Cancer Research TCM Europe  2010 Workshops
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cadoret, A.
Right arrow Articles by Perret, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cadoret, A.
Right arrow Articles by Perret, C.
[Cancer Research 61, 3245-3249, April 15, 2001]
© 2001 American Association for Cancer Research


Advances in Brief

Hepatomegaly in Transgenic Mice Expressing an Oncogenic Form of ß-Catenin1

Axelle Cadoret, Christine Ovejero, Sihem Saadi-Kheddouci, Evelyne Souil, Monique Fabre, Béatrice Romagnolo, Axel Kahn and Christine Perret2

Institut Cochin de Génétique Moléculaire INSERM U129, 75014 Paris [A. C., C. O., S. S-K., E. S., B. R., A. K., C. P.], and Laboratoire d’Anatomopathologie du Professeur Bedossa, Hôpital Bicêtre, 94275 Le Kremlin-Bicêtre [M. F.], France


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Inappropriate activation of the Wnt/ß-catenin signaling, resulting mainly from activating mutations of the ß-catenin gene, has been implicated recently in the development of hepatocellular carcinoma (HCC). We have generated transgenic mice expressing an oncogenic form of ß-catenin in their hepatocytes to analyze the effect of deregulated ß-catenin signaling on liver homeostasis. These mice rapidly developed hepatomegaly soon after birth, with livers three to four times heavier than those of nontransgenic littermates. The liver cell hyperplasia resulted from increased cell proliferation without any compensatory apoptosis. Although the genes encoding c-myc and cyclin D1 are potential targets of the ß-catenin signaling pathway, neither of them was overexpressed in the hyperplastic livers of ß-catenin transgenic mice. Thus, the key target genes of the ß-catenin signaling pathway in the liver remain to be identified.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The Wnt/ß-catenin signaling pathway is deregulated in colon cancer. This deregulation has been then implicated in several other cancers (reviewed in Ref. 1 ). Genetic and embryological studies have shown that ß-catenin is an important effector of the Wnt/Wingless signaling pathway (reviewed in Ref. 2 ). In the absence of Wnt signaling, ß-catenin is phosphorylated at critical NH2-terminal residues by the GSK3 -3ß in a large multiprotein complex that include the product of the tumor suppressor adenomatous polyposis coli gene and a member of the Axin family. The phosphorylated ß-catenin is subsequently degraded by the ubiquitin-proteasome system. GSK-3ß is inactivated by Wnt stimulation, which therefore stabilizes ß-catenin. ß-Catenin is subsequently translocated into the nucleus, where it modulates the activity of target genes, in association with members of the Lef/Tcf family of transcription factors. Colon cancers result mainly from inactivating mutations of the adenomatous polyposis coli gene. However, ~10% of colon cancers are associated with activating mutations of the ß-catenin gene that affect amino acids essential for the targeted degradation of ß-catenin (3) .

Liver malignancies have also been shown recently to harbor frequent mutations in the Wnt/ß-catenin pathway. However, in contrast with colon cancer, most of these mutations involve the ß-catenin gene itself. We and others have reported genetic alterations in the ß-catenin gene in 18–34% of human HCCs (4, 5, 6, 7) , and ß-catenin mutations are frequent (up to 67%) in hepatoblastoma (8 , 9) . Finally, mutations in the axin gene have been described recently in a few HCCs; but these mutations in the axin gene were identified only in HCCs that lacked mutations in the ß-catenin gene (10) . Such evidence of the role played by deregulation of the Wnt/ß-catenin pathway in hepatocarcinogenesis has shed new insight into the mechanisms of this type of cancer. The recent finding that the c-myc and the cyclin D1 genes are targets of the ß-catenin signaling offers a putative link between deregulation of Wnt/ß-catenin signaling and development of liver cancer (11 , 12) . Elevated production of c-myc, and less frequently cyclin D1, is frequent in primary HCC (13) . However, the relevance of these target genes to liver tumor development is presently unknown.

We have therefore generated transgenic mice expressing an oncogenic form of ß-catenin in the liver and used them to determine whether activated ß-catenin alone stimulates the proliferation of parenchymal liver cells. These animals developed severe hepatomegaly immediately after birth because of increased cell proliferation, whereas apoptosis was not activated. Surprisingly, the c-myc and cyclin D1 genes were not overexpressed, suggesting that they do not play key roles in ß-catenin-dependent hepatocyte growth.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Generation of Transgenic Mice.
The EAB/9K/{Delta}N131ß-catenin mice were produced as described earlier using (C57/B6 x DBA)F1 mice (14) . Transgene screening was performed by Southern blot analysis of the tail DNA after digestion with appropriate restriction nucleases. Transgenic mice were maintained in accordance with the Ministère de l’Agriculture et de la Forêt guidelines for the care and use of laboratory animals.

Histological Analysis and Cell Proliferation Analysis.
Mice were killed by cervical dislocation. Their livers were removed and fixed in 4% (v/v) formaldehyde, embedded in paraffin, stained with H&E, and examined for histopathological abnormalities. Paraffin-embedded sections were analyzed by immunohistochemistry using the polyclonal anti-Ki-67 antibody (dilution, 1:500; Novocastra, New Castle, United Kingdom) to estimate the degree of cell proliferation. The proliferative index was estimated by the percentage of Ki-67-positive hepatocytes in a total of 1500 hepatocytes.

Northern Blotting.
Total RNA was extracted from frozen liver by the guanidinium thiocyanate single-step procedure, and an aliquot (10 µg) was electrophoresed through 1.3% agarose-6% formaldehyde gel. The resulting bands were transferred to nitrocellulose and hybridized with corresponding 32P-labeled probes.

Real-Time RT-PCR.
The theoretical basis of real-time RT-PCR has been described elsewhere (15) . Quantitative values are obtained from the threshold cycle number (Ct) at which the increase in the signal associated with exponential growth of PCR products begins to be detected using PE Biosystems analysis software, according to the manufacturer’s manuals.

We used the RPLP0 gene (also known as 36B4) encoding human acidic ribosomal phosphoprotein P0 as the endogenous RNA control (16) , and each sample was normalized on the basis of its RPLP0 content. The relative target gene expression was also normalized to a calibrator consisting of one of our tissue samples that contained the smallest amount of target gene mRNA. Results, expressed as the amount of target sample relative to the RPLP0 gene and the calibrator, were determined as follows, , where the {Delta}Ct values of the sample and calibrator were determined by subtracting the average Ct value of the sample and the calibrator from the average Ct value of the RPLP0 gene.

Primers for the RPLP0 and target genes were chosen with the assistance of the computer programs Oligo 4.0 (National Biosciences, Plymouth, MN) and Primer Express (Perkin-Elmer Applied Biosystems, Foster City, CA). Each primer was placed in a different exon to avoid amplifying contaminating genomic DNA. The sequences were as follows: RPLP0 gene, RPLP01 (GGCGACCTGGAAGTCCAACT) and RPLP02 (CATCAGCACCACGGCCTTC); endogenous mouse ß-catenin gene, BCAT1 (CAACCCTGAGGAAGAAGA) and BCAT2 (TGCCCGCAATATCAGCTA); {Delta}N131ß-catenin transgene, EAB1 (CTGACAGCAAGCAGCACAGA) and EAB2 (CCTGGTCCTCGTCATTTAGCA); mouse c-myc gene, CMYC1 (CACCAGCAGCGACTCTGAA) and CMYC2 (GCCCGACCTCTTG); mouse cyclin D1 gene, CCD1 (CATCAAGTGTGACCCGGACTG) and CCD2 (CCTCCTCCTCAGTGGCCTTG); mouse matrilysin gene, MMP1 (GTGAGGACGCAGGAGTGAC) and MMP2 (ACAGGTGCAAGCTCAAGGAAGG).

cDNA was synthesized as described previously (17) , and PCR reactions were performed using a ABI Prism 7700 Sequence Detection System and the SYBR Green PCR Core Reagents kit (Perkin-Elmer Applied Biosystems). The thermal cycling conditions were an initial denaturation step at 95°C for 10 min and 50 cycles at 95°C for 15 s and 65°C for 1 min. Experiments were performed with duplicates for each data point.

Western Blotting.
Tissues were homogenized with a Polytron in Laemmli buffer (1:10 w/v). Samples of extract containing ~100 µg of total protein were separated by 10% SDS-PAGE and transferred to a nitrocellulose membrane. Blots were standardized by staining with Ponceau Red. Cyclin D1 and c-myc proteins were detected using mouse monoclonal anti-cyclin D1 (DCS6, 1:300; Dako, Copenhagen, Denmark) or mouse monoclonal anti-c-myc (9E10, 1:500; Santa Cruz Biotechnology, Santa Cruz, CA) antibodies. The signals were visualized with the ECL detection system.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Expression of the Mutant {Delta}N131ß-Catenin in the Livers of Transgenic Mice.
The mutant ß-catenin had a truncated NH2 terminus ({Delta}N131ß-catenin) that has lost both the GSK-3ß phosphorylation site involved in stabilizing the protein and the binding site for {alpha}-catenin needed for the adhesive properties of ß-catenin (Fig. 1A)Citation . Production of the oncogenic form of ß-catenin was targeted to the liver by a chimeric construct (EAB/9K) composed of the calbindin-D9K (CaBP9K) promoter and its regulatory sequences that specifically activate transgene expression in the intestine and kidney (17) , linked to the strong liver-specific enhancer of the aldolase B gene (EAB; Ref. 18 ). This resulted in transgene expression in the intestine, kidney, and liver. We have shown that transgenic founders carrying the EAB/9K/{Delta}N131ß-catenin construct and actively expressing the transgene in the intestine, kidney, and liver displayed a marked morbidity. We therefore analyzed all of the founders between the third and fourth weeks of age. Intestinal lesions have been described (14) , and kidney lesions will be reported elsewhere.4



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Expression of the {Delta}N131ß-catenin gene in transgenic mice. A, map of the EAB/9K/{Delta}N131ß-catenin construct. The ß-catenin functional domains are shown, together with the structure of the NH2-terminally truncated mutant ({Delta}N131). EAB, the enhancer of the aldolase B gene cloned in front of the CaBP9K promoter sequence (9K). The positions of the oligonucleotides BCAT1, BCAT2 and EAB1, EAB2 used to measure the mRNA encoding the oncogenic mutant form of ß-catenin form relative to the endogenous ß-catenin gene by real-time RT-PCR assay are shown. B, Northern blot analysis of transgene expression. The concentration of {Delta}N131ß-catenin mRNA ({Delta}N131) was compared with that of the endogenous ß-catenin (wt) in the liver. C, weights of the livers of control and {Delta}N131ß-catenin transgenic mice. Values are means of the weight of the liver determined for five control mice (Cont) and the five highly expressing transgenic mice ({Delta}N131; see Table 1Citation ); bars, SE. Total body weights of all mice analyzed were comparable.

 
This report describes the impact of the mutant {Delta}N131ß-catenin in the liver and analyzes the liver phenotype of nine founders that expressed the transgene in this tissue. The expression varied greatly from one founder to another. The {Delta}N131ß-catenin transgene was actively expressed in the liver of five founders at a level 2.5–10-fold higher than the endogenous ß-catenin. In contrast, transgene expression was low in the other four founders (Fig. 1BCitation and Table 1Citation ). The observed liver phenotype was restricted to the five animals accumulating the truncated ß-catenin mRNA at a high level (Table 1)Citation . Their livers were 3–4-fold heavier than those of nontransgenic control littermates (Fig. 1C)Citation . No hepatomegaly was observed in the founders that expressed the transgene at a level similar to or lower than that of the endogenous ß-catenin gene (Table 1)Citation . Consequently, liver cell hyperplasia was clearly correlated with the accumulation of the mRNA for activated ß-catenin.


View this table:
[in this window]
[in a new window]

 
Table 1 Liver phenotype of {Delta}N131ß-catenin transgenic mice

 
Morphological Alterations and Increased Cell Proliferation in the Livers of {Delta}N131ß-Catenin Transgenic Mice.
Histological analysis of liver specimens from highly expressing transgenic mice revealed no major abnormality in lobular architecture. However, the hepatic lobules were larger than those of nontransgenic littermates (Fig. 2A and B)Citation . Foci of hepatocellular hyperplasia containing many small hepatocytes with a high nuclear:cytoplasmic ratio were involved in the enlargement of the lobules (Fig. 2, B and D)Citation . Liver cell hyperplasia was associated with a marked increase in hepatocytes bearing mitotic figures (Fig. 2D)Citation . In contrast, the apoptotic index in the liver was not different from that of wild-type mice (data not shown). There was considerable proliferation of the portal cholangiocytes in the hyperplastic livers of hepatomegalic transgenic mice (Fig. 2E)Citation .



View larger version (157K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Histological analysis and Ki-67 immunostaining of liver sections of control and {Delta}N131ß-catenin transgenic mice. A and B, H&E-stained sections of the liver of a nontransgenic mouse (A) and a representative {Delta}N131ß-catenin mouse with hepatomegaly (B). Note the enlarged hepatic lobules in the transgenic mice revealed by fewer vascular spaces (portal space and central vein). Large arrow shows an area of cell hyperplasia (x200). C and D, high magnification (x640) showing the high density of nondysplastic small hepatocytes with a high nuclear/cytoplasmic ratio. Arrows point to mitotic figures. E, periportal zone showing intense proliferation of duct cells (x320). F and G, immunohistochemical detection of Ki-67 positive cells in the liver of nontransgenic mouse (F) and a representative {Delta}N131ß-catenin mouse (G). (x250). PS, portal space; CV, central vein.

 
Cell proliferation was analyzed by immunohistochemistry using the nuclear proliferation marker Ki-67. Hepatocyte nuclear labeling was more intense in {Delta}N131ß-catenin mice than in their nontransgenic littermates (Fig. 2, F and G)Citation . The cholangiocytes were also strongly immunoreactive for Ki67, confirming the high proliferation rate of all of the liver epithelial cells. The counts of Ki-67-positive hepatocytes (Fig. 3A)Citation showed that hepatocyte proliferation was increased ~4-fold in {Delta}N131ß-catenin mice with hyperplastic livers (mean values, 23.6 ± 2.3% versus 5.4 ± 1%). Thus, the synthesis of large amounts of an oncogenic form of ß-catenin in the liver led to increased cell proliferation not counterbalanced by compensatory apoptosis, and hence to liver hyperplasia.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Proliferative index and expression of cyclin D1 and c-myc genes in {Delta}N131ß-catenin transgenic mice. A, quantitative analysis of cell proliferation. The proliferative index indicates the number of Ki-67-positive hepatocytes counted in a total of 1500 hepatocytes. Each index was calculated from three control mice (Cont) and four highly expressing {Delta}N131ß-catenin founders ({Delta}N131). The values are means; bars, SE. B, real-time quantitative RT-PCR analysis. Cyclin D1 and c-myc mRNAs were determined in control ({blacksquare}) and transgenic mice without () or with phenotype ({square}), as explained in "Materials and Methods." C, Western blot analysis. Total extracts prepared from control (Cont) and hepatomegalic transgenic mice ({Delta}N131) were analyzed by SDS-PAGE and immunoblotted with antibodies specific for cyclin D1 and c-myc.

 
Effect of {Delta}N131ß-Catenin Gene Expression in the Liver on Cyclin D1 and c-myc Gene Expression.
We analyzed the expression of cyclin D1 and c-myc genes, which are overexpressed in a number of human HCCs and described as target genes of the Wnt/ß-catenin pathway (11 , 12) , to identify the mechanism responsible for this abnormal hepatic proliferation. We used a real-time RT-PCR assay (Fig. 3B)Citation and Western blotting (Fig. 3C)Citation to show that the activities of neither cyclin D1 nor c-myc genes were significantly increased in {Delta}N131ß-catenin mice with hepatomegaly. These results indicate that cyclin D1 and c-myc genes may not be specific key targets of ß-catenin pathway in the livers of these mice. We also analyzed the expression of the matrilysin gene, a target gene of ß-catenin signaling in the intestine (19) that has been reported to be overexpressed in human HCC (20) . However, the level of expression of the matrilysin gene, analyzed by real-time RT-PCR assay, was undetectable, both in liver of hepatomegalic mice and control nontransgenic mice (data not shown). This result suggests that the expression of the matrilysin gene is not controlled by ß-catenin signaling in the liver.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We have demonstrated that an elevated production of an oncogenic form of ß-catenin in the liver leads to the development of massive hepatomegaly, with liver cell hyperplasia, in young 3–4-week-old transgenic mice. This type of massive hepatomegaly resulting from cell hyperplasia has not been reported previously. In other transgenic mice with liver hyperplasia, such as young transgenic mice overproducing the growth factor transforming growth factor-{alpha}, growth hormone, or adult transgenic mice bearing a null mutation in the FAS gene (21 , 22) , the increase in liver weights was moderate, not exceeding 60% of control mice. Thus, our results strongly suggest that the Wnt/ß-catenin pathway plays a key role in the control of liver growth, its constitutive activation resulting in sustained hepatocellular proliferation that is not compensated by cell death. However, we saw no signs of liver transformation, such as hepatocyte dysplasia or nodule formation. Thus, activation of ß-catenin signaling alone in the hepatocytes is not sufficient for hepatocellular transformation and requires other genetic events, in contrast to intestinal neoplasia, where constitutive activation of the Wnt/ß-catenin pathway alone leads to the development of intestinal adenoma (23) . However, the increase in cell proliferation in the {Delta}N131ß-catenin transgenic mice is likely to be preneoplastic, fostering secondary genetic events which, together with dysregulation of the ß-catenin signaling pathway, may lead to hepatocyte transformation. This is supported by our finding that HCC developed in transgenic mice overexpressing the oncogenes c-myc or H-ras, have frequent activating mutations of the ß-catenin gene (4) . The premature death of the {Delta}N131ß-catenin transgenic mice probably prevented the development of liver tumors in which supplementary genetic events could cooperate with ß-catenin activation to promote malignant transformation.

The absence of increased apoptosis in hyperplastic livers expressing oncogenic ß-catenin differs from the situation observed in the intestine (14) , the skin (24) , and the kidney.4 In these later tissues, the presence of activated ß-catenin is associated with increases in both mitotic and apoptotic indexes. The response of the liver to oncogenic ß-catenin is also different from that of the liver of c-myc transgenic mice. Overexpression of the oncogene c-myc in the liver leads first to cell proliferation, with a high apoptotic index that prevents enlargement of the liver in young animals. Hepatomegaly appears later, linked to the development of malignant nodules (25) .

A recent report found a significant relationship between the number of neoplastic hepatocytes bearing nuclear ß-catenin and the number of proliferative (Ki-67-positive) cells in human HCC, indicating that activation of ß-catenin signaling may promote tumor progression by stimulating cell proliferation (6) . The recent identification of c-myc and cyclin D1 as target genes of ß-catenin signaling has provided a link that might explain the proliferation caused by ß-catenin (11 , 12) . However, the liver hyperplasia that occurs in {Delta}N131ß-catenin mice is independent of the expression of cyclin D1 and c-myc genes. This suggests that neither c-myc nor cyclin D1 are critical target genes for controlling cell proliferation triggered by the ß-catenin signaling in the liver. We have shown previously that activation of ß-catenin signaling is required in cooperation with c-myc for the development of liver tumors in the PK/c-myc mouse (4) . This result also raises doubts about the involvement of deregulation of the ß-catenin signaling in the increase in c-myc gene expression observed frequently in human HCC (26) . In addition, enhanced c-myc gene expression is found in both tumor tissue and adjacent nontumoral liver and cirrhotic nodules (13) , where there is neither mutation nor intracellular accumulation of ß-catenin (27) . The involvement of cyclin D1 in hepatocarcinogenesis is more controversial, both up-regulation and down-regulation have been described in human HCC (28 , 29) . However, our results strongly suggest that other target genes are probably involved in the proliferative stimulus triggered by deregulation of ß-catenin signaling in the liver.

In conclusion, the present study demonstrates, in vivo, that constitutive activation of the Wntß/catenin pathway plays a major part in liver homeostasis by stimulating massive hepatocyte proliferation that is not offset by apoptosis. This emphasizes the crucial role of deregulated ß-catenin signaling in the malignant transformation of liver cells.


    ACKNOWLEDGMENTS
 
We thank Dr. Michel Vidaud for real-time quantitative PCR analysis. We thank Arlette Dell’Amico, Isabelle Lagoutte, and Hervé Gendrot for skillful care of the mice and Owen Parkes for editing the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the INSERM, La Ligue Nationale Contre le Cancer and l’Association pour la Recherche Contre le Cancer. Back

2 To whom requests for reprints should be addressed, at INSERM U129, 24 rue du Faubourg St. Jacques, 75014 Paris, France. Phone: 33-1-44-41-24-12; Fax: 33-1-44-41-24-21; E-mail: perret{at}icgm.cochin.inserm.fr Back

3 The abbreviations used are: GSK, glycogen synthase kinase; HCC, hepatocellular carcinoma; RT-PCR, reverse transcription-PCR. Back

4 S. Saadi-Kheddouci, D. Berrebi, B. Romagnolo, F. Cluzeaud, N. Peuchmaur, A. Kahn, and C. Perret. Early development of polycystic kidney disease in transgenic mice expressing an activated mutant of the ß-catenin gene, submitted for publication. Back

Received 12/18/00. Accepted 3/ 1/01.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Polakis P. Wnt signaling and cancer. Genes Dev., 14: 1837-1851, 2000.[Free Full Text]
  2. Cadigan K. M., Nusse R. Wnt signaling: a common theme in animal development. Genes Dev., 11: 3286-3305, 1997.[Free Full Text]
  3. Morin P. J., Sparks A. B., Korinek V., Barker N., Clevers H., Vogelstein B., Kinzler K. W. Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science (Wash. DC), 275: 1787-1790, 1997.[Abstract/Free Full Text]
  4. de La Coste A., Romagnolo B., Billuart P., Renard C. A., Buendia M. A., Soubrane O., Fabre M., Chelly J., Beldjord C., Kahn A., Perret C. Somatic mutations of the ß-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc. Natl. Acad. Sci. USA, 95: 8847-8851, 1998.[Abstract/Free Full Text]
  5. Miyoshi Y., Iwao K., Nagasawa Y., Aihara T., Sasaki Y., Imaoka S., Murata M., Shimano T., Nakamura Y. Activation of the ß-catenin gene in primary hepatocellular. Cancer Res., 58: 2524-2527, 1998.[Abstract/Free Full Text]
  6. Nhieu J. T., Renard C. A., Wei Y., Cherqui D., Zafrani E. S., Buendia M. A. Nuclear accumulation of mutated ß-catenin in hepatocellular carcinoma is associated with increased cell proliferation. Am. J. Pathol., 155: 703-710, 1999.[Abstract/Free Full Text]
  7. Terris B., Pineau P., Bregeaud L., Valla D., Belghiti J., Tiollais P., Degott C., Dejean A. Close correlation between ß-catenin gene alterations and nuclear. Oncogene, 18: 6583-6588, 1999.[Medline]
  8. Koch A., Denkhaus D., Albrecht S., Leuschner I., von Schweinitz D., Pietsch T. Childhood hepatoblastomas frequently carry a mutated degradation. Cancer Res., 59: 269-273, 1999.[Abstract/Free Full Text]
  9. Wei Y., Fabre M., Branchereau S., Gauthier F., Perilongo G., Buendia M. A. Activation of ß-catenin in epithelial and mesenchymal hepatoblastomas. Oncogene, 19: 498-504, 2000.[Medline]
  10. Satoh S., Daigo Y., Furukawa Y., Kato T., Miwa N., Nishiwaki T., Kawasoe T., Ishiguro H., Fujita M., Tokino T., Sasaki Y., Imaoka S., Murata M., Shimano T., Yamaoka Y., Nakamura Y. AXIN1 mutations in hepatocellular carcinomas and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat. Genet., 24: 245-250, 2000.[Medline]
  11. He T. C., Sparks A. B., Rago C., Hermeking H., Zawel L., da Costa L. T., Morin P. J., Vogelstein B., Kinzler K. W. Identification of c-MYC as a target of the APC pathway. Science (Wash. DC), 281: 1509-1512, 1998.[Abstract/Free Full Text]
  12. Tetsu O., McCormick F. ß-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature (Lond.), 398: 422-426, 1999.[Medline]
  13. Zhang X. K., Huang D. P., Qiu D. K., Chiu J. F. The expression of c-myc and c-N-ras in human cirrhotic livers, hepatocellular carcinomas, and liver tissue surrounding the tumors. Oncogene, 5: 909-914, 1990.[Medline]
  14. Romagnolo B., Berrebi D., Saadi-Keddoucci S., Porteu A., Pichard A. L., Peuchmaur M., Vandewalle A., Kahn A., Perret C. Intestinal dysplasia and adenoma in transgenic mice after. Cancer Res., 59: 3875-3879, 1999.[Abstract/Free Full Text]
  15. Bieche I., Laurendeau I., Tozlu S., Olivi M., Vidaud D., Lidereau R., Vidaud M. Quantitation of MYC gene expression in sporadic breast tumors with a real-time reverse transcription-PCR assay. Cancer Res., 59: 2759-2765, 1999.[Abstract/Free Full Text]
  16. Laborda J. 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Res., 19: 3998 1991.[Free Full Text]
  17. Romagnolo B., Cluzeaud F., Lambert M., Colnot S., Porteu A., Molina T., Tomasset M., Vandewalle A., Kahn A., Perret C. Tissue-specific and hormonal regulation of calbindin-D9K fusion genes in transgenic mice. J. Biol. Chem., 271: 16820-16826, 1996.[Abstract/Free Full Text]
  18. Gregori C., Porteu A., Lopez S., Kahn A., Pichard A. Characterization of the aldolase B intronic enhancer. J. Biol. Chem., 273: 25237-25243, 1998.[Abstract/Free Full Text]
  19. Crawford H. C., Fingleton M., Rudolph-Owen L. A., Goss K. J., Rubinfeld B., Polakis P., Matrisian L. M. The metalloproteinase matrilysin is a target of ß-catenin transactivation in intestinal tumors. Oncogene, 18: 2883-2891, 1999.[Medline]
  20. Ozaki I., Mizuta T., Zhao G., Yotsumoto H., Hara T., Kajihara S., Hisatomi A., Yamamoto K. Involvement of the Ets-1 gene in overexpression of matrilysin in human hepatocellular carcinoma. Cancer Res., 60: 6159-6525, 2000.
  21. Wanke R., Hermanns W., Folger S., Wolf E., Brem G. Accelerated growth and visceral lesions in transgenic mice expressing foreign genes of the growth hormone family: an overview. Pediatr. Nephrol., 5: 513-521, 1991.[Medline]
  22. Adachi M., Suematsu S., Kondo T., Ogasawara J., Tanaka T., Yoshida N., Nagata S. Targeted mutation in the Fas gene causes hyperplasia in peripheral lymphoid organs and liver. Nat. Genet., 11: 294-300, 1995.[Medline]
  23. Harada N., Tamai Y., Ishikawa T., Sauer B., Takaku K., Oshima M., Taketo M. M. Intestinal polyposis in mice with a dominant stable mutation of the ß-catenin gene. EMBO J., 18: 5931-5942, 1999.[Medline]
  24. Gat U., Das Gupta R., Degenstein L., Fuchs E. De novo hair follicle morphogenesis and hair tumors in mice expressing. Cell, 95: 605-614, 1998.[Medline]
  25. de La Coste A., Mignon A., Fabre M., Gilbert E., Porteu A., Van Dyke T., Kahn A., Perret C. Paradoxical inhibition of c-myc-induced carcinogenesis by Bcl-2 in transgenic mice. Cancer Res., 59: 5017-5022, 1999.[Abstract/Free Full Text]
  26. Buendia M. A. Hepatitis B viruses and hepatocellular carcinoma. Adv. Cancer Res., 59: 167-226, 1992.[Medline]
  27. Buendia M. A. Genetics of hepatocellular carcinoma. Semin. Cancer Biol., 10: 185-200, 2000.[Medline]
  28. Nishida N., Fukuda Y., Komeda T., Kita R., Sando T., Furukawa M., Amenomori M., Shibagaki I., Nakao K., Ikenaga M., et al Amplification and overexpression of the cyclin D1 gene in aggressive human hepatocellular carcinoma. Cancer Res., 54: 3107-3110, 1994.[Abstract/Free Full Text]
  29. Peng S. Y., Chou S. P., Hsu H. C. Association of downregulation of cyclin D1 and of overexpression of cyclin E with p53 mutation, high tumor grade, and poor prognosis in hepatocellular carcinoma. J. Hepatol., 29: 281-289, 1998.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
M. A. Patil, S. A. Lee, E. Macias, E. T. Lam, C. Xu, K. D. Jones, C. Ho, M. Rodriguez-Puebla, and X. Chen
Role of Cyclin D1 as a Mediator of c-Met- and {beta}-Catenin-Induced Hepatocarcinogenesis
Cancer Res., January 1, 2009; 69(1): 253 - 261.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
D. F. Calvisi, F. Pinna, S. Ladu, R. Pellegrino, M. R. Muroni, M. M. Simile, M. Frau, M. L. Tomasi, M. R. De Miglio, M. A. Seddaiu, et al.
Aberrant iNOS signaling is under genetic control in rodent liver cancer and potentially prognostic for the human disease
Carcinogenesis, August 1, 2008; 29(8): 1639 - 1647.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. A. Schmidt, C. S. Chiariello, E. Capilla, F. Miller, and W. F. Bahou
Development of Hepatocellular Carcinoma in Iqgap2-Deficient Mice Is IQGAP1 Dependent
Mol. Cell. Biol., March 1, 2008; 28(5): 1489 - 1502.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. M. Iglesias, P.-A. Hueber, L. Chu, R. Campbell, A.-M. Patenaude, A. J. Dziarmaga, J. Quinlan, O. Mohamed, D. Dufort, and P. R. Goodyer
Canonical WNT signaling during kidney development
Am J Physiol Renal Physiol, August 1, 2007; 293(2): F494 - F500.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Wang, L. Shang, A. W. G. Burgett, P. G. Harran, and X. Wang
Diazonamide toxins reveal an unexpected function for ornithine {delta}-amino transferase in mitotic cell division
PNAS, February 13, 2007; 104(7): 2068 - 2073.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C.-A. Renard, C. Labalette, C. Armengol, D. Cougot, Y. Wei, S. Cairo, P. Pineau, C. Neuveut, A. de Reynies, A. Dejean, et al.
Tbx3 Is a Downstream Target of the Wnt/{beta}-Catenin Pathway and a Critical Mediator of {beta}-Catenin Survival Functions in Liver Cancer
Cancer Res., February 1, 2007; 67(3): 901 - 910.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. M. Lowy, W. M. Clements, J. Bishop, L. Kong, T. Bonney, K. Sisco, B. Aronow, C. Fenoglio-Preiser, and J. Groden
{beta}-Catenin/Wnt Signaling Regulates Expression of the Membrane Type 3 Matrix Metalloproteinase in Gastric Cancer.
Cancer Res., May 1, 2006; 66(9): 4734 - 4741.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Colnot, T. Decaens, M. Niwa-Kawakita, C. Godard, G. Hamard, A. Kahn, M. Giovannini, and C. Perret
Liver-targeted disruption of Apc in mice activates {beta}-catenin signaling and leads to hepatocellular carcinomas
PNAS, December 7, 2004; 101(49): 17216 - 17221.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
D. F. Calvisi, S. Ladu, V. M. Factor, and S. S. Thorgeirsson
Activation of {beta}-catenin provides proliferative and invasive advantages in c-myc/TGF-{alpha} hepatocarcinogenesis promoted by phenobarbital
Carcinogenesis, June 1, 2004; 25(6): 901 - 908.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Sharma, A. Pradeep, R. G. Pestell, and B. Rana
Peroxisome Proliferator-activated Receptor {gamma} Activation Modulates Cyclin D1 Transcription via {beta}-Catenin-independent and cAMP-response Element-binding Protein-dependent Pathways in Mouse Hepatocytes
J. Biol. Chem., April 23, 2004; 279(17): 16927 - 16938.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-H. Xiao, C. Ghosn, C. Hinchman, C. Forbes, J. Wang, N. Snider, A. Cordrey, Y. Zhao, and R. A. S. Chandraratna
Adenomatous Polyposis Coli (APC)-independent Regulation of {beta}-Catenin Degradation via a Retinoid X Receptor-mediated Pathway
J. Biol. Chem., August 8, 2003; 278(32): 29954 - 29962.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Levy, C. Neuveut, C.-A. Renard, P. Charneau, S. Branchereau, F. Gauthier, J. T. Van Nhieu, D. Cherqui, A.-F. Petit-Bertron, D. Mathieu, et al.
Transcriptional Activation of Interleukin-8 by beta -Catenin-Tcf4
J. Biol. Chem., October 25, 2002; 277(44): 42386 - 42393.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Loeppen, D. Schneider, F. Gaunitz, R. Gebhardt, R. Kurek, A. Buchmann, and M. Schwarz
Overexpression of Glutamine Synthetase Is Associated with {beta}-Catenin-Mutations in Mouse Liver Tumors during Promotion of Hepatocarcinogenesis by Phenobarbital
Cancer Res., October 15, 2002; 62(20): 5685 - 5688.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Harada, H. Miyoshi, N. Murai, H. Oshima, Y. Tamai, M. Oshima, and M. M. Taketo
Lack of Tumorigenesis in the Mouse Liver after Adenovirus-mediated Expression of a Dominant Stable Mutant of {beta}-Catenin
Cancer Res., April 1, 2002; 62(7): 1971 - 1977.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Inagawa, M. Itabashi, S. Adachi, T. Kawamoto, M. Hori, J. Shimazaki, F. Yoshimi, and K. Fukao
Expression and Prognostic Roles of {beta}-Catenin in Hepatocellular Carcinoma: Correlation with Tumor Progression and Postoperative Survival
Clin. Cancer Res., February 1, 2002; 8(2): 450 - 456.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cadoret, A.
Right arrow Articles by Perret, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cadoret, A.
Right arrow Articles by Perret, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online