Fig. 4C)
. Administration of tetracycline at an earlier developmental stage (GD 14.5) also led to normalization of mouse body weight (Fig. 4C)
. These results, together with our observations of growth alterations in GD 12.5 embryos (see above), demonstrate that variations in Rb expression define the ultimate body weight of mouse fetuses.
To test whether Rb expression influences body weight during postnatal development, animals were exposed to tetracycline from P 24. The removal of tetracycline resulted in an increased growth rate for the few subsequent days (Fig. 4D)
. On average, animals regained up to 1015% of their body weights (Fig. 4D
; Table 2
). To characterize potential tissue-specific effects of Rb-mediated dwarfism and its reversion by RB down-regulation, organs and body dimensions were carefully monitored. The weights of carcasses and major organs and the parameters of longitudinal growth (lengths of nose to anus distance, tail, and humerus) were measured in RTg mice before and after tetracycline application (Table 2)
. Continuous RB overexpression results in relatively proportional reductions in the weight of major organs and carcass. As compared with other organs, the weights of pituitary gland and spleen were somewhat lower, both in RB3 and in RTg mice. Interestingly, only minor changes were observed in the longitudinal growth parameters of either group of mice. Down-regulation of Rb expression postnatally resulted in a 1018% gain of the weight of parenchymal organs. The most dramatic effect was observed in the weight increase of ovaries (32%), spleen (31%), and skin (22%). Only very slight changes were observed in the weight of heart and para-ovarian fat in body and tail lengths. Morphological analyses of brain, cerebellum, pituitary gland, thyroid gland, lungs, thymus, stomach, small and large intestine, liver, kidney, adrenal gland, gonads, spleen, pancreas, salivary glands, prostate/uterus, mammary glands, trigeminal nerve, eyes, heart, and striated muscles of the thigh demonstrated proportional changes in the size of particular tissue compartments. No significant hypoplasia, hyperplasia, edema, and/or adipose accumulation were observed in any of the tissues analyzed. However, we cannot exclude subtle changes in cellular size and/or proliferation beyond the limits of direct microscopic evaluation. Taken together, our results demonstrate continuous involvement of Rb in weight regulation of the internal organs.
Rb Expression Correlates with Levels of Plasma IGF-I.
To determine which major pathways regulating somatic growth during ontogenesis were subject to Rb influence, amounts of plasma IGF-I, GH, and glucose (as an indicator for insulin) were measured in RTg mice before and after tetracycline application. No significant deviations in the concentration of GH and glucose were observed (Fig. 5, A and C)
. In contrast, IGF-I levels were 194% ± 15 (mean ± SE; n = 16; P < 0.0001) and 180% ± 13 (n = 9; P < 0.0001) higher in RTg and RB3 mice when compared with sex-matched wild-type littermates (100 ± 8; n = 14; Fig. 5B
). Application of tetracycline to RTg mice for 3 days resulted in decreased plasma IGF-I concentrations to normal values, coincident with Rb down-regulation. The normal IGF-I concentrations were maintained after tetracycline administration for 14 days. In a reverse experiment, IGF-I, GH, and glucose concentrations were measured in RTg animals receiving tetracycline in utero since fertilization, both before and after tetracycline withdrawal. Three days after tetracycline withdrawal, increased RB expression coincided with an elevation of plasma IGF-I concentrations but not with changes in either GH or glucose concentrations. IGF-I concentrations increased further when animals were maintained for 14 days in tetracycline-free conditions. This gradual increase probably reflected a requirement for plasma clearance of tetracycline. Thus, a tight correlation exists between amounts of RB expressed and plasma IGF-I concentration, but neither GH nor glucose concentrations were significantly affected by RB.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 5. Relative plasma concentrations of GH (A), IGF-I (B), and glucose (C) in 30-day-old RTg mice never exposed to tetracycline (none), exposed for either 3 days (+3 d) or 14 days (+14 d), or exposed since fertilization and withdrawn from tetracycline treatment for either 3 days (-3 d) or 14 days (-14). RU were estimated after normalization for values of wild-type littermates undergoing the same treatment protocol.
|
|
High Concentrations of IGF-I Are Required to Stimulate Proliferation of Fibroblasts Overexpressing RB.
To test directly the existence of IGF-mediated signal transduction via Rb, primary fibroblast cultures derived from tails of either RTg or nontransgenic mice were exposed to different concentrations of IGF-I either in the presence or in the absence of tetracycline. The addition of 5 ng/µl IGF-I was sufficient for stimulation of DNA synthesis in G0-arrested RTg fibroblasts with repressed expression of RB to levels similar with those of wild-type fibroblasts (Fig. 6, A and B)
. In contrast, RTg fibroblasts with RB expression required the addition of 100 ng/µl of IGF-I for 70% stimulation of BrdUrd incorporation. Thus, Rb expression can effectively block cell proliferation induced by IGF-I. This block can be partially overcome by increased amounts of IGF-I in a dose-dependent manner. These results further suggest that Rb may serve as a general negative regulator of cell proliferation stimulated by IGF-I.
 |
DISCUSSION
|
|---|
Rb plays a significant role in the prenatal development of neural, hematopoietic, and skeletal muscle tissues. However, its functions in postnatal development have been less understood. Our results demonstrate that Rb is an important component in integrative regulation of body growth during the most of ontogenesis. Quantitative changes in the Rb amount and phosphorylation status can be detected by GD 10.5 (12)
. At this time, the amount of Rb increases, and the hypophosphorylated, functionally active fraction becomes apparent. By GD 14.5, phosphorylated, inactive forms of Rb are nearly undetectable. Interestingly, this period coincides with a general decrease in embryonic growth rate (49)
. As shown in the present study, the absence of Rb results in an increase of total embryo weight by GD 12.5. This weight increase can be measured only for a short period, for the Rb-/- embryos die by GD 14.5. At the same time, the overexpression of Rb decreases embryonic weight in a dose-dependent fashion (the present study and Refs. 27
, 28
). Thus, Rb modulates body growth from GD 12.5 forwards.
Rb-mediated dwarfism begins during prenatal development and is maintained through adult life. Continuous expression of Rb during postnatal development (43
, 48)
indicates a persistent function for Rb in the majority of organs and tissues. The preparation of mice with tightly regulated Rb expression allowed us to determine that maintenance of the mass of organs and tissues is continuously responsive to Rb. Indeed, lowering Rb levels results in compensatory growth during both prenatal and postnatal development. Because such regulation of growth was observed in all of the organs tested, this novel function of Rb should be biologically relevant for the majority of cell types. It should be noted that although we were unable to observe any specific alterations in cell differentiation and survival upon modulation of Rb quantity, additional functions of Rb in postnatal cells could not be excluded by these studies. Indeed, the spectrum of Rb effects and their thresholds undoubtedly vary in different cell types. It was noted that developmental and carcinogenic effects associated with Rb deficiency are observed only in some of tissues with the highest expression of the protein (43
, 48
, 50)
. In some cells, biological effects of Rb may not be evident because of compensatory modulation of the related proteins, p107 and p130 (51
, 52)
. Additional studies are warranted to address the issue regarding the extent of Rb contribution to the maintenance of differentiation and the survival of specific cell types in vivo.
Phosphorylation leading to the inactivation of Rb growth inhibitory functions is achieved by cyclin-dependent protein kinases and cyclins (for review, see Refs. 3
, 53
). On the other hand, these kinase activities are modulated by cyclin-dependent protein kinase inhibitors of the INK and Cip/Kip families, p15, p16, p18, p19 and p21, p27, p57, respectively. As expected from these functions established ex vivo, cyclin D and p27 are indeed involved in growth regulation. Mice without functional cyclin D are smaller than their littermates (54
, 55)
. In contrast, mice deficient for p27 are larger (56, 57, 58)
. Intriguingly, other genes such as p21, p16, and p57 implicated in the regulation of Rb function either do not have an effect on somatic growth (59
, 60) or affect development of only some compartments, such as limbs (61)
. In the latter case, the phenotype of shortened extremities is quite similar to that observed in mice with simultaneous inactivation of the p107 and p130 genes (62)
. Thus, genetic studies of animal models pinpoint interactions between Rb, cyclin D, and p27 as most biologically critical and nonredundant. Some phenotypes in mice with cyclin D and p27 disruption differ from those in Rb-transgenic mice; e.g., defects in mammary gland development and female sterility are observed only in cyclin D- and p27-deficient mice, respectively. The relevance of these phenotypes to Rb-mediated pathways remains to be evaluated. Future analyses of mice with conditionally regulated expression of Rb should enable us to evaluate the possible contribution of other Rb-upstream regulators as temporarily and spatially active effectors of the somatic growth.
Somatic growth relies on the balance between rates of cell proliferation and death, as well as on changes in the volume of cells and extracellular matrix that are frequently associated with the changes in the differentiation stage (63)
. IGF-I and -II, as well as GH, are major factors responsible for systemic growth stimulation (64, 65, 66, 67, 68, 69)
. Transgenic mice overexpressing IGF-I (70)
and GH (69
, 71)
exhibit accelerated body growth. Mice with mutations in the IGF-I receptor (64
, 72)
, IGF-I (64
, 67
, 72)
, IGF-II, (66)
and GH receptor (73)
exhibit pronounced growth retardation. Mice homozygous for IGF-I receptor mutations are 45% of normal size and die at birth (72)
, whereas IGF-I mutants are <60% of their wild-type littermates and only occasionally survive postnatally (67
, 72)
. A less severe phenotype is observed in mice with a single copy of the IGF-I gene. These mice are 1020% smaller than the wild-type littermates and contain 37% lower levels of serum IGF-I (67)
; therefore, they demonstrate the quantitative effects of the gene dosage. Similar gene dosage effects were demonstrated in RB transgenic mice (the present study and Refs. 28
, 29
). As opposed to IGF-I and the IGF-I receptor, IGF-II affects not only somatic growth but also growth of the placenta. The effect on the placenta is explained by the signaling of IGF-II through a genetically identified unknown receptor (64)
. The IGF-II-specific signal transduction pathway complements signaling through the IGF-I receptor that is common for IGF-I and IGF-II (64)
. It is likely that Rb is involved in signaling through IGF-I receptor but not through IGF-II-specific pathway because Rb expression does not reduce growth of the placenta. Accordingly, both IGF-I and RB regulate somatic growth both pre- and postnatally, whereas the role of IGF-II is mainly limited to the prenatal phase of development (64
, 66
, 72)
. Immediate involvement of RB in GH-mediated signaling is also unlikely, because no correlation between RB and GH quantities were observed and because GH influences growth beginning at puberty but not in perinatal development (71
, 74)
. Furthermore, variations in GH concentrations observed in this study are within physiological range (69
, 71
, 75)
. Similarly, any major involvement of insulin-signaling pathway in growth regulation mediated by RB is unlikely, because variations of glucose concentrations are not significant (76)
, and no correlation was observed between amounts of glucose and RB in these mice.
Growth regulation by GH and IGF signaling involves well-developed feedback mechanisms; e.g., mutation of growth hormone receptor (Laron syndrome) results in increased amounts of circulating GH and decreased amounts of IGF (73
, 77
, 78)
. Our present study indicates that Rb expression correlates directly with dwarfism and increasing amounts of IGF-I, which alleviates the RB-mediated block of cell proliferation. Thus, it is likely that both Rb and IGF-I participate in the same feedback loop. Future studies are warranted to evaluate the particular mechanisms mediating IGF-I-Rb signaling.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Manfred Gossen and Hermann Bujard for the pUHD15-1, pUHD10-3, and pUHD13-3 plasmids and Drs. Sergei Yu. Revskoy, Daniel J. Riley, and Z. Dave Sharp for critical reading of the manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by Grants from NIH (EY05785 and CA58318 to W-H. L.). 
2 Present address: Department of Biomedical Sciences, Cornell University, Ithaca, New York 14853-6401. 
3 Present address: Tularik Inc., Two Corporate Drive, South San Francisco, California 94080. 
4 Present address: Cell Genesys, Inc., 342 Lakeside Drive, Foster City, California 94404. 
5 To whom requests for reprints should be addressed, at Department of Molecular Medicine, Institute of Biotechnology, The University of Texas Health Science Center, 15355 Lambda Drive, San Antonio, Texas 78245-3207. Phone: (210) 567-7351; Fax: (210) 567-7377; E-mail: leew{at}uthscsa.edu 
6 The abbreviations used are: Rb, retinoblastoma protein; Rb, mouse retinoblastoma gene; RB, human retinoblastoma protein; RB, human retinoblastoma gene; IGF, insulin-like growth factor; GD, gestational day; GH, growth hormone; P, postnatal day; cDMEM, DMEM complemented with 10% FCS; BrdUrd, bromodeoxyuridine; CMV, cytomegalovirus; RTg, RB transgene; IP-WB, immunoprecipitation-Western blotting; Mab, monoclonal antibody; RU, relative unit. 
7 A. Y. Nikitin, unpublished observations. 
Received 10/ 3/00.
Accepted 1/30/01.
 |
REFERENCES
|
|---|
-
Riley D. J., Lee E. Y., Lee W. H. The retinoblastoma protein: more than a tumor suppressor. Annu. Rev. Cell. Biol., 10: 1-29, 1994.
-
Chen P. L., Riley D. J., Lee W. H. The retinoblastoma protein as a fundamental mediator of growth and differentiation signals. Crit. Rev. Eukaryotic Gene Expr., 5: 79-95, 1995.[Medline]
-
Jacks T., Weinberg R. A. The expanding role of cell cycle regulators. Science (Washington DC), 280: 1035-1036, 1998.[Free Full Text]
-
Nikitin A. Y., Riley D. J., Lee W-H. A paradigm for cancer treatment using the retinoblastoma gene in a mouse model. Ann. NY Acad. Sci., 886: 12-22, 1999.[Abstract/Free Full Text]
-
Huang H. J., Yee J. K., Shew J. Y., Chen P. L., Bookstein R., Friedmann T., Lee E. Y-P., Lee W. H. Suppression of the neoplastic phenotype by replacement of the RB gene in human cancer cells. Science (Washington DC), 242: 1563-1566, 1988.[Abstract/Free Full Text]
-
Bookstein R., Shew J. Y., Chen P. L., Scully P., Lee W. H. Suppression of tumorigenicity of human prostate carcinoma cells by replacing a mutated RB gene. Science (Washington DC), 247: 712-715, 1990.[Abstract/Free Full Text]
-
Riley D. J., Nikitin A. Y., Lee W-H. Adenovirus-mediated retinoblastoma gene therapy suppresses spontaneous pituitary melantroph tumors in Rb+/- mice. Nat. Med., 2: 1316-1321, 1996.[Medline]
-
Nikitin A. Y., Juárez-Pérez M. I., Li S., Huang L., Lee W-H. RB-mediated suppression of multiple neuroendocrine neoplasia and lung metastases in Rb+/- mice. Proc. Natl. Acad. Sci. USA, 96: 3916-3921, 1999.[Abstract/Free Full Text]
-
Chen P. L., Scully P., Shew J. Y., Wang J. Y., Lee W. H. Phosphorylation of the retinoblastoma gene product is modulated during the cell cycle and cellular differentiation. Cell, 58: 1193-1198, 1989.[Medline]
-
Goodrich D. W., Wang N. P., Qian Y-W., Lee E. Y-H. P., Lee W-H. The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle. Cell, 67: 293-302, 1991.[Medline]
-
Gu W., Schneider J. W., Condorelli G., Kaushal S., Mahdavi V., Nadal-Ginardm B. Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation. Cell, 72: 309-324, 1993.[Medline]
-
Lee E. Y., Hu N., Yuan S. S., Cox L. A., Bradley A., Lee W. H., Herrup K. Dual roles of the retinoblastoma protein in cell cycle regulation and neuron differentiation. Genes Dev., 8: 2008-2021, 1994.[Abstract/Free Full Text]
-
Almasan A., Yin Y., Kelly R. E., Lee E. Y., Bradley A., Li W., Bertino J. R. Deficiency of retinoblastoma protein leads to inappropriate S-phase entry, activation of E2F-responsive genes, and apoptosis. Proc. Natl. Acad. Sci. USA, 92: 5436-5440, 1995.[Abstract/Free Full Text]
-
Haas-Kogan D. A., Kogan S. C., Levi D., Dazin P., TAng A., Fung Y. K., Israel M. A. Inhibition of apoptosis by the retinoblastoma gene product. EMBO J., 14: 461-472, 1995.[Medline]
-
Slack R. S., Skerjanc I. S., Lach B., Craig J., Jardine K., McBurney M. W. Cells differentiating into neuroectoderm undergo apoptosis in the absence of functional retinoblastoma family proteins. J. Cell Biol., 129: 779-788, 1995.[Abstract/Free Full Text]
-
Chen P. L., Riley D. J., Chen Y., Lee W. H. Retinoblastoma protein positively regulates terminal adipocyte differentiation through direct interaction with C/EBPs. Genes Dev., 10: 2794-2804, 1996.[Abstract/Free Full Text]
-
Herrera R. E., Sah V. P., Williams B. O., Makela T. P., Weinberg R. A., Jacks T. Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts. Mol. Cell. Biol., 16: 2402-2407, 1996.[Abstract]
-
Lee E. Y., Chang C. Y., Hu N., Wang Y. C., Lai C. C., Herrup K., Lee W. H., Bradley A. Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature (Lond.), 359: 288-294, 1992.[Medline]
-
Jacks T., Fazeli A., Schmitt E. M., Bronson R. T., Goodell M. A., Weinberg R. A. Effects of an Rb mutation in the mouse. Nature (Lond.), 359: 295-300, 1992.[Medline]
-
Clarke A. R., Maandag E. R., van Roon M., van der Lugt N. M., van der Valk M., Berns A., te Riele H. Requirement for a functional Rb-1 gene in murine development. Nature (Lond.), 359: 328-330, 1992.[Medline]
-
Hu N., Gulley M. L., Kung J. T., Lee E. Y-H. P. Retinoblastoma gene deficiency has mitogenic but not tumorigenic effects on erythropoiesis. Cancer Res., 57: 4123-4129, 1997.[Abstract/Free Full Text]
-
Macleod K. F., Hu Y., Jacks T. Loss of Rb activates both p53-dependent and independent cell death pathways in the developing mouse nervous system. EMBO J., 15: 6178-6188, 1996.[Medline]
-
Morgenbesser S. D., Williams B. O., Jacks T., DePinho R. A. p53-dependent apoptosis produced by Rb-deficiency in the developing mouse lens. Nature (Lond.), 371: 72-74, 1994.[Medline]
-
Zacksenhaus E., Jiang Z., Chung D., Marth J. D., Phillips R. A., Gallie B. L. pRb controls proliferation, differentiation, and death of skeletal muscle cells and other lineages during embryogenesis. Genes Dev., 10: 3051-3064, 1996.[Abstract/Free Full Text]
-
Williams B. O., Schmitt E. M., Remington L., Bronson R. T., Albert D. M., Weinberg R., Jacks T. Extensive contribution of Rb-deficient cells to adult chimeric mice with limited histopathological consequences. EMBO J., 13: 4251-4259, 1994.[Medline]
-
Robanus-Maandag E. C., van der Valk M., Vlaar M., Feltkamp C., OBrien J., van Roon M., van der Lugt N., Berns A., te Riele H. Developmental rescue of an embryonic-lethal mutation in the retinoblastoma gene in chimeric mice. EMBO J., 13: 4260-4268, 1994.[Medline]
-
Chang C. Y., Riley D. J., Lee E. Y., Lee W. H. Quantitative effects of the retinoblastoma gene on mouse development and tissue-specific tumorigenesis. Cell Growth Differ., 4: 1057-1064, 1993.[Abstract]
-
Bignon Y. J., Chen Y., Chang C. Y., Riley D. J., Windle J. J., Mellon P. L., Lee W. H. Expression of a retinoblastoma transgene results in dwarf mice. Genes Dev., 7: 1654-1662, 1993.[Abstract/Free Full Text]
-
Riley D. J., Liu C. Y., Lee W. H. Mutations of N-terminal regions render the retinoblastoma protein insufficient for functions in development and tumor suppression. Mol. Cell. Biol., 17: 7342-7352, 1997.[Abstract]
-
Hammer R. E., Brinster R. L., Rosenfeld M. G., Evans R. M., Mayo K. E. Expression of human growth hormone-releasing factor in transgenic mice results in increased somatic growth. Nature (Lond.), 315: 413-416, 1985.[Medline]
-
Gossen M., Bujard H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA, 89: 5547-5551, 1992.[Abstract/Free Full Text]
-
Gossen M., Freundlieb S., Bender G., Muller G., Hillen W., Bujard H. Transcriptional activation by tetracyclines in mammalian cells. Science (Washington DC), 268: 1766-1769, 1995.[Abstract/Free Full Text]
-
Furth P. A., St. Onge L., Böger H., Gruss P., Gossen M., Kistner A., Bujard H., Hennighausen L. Temporal control of gene expression in transgenic mice by a tetracycline-responsive promoter. Proc. Natl. Acad. Sci. USA, 91: 9302-9306, 1994.[Abstract/Free Full Text]
-
Ewald D., Li M., Efrat S., Auer G., Wall R. J., Furth P. A., Hennighausen L. Time-sensitive reversal of hyperplasia in transgenic mice expressing SV40 T antigen. Science (Washington DC), 273: 1384-1386, 1996.[Abstract]
-
Hennighausen L., Wall R. J., Tillmann U., Li M., Furth P. A. Conditional gene expression in secretory tissues and skin of transgenic mice using the MMTV-LTR and the tetracycline responsive system. J. Cell. Biochem., 59: 463-472, 1995.[Medline]
-
Kistner A., Gossen M., Zimmermann F., Jerecic J., Ullmer C., Lubbert H., Bujard H. Doxycycline-mediated quantitative and tissue-specific control of gene expression in transgenic mice. Proc. Natl. Acad. Sci. USA, 93: 10933-10938, 1996.[Abstract/Free Full Text]
-
Shockett P., Difilippantonio M., Hellman N., Schatz D. G. A modified tetracycline-regulated system provides autoregulatory, inducible gene expression in cultured cells and transgenic mice. Proc. Natl. Acad. Sci. USA, 92: 6522-6526, 1995.[Abstract/Free Full Text]
-
Pfarr D. S., Reiser L. A., Woychik R. P., Rottman F. M., Rosenberg M., Reff M. E. Differential effects of polyadenylation regions on gene expression in mammalian cells. DNA (NY), 5: 115-122, 1986.[Medline]
-
Hong F. D., Huang H. J., To H., Young L. J., Oro A., Bookstein R., Lee E. Y., Lee W. H. Structure of the human retinoblastoma gene. Proc. Natl. Acad. Sci. USA, 86: 5502-5506, 1989.[Abstract/Free Full Text]
-
Baker S. J., Markowitz S., Fearon E. R., Willson J. K., Vogelstein B. Suppression of human colorectal carcinoma cell growth by wild-type p53. Science (Washington DC), 249: 912-915, 1990.[Abstract/Free Full Text]
-
Wang N. P., Qian Y. W., Chung A. E., Lee W. H., Lee E. Y. Expression of the human retinoblastoma gene product pp110RB in insect cells using the baculovirus system. Cell Growth Differ., 1: 429-437, 1990.[Abstract]
-
Hogan B., Costantini F., Lacy E. . Manipulating the Mouse Embryo. A Laboratory Manual, 332 Cold Spring Harbor Laboratory Cold Spring Harbor, NY 1986.
-
Nikitin A. Y., Lee W. H. Early loss of the retinoblastoma gene is associated with impaired growth inhibitory innervation during melanotroph carcinogenesis in Rb+/- mice. Genes Dev., 10: 1870-1879, 1996.[Abstract/Free Full Text]
-
Nikitin A. Y., Riley D. J., Lee W. H. Earlier onset of melanotroph carcinogenesis in mice with inherited mutant paternal allele of the retinoblastoma gene. Cancer Res., 57: 4274-4278, 1997.[Abstract/Free Full Text]
-
Shan B., Zhu X., Chen P-L., Durfee T., Yang Y., Sharp D., Lee W-H. Molecular cloning of cellular genes encoding retinoblastoma-associated proteins: identification of a gene with properties of the transcription factor E2F. Mol. Cell. Biol., 12: 5620-5631, 1992.[Abstract/Free Full Text]
-
DeCaprio J. A., Ludlow J. W., Figge J., Shew J. Y., Huang C. M., Lee W. H., Marsilio E., Paucha E., Livingston D. M. SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell, 54: 275-283, 1988.[Medline]
-
Shockett P. E., Schatz D. G. Diverse strategies for tetracycline-regulated inducible gene expression. Proc. Natl. Acad. Sci. USA, 93: 5173-5176, 1996.[Abstract/Free Full Text]
-
Cordon-Cardo C., Richon V. M. Expression of the retinoblastoma protein is regulated in normal human tissues. Am. J. Pathol., 144: 500-510, 1994.[Abstract]
-
Goedbloed J. F. The embryonic and postnatal growth of rat and mouse. Acta Anat., 82: 305-336, 1972.[Medline]
-
Szekely L., Jiang W. Q., Bulic-Jakus F., Rosen A., Ringertz N., Klein G., Wiman K. G. Cell type and differentiation dependent heterogeneity in retinoblastoma protein expression in SCID mouse fetuses. Cell Growth Differ., 3: 149-156, 1992.[Abstract]
-
Robanus-Maandag E., Dekker M., van der Valk M., Carrozza M. L., Jeanny J. C., Dannenberg J. H., Berns A., te Riele H. p107 is a suppressor of retinoblastoma development in pRb-deficient mice. Genes Dev., 12: 1599-1609, 1998.[Abstract/Free Full Text]
-
Schneider J. W., Gu W., Zhu L., Mahdavi V., Nadal-Ginard B. Reversal of terminal differentiation mediated by p107 in Rb-/- muscle cells. Science (Washington DC), 264: 1467-1471, 1994.[Abstract/Free Full Text]
-
Sherr C. J. Cancer cell cycles. Science (Washington DC), 274: 1672-1677, 1996.[Abstract/Free Full Text]
-
Sicinski P., Donaher J. L., Parker S. B., Li T., Fazeli A., Gardner H., Haslam S. Z., Bronson R. T., Elledge S. J., Weinberg R. A. Cyclin D1 provides a link between development and oncogenesis in the retina and breast. Cell, 82: 621-630, 1995.[Medline]
-
Fantl V., Stamp G., Andrews A., Rosewell I., Dickson C. Mice lacking cyclin D1 are small and show defects in eye and mammary gland development. Genes Dev., 9: 2364-2372, 1995.[Abstract/Free Full Text]
-
Nakayama K., Ishida N., Shirane M., Inomata A., Inoue T., Shishido N., Horii I., Loh D. Y., Nakayama K. Mice lacking p27(Kip1) display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell, 85: 707-720, 1996.[Medline]
-
Kiyokawa H., Kineman R. D., Manova-Todorova K. O., Soares V. C., Hoffman E. S., Ono M., Khanam D., Hayday A. C., Frohman L. A., Koff A. Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function of p27(Kip1). Cell, 85: 721-732, 1996.[Medline]
-
Fero M. L., Rivkin M., Tasch M., Porter P., Carow C. E., Firpo E., Polyak K., Tsai L. H., Broudy V., Perlmutter R. M., Kaushansky K., Roberts J. M. A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell, 85: 733-744, 1996.[Medline]
-
Deng C., Zhang P., Harper J. W., Elledge S. J., Leder P. Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control. Cell, 82: 675-684, 1995.[Medline]
-
Serrano M., Lee H., Chin L., Cordon-Cardo C., Beach D., DePinho R. A. Role of the INK4a locus in tumor suppression and cell mortality. Cell, 85: 27-37, 1996.[Medline]
-
Yan Y., Frisen J., Lee M. H., Massague J., Barbacid M. Ablation of the CDK inhibitor p57Kip2 results in increased apoptosis and delayed differentiation during mouse development. Genes Dev., 11: 973-983, 1997.[Abstract/Free Full Text]
-
Cobrinik D., Lee M. H., Hannon G., Mulligan G., Bronson R. T., Dyson N., Harlow E., Beach D., Weinberg R. A., Jacks T. Shared role of the pRB-related p130 and p107 proteins in limb development. Genes Dev., 10: 1633-1644, 1996.[Abstract/Free Full Text]
-
Raff M. C. Size control: the regulation of cell numbers in animal development. Cell, 86: 173-175, 1996.[Medline]
-
Baker J., Liu J. P., Robertson E. J., Efstratiadis A. Role of insulin-like growth factors in embryonic and postnatal growth. Cell, 75: 73-82, 1993.[Medline]
-
Humbel R. E. Insulin-like growth factors I and II. Eur. J. Biochem., 190: 445-462, 1990.[Medline]
-
DeChiara T. M., Efstratiadis A., Robertson E. J. A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature (Lond.), 345: 78-80, 1990.[Medline]
-
Powell-Braxton L., Hollingshead P., Warburton C., Dowd M., Pitts-Meek S., Dalton D., Gillett N., Stewart T. A. IGF-I is required for normal embryonic growth in mice. Genes Dev., 7: 2609-2617, 1993.[Abstract/Free Full Text]
-
Behringer R. R., Mathews L. S., Palmiter R. D., Brinster R. L. Dwarf mice produced by genetic ablation of growth hormone-expressing cells. Genes Dev., 2: 453-461, 1988.[Abstract/Free Full Text]
-
Palmiter R. D., Brinster R. L., Hammer R. E., Trumbauer M. E., Rosenfeld M. G., Birnberg N. C., Evans R. M. Dramatic growth of mice that develop from eggs microinjected with metallothionein-growth hormone fusion genes. Nature (Lond.), 300: 611-615, 1982.[Medline]
-
Mathews L. S., Hammer R. E., Behringer R. R., DErcole A. J., Bell G. I., Brinster R. L., Palmiter R. D. Growth enhancement of transgenic mice expressing human insulin-like growth factor I. Endocrinology, 123: 2827-2833, 1988.[Abstract]
-
Palmiter R. D., Norstedt G., Gelinas R. E., Hammer R. E., Brinster R. L. Metallothionein-human GH fusion genes stimulate growth of mice. Science (Washington DC), 222: 809-814, 1983.[Abstract/Free Full Text]
-
Liu J. P., Baker J., Perkins A. S., Robertson E. J., Efstratiadis A. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell, 75: 59-72, 1993.[Medline]
-
Zhou Y., Xu B. C., Maheshwari H. G., He L., Reed M., Lozykowski M., Okada S., Cataldo L., Coschigamo K., Wagner T. E., Baumann G., Kopchick J. J. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc. Natl. Acad. Sci. USA, 94: 13215-13220, 1997.[Abstract/Free Full Text]
-
Voss J. W., Rosenfeld M. G. Anterior pituitary: short tales from dwarf mice. Cell, 70: 527-530, 1992.[Medline]
-
Sinha Y. N., Selby F. W., Lewis U. J., VanderLaan W. P. Studies of GH secretion in mice by a homologous radioimmunoassay for mouse GH. Endocrinology, 91: 784-792, 1972.[Medline]
-
Joshi R. L., Lamothe B., Cordonnier N., Mesbah K., Monthioux E., Jami J., Bucchini D. Targeted disruption of the insulin receptor gene in the mouse results in neonatal lethality. EMBO J., 15: 1542-1547, 1996.[Medline]
-
Amselem S., Sobrier M. L., Dastot F., Duquesnoy P., Duriez B., Goossens M. Molecular basis of inherited growth hormone resistance in childhood. Baillieres Clin. Endocrinol. Metab., 10: 353-369, 1996.[Medline]
-
Laron Z., Anin S., Klipper-Aurbach Y., Klinger B. Effects of insulin-like growth factor on linear growth, head circumference, and body fat in patients with Laron-type dwarfism. Lancet, 339: 1258-1261, 1992.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
N. Dali-Youcef, C. Mataki, A. Coste, N. Messaddeq, S. Giroud, S. Blanc, C. Koehl, M.-F. Champy, P. Chambon, L. Fajas, et al.
Adipose tissue-specific inactivation of the retinoblastoma protein protects against diabesity because of increased energy expenditure
PNAS,
June 19, 2007;
104(25):
10703 - 10708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Zhou, A. Flesken-Nikitin, C. G. Levine, E. N. Shmidt, J. P. Eng, E. Yu. Nikitina, D. M. Spencer, and A. Yu. Nikitin
Suppression of Melanotroph Carcinogenesis Leads to Accelerated Progression of Pituitary Anterior Lobe Tumors and Medullary Thyroid Carcinomas in Rb+/- Mice
Cancer Res.,
February 1, 2005;
65(3):
787 - 796.
[Abstract]
[Full Text]
[PDF]
|
 |
|