| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Department of Pharmacology [B. V., Z. C., J. T. B., W. D., Jr., E. S. W., K. D. T.] and Division of Medical Science [M. G. B.], Fox Chase Cancer Center, Philadelphia, Pennsylvania 19111
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Many ABC transporters play critical roles in the cellular efflux of endogenous or xenobiotic substrates, and their biological dysfunction has been implicated in a number of clinical disorders. For example, impaired function of the cyclic AMP-activated ABCC7 (CFTR) chloride channel appears to be the basic defect in epithelial and nonepithelial cells derived from cystic fibrosis patients (6) . Some mutations in the peroxisomal membrane half-transporter ABCD1 (ALDP), are associated with abnormal peroxisomal ß-oxidation of saturated, very long chain fatty acids, and result in the neurodegenerative disorder X-linked adrenoleukodystrophy (7) . The absence of functional transporter subunits associated with antigen processing (ABCB2 and ABCB3), has been linked to different forms of HLA class I deficiency syndrome (8) . Mutations in the mitochondrial half-transporter, ABCB7, (an iron-transporter) are responsible for X-linked sideroblastic anemia and ataxia (9) . More recently, ABCA4, the rod photoreceptor ABC transporter, has been implicated in a whole spectrum of vision disorders (10) . Mutations in the ABCA4 gene interfere with transport functions that can lead to conditions associated with Stargardt disease, age-related macular degeneration, fundus flavimaculatus, cone-rod dystrophy, and retinitis pigmentosa. Characterization of ABCA4 knockout mice (11) suggested that ABCA4 probably functions as an outwardly directed flippase for N-retinylidene-phosphatidylethanolamine, protecting the retinal pigment epithelium from toxic adducts of photobleaching. Mutations in a closely related transporter, ABCA1, have been linked to Tangier disease and familial high-density cholesterol deficiency syndrome (12, 13, 14) . Disrupted export of cholesterol and phospholipids from the cells plays a major role in the pathogenesis of these diseases (15) .
ABC transporters have been implicated in cellular drug resistance (16) . In particular, members of the MDR and MRP subfamilies of proteins have been linked to simultaneous resistance to multiple cytotoxic drugs in cancer cells. MDR1 confers resistance to a variety of hydrophobic, amphipathic natural product drugs (17) whereas members of the MRP-subfamily cause resistance to anionic and neutral drugs frequently conjugated to acidic ligands (18) . Extending the drug-resistance paradigm, research from our laboratory revealed that an ovarian carcinoma cell line made resistant to the estradiol-based agent, estramustine, has a homogeneously staining region at chromosome 9q34 (19) . Fluorescence in situ hybridization with a probe specific to a region of ABCA2 indicated that this gene was amplified at 9q34. Both gene copy number and mRNA levels of this transporter were increased in the resistant cell line. In addition, antisense treatment directed toward ABCA2 mRNA sensitized the resistant cells to estramustine. Together, these results suggested that ABCA2 is causally involved in estramustine resistance and implied a possible role for ABCA2 in steroid transport. Recently, Kikuno et al. (20) showed that a partial-sequence human cDNA clone, highly similar to mouse Abca2, was more prevalent in brain than in other tissues. Our present data provide the first characterization of the full-length human ABCA2 cDNA and its detailed expression pattern. Functionally, the protein sequesters estramustine into intracellular vesicles with lysosomal/endosomal characteristics, indicating a potential role in steroid transport and/or metabolism.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Our initial library screening experiments were performed using a ready-made random and oligo(dT)-primed human fetal brain cDNA library generated in
ZAP II (Stratagene, La Jolla, CA). This library was chosen because Abca2 expression in the mouse is most pronounced in the brain (21)
. The library was probed with a 32P-labeled (Prime-it II Random Primer Labeling Kit; Stratagene) 490-bp PCR fragment that we amplified from the 5' end of the 1.75-kb ABCA2 fragment. Screening was performed according to the manufacturers instructions. The four longest ABCA2 clones were designated as
15B,
17B,
5A, and
9A (Fig. 1)
.
|
900 bp (Fig. 1)
To obtain the entire 5' end sequence, we constructed a 5' ABCA2 cDNA library from high quality human brain poly(A)+RNA (Clontech) using a Marathon cDNA Amplification Kit (Clontech). Gene-specific primer, 5'CCACTGGGCAGCGAGAAGTTGTC3', was used for first-strand synthesis. Second-strand synthesis and creation of blunt ends was followed by DNA ligation with adapters provided with the kit, according to the manufacturers protocol. The library was then PCR-amplified using AP1 and 5'CCACTGGGCAGCGAGAAGTTGTC3' and then amplified with the nested ABCA2 primer, 5'GAAGCTGGAGTTCTGGCGGATCT3' and the adapter primer, AP2. Reaction products were cloned into pCR-XL-TOPO plasmid (Invitrogen) and transformed into DH5
cells. Fig. 1
indicates the location of the two longest clones, designated 65 and 119.
For 3' RACE, we used 5'CAGACCACACTGGACAATGTGTTCGTG3' (forward) and AP1 (reverse), and 5'TCATCAGCTTCGAGGAGGAGCGG3' (forward) and AP2 (reverse). Only short, 300-bp fragments were isolated (data not shown).
Full-length ABCA2 cDNA was assembled from four fragments (AD). Fragments A and B were obtained by PCR from a human brain cDNA library using the following primers: (5'ATAAGCTTGCTGAGGCGGCGGAGCGTGGC3' and 5'CCACTGGGCGAGAAGTTGTC3' for fragment A; and 5'CCTCATTTTCCCCTACAACC3' and 5'ACCTGCTCCATCTTGCTGCTGAACAC, for fragment B. Fragment C was directly obtained by restriction digestion of KIA1065 clone (kindly provided by Dr. Takahiro Nagase from Kazusa the DNA Research Institute, Chiba, Japan; Ref. 20 ). Fragment D was obtained by PCR from KIA1065 clone using 5'CAGCGGCGGCAACAAGCGGAA3' and 5'GGTGAATTCGGCAGGCACTGGGGGACTTGT3' primers. PCR products were initially cloned into the pCR-XL-TOPO cloning vector. Fragment A was excised by HindIII and SalI digestion and subcloned into pCR-XL-TOPO clone containing fragment B. Fragment D was excised by KpnI and EcoRI digestion and subcloned into corresponding sites of (A+B)pCR-XL-TOPO construct. Finally, fragment C was cloned into the KpnI site of (A+B+D) pCR-XL-TOPO clone.
The ABCA2 cDNA fragment was inserted into HindIII and EcoRI sites of pcDNA3.1 vector (Stratagene).
The pEGFP-ABCA2 clone was constructed in the following way. The start codon of ABCA2 was modified using PCR (primers used were 5'TAGTACTCCTTGGGCTTCCTGCACCAGC3' and 5'CCAGGGCAGATGAGGGACCAAAGA3'), and the resulting clone was inserted into ScaI and EcoRI sites of pEGFP-C3 vector (Clontech).
All PCR products were verified by double-stranded DNA sequencing.
Mapping of Transcription Start Site.
5' RACE was used to map the start site of the ABCA2 transcript. Reverse transcription of total brain RNA (Clontech) was performed using the antisense gene-specific primer 5'CATCCAGCAGGTCCCCCAGAAGC 3' with subsequent RNase H treatment. First-strand synthesis product was subjected to dC tailing reactions with terminal deoxynucleotidyl transferase. The first round of PCR amplification was then performed using 5' RACE anchor primer 5'GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG3' and gene-specific antisense primer 5'AAACAGGTTGCCCTTCCTCCACCAC3'. A second round of PCR amplification was performed with universal amplification primer 5'GGCCACGCGTCGACTAGTAC3' and gene-specific antisense primer 5'ACAGCGATTGCATGACAGGCAG3'. A single
300-bp product was obtained, and, after purification, it was cloned and sequenced.
Northern Blot Analysis.
Samples of the total RNA from a selection of the National Cancer Institute human tumor cell line panels were provided by Dr. Anne Monks (National Cancer Institute, Rockville, MD) (22)
. Ten-µg samples were separated on formaldehyde agarose gels, transferred to nylon membranes (GeneScreen; NEN Life Science Products, Inc., Boston, MA), and hybridized by standard protocols. 32P-radioactive labeling of a gel-purified 1.75-kb ABCA2 probe (position 37545498) to high specific activity was performed by random priming kit (Prime-It II Random Primer Labeling Kit; Stratagene).
Multiple Tissue Northern blot (MTN; Clontech) was hybridized with an 850-bp probe (position 41575005) that was PCR-amplified using the following primers: 5'AGGGAGCTGGCTACACCGACG3' (forward) and 5'CGCCTGTGACCACCCGCATCT3' (reverse). 32P-radioactive labeling was performed according to the random primer labeling method.
ABCA2 Sequence Analysis.
Nucleotide sequencing was performed with an ABI 377 DNA sequencer. The sequences were assembled in the Sequencher program (Gene Codes Corporation, Ann Arbor, MI). Protein computer analyses were performed with the Genetics Computer Group Package, version 9.1 (Madison, WI), and McVector (Oxford Molecular, Oxford, United Kingdom). N-linked glycosylation sites were obtained by ScanProsite analysis.5
TMDs were obtained with TopPred 2 analysis.
Transfections.
HEK293 cell lines (American Type Culture Collection, Rockville, MD) were cultured in DMEM supplemented with 50 µg/ml streptomycin, 50 units/ml penicillin, 2 mM glutamine, and 10% (v/v) fetal bovine serum. Transient transfections were performed using SuperFect (Qiagen, Valencia, CA) transfection reagent according to the manufacturers instructions. Cells (2 x 105/well) were seeded on LabTek II chambered coverglass (Nunc 155379) and transfected with 1.5 µg/well of pEGFP-C3 or pEGFP-ABCA2 vector. After 48 h, slides were prepared for confocal microscopy or lysed in 18 mM 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate buffer supplemented with protease inhibitors for immunoblot analysis.
The stably overexpressing HEK293 clones were created by electroporation of 2 x 106 HEK293 cells with 10 µg of either the pcDNA-ABCA2 or the parental pcDNA3.1 vector using Bio-Rad (Hercules, CA) gene Pulser apparatus. At 48 h after electroporation, the growth medium was changed to include 0.8 mg/ml G418. At
3 weeks, independent G418-resistant colonies were isolated using the cloning cylinder technique and expanded for confocal, drug sensitivity, or immunoblot analysis (same preparation conditions as above).
Immunoblot Analysis.
Polyclonal rabbit antisera were raised against synthetic peptides corresponding to residues 14991522 of the primary ABCA2 sequence. Protein levels in whole cell lysates were quantified by Bradford assay (Bio-Rad) and separated by 6% SDS-PAGE and transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked with 5% powder milk in Tris-buffered saline and 0.1% Tween 20 and probed for 1 h at room temperature with anti-ABCA2 antibody or mouse anti-GFP antibody (Clontech 8362-1). Each primary antibody was used at 1:500 dilution. Antirabbit-horseradish peroxide (Amersham Pharmacia Biotech NA934, Uppsala, Sweden) or antimouse-horseradish peroxide (Amersham Pharmacia Biotech NA931) was used as secondary antibodies at 1:1000 dilution. Bands were visualized using Renaissance Western Blot Chemiluminescence Reagent Plus (NEN Life Science Products, Inc.).
Immunofluorescence.
Cells were prepared for immunofluorescence by standard methods. Fixation was accomplished by -20°C methanol or by 4% paraformaldehyde with 0.1% Tween 20. Primary antibodies used were a polyclonal rabbit anti-ABCA2; a polyclonal goat anti-LAMP1 (C-20), sc8090 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); a polyclonal rabbit anti-PMP70 (Zymed Laboratories, Inc., San Francisco, CA); a polyclonal rabbit anti-Human Endoplasmic Reticulum Associated Amyloid Beta Binding Protein (Chemicon International, Inc., Temecula, CA); a monoclonal mouse anti-Golgi Complex ab-1 (Clone 371-4; Neomarkers, Fremont, CA); and monoclonal mouse antihuman mitochondria (Chemicon International, Inc., Temecula, CA). Secondary antibodies used were species-specific for the primary antibodies, and all were conjugated with Rhodamine Red X and Cy2 (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). A Mowiol antifade in glycerol was used in an aqueous mounting medium.
Confocal Microscopy.
Immunofluorescently stained cells were imaged using a Bio-Rad MRC-600 laser scanning confocal microscope. Using the two photomultiplier setting on the laser scanning confocal microscope, dual acquisition of GFP or Cy2 and Rhodamine Red X was accomplished. Optical sections were acquired with x60 and x100 objectives using a 0.5-µM step size. The volumes were rendered using Voxel View (Vital Images, Plymouth, MN).
Dansylated Estramustine Imaging.
Transfected HEK293 cells were treated for 2 h with a dansyl chloride derivative of estramustine (synthesis described in Ref. 23
) at a final concentration of 200 nM. The drug was removed, the were cells washed with PBS, and fresh media was added to the cells. Drug-treated cells were then imaged with a Quantix 12-bit cooled CCD camera (Roper, Inc., Tuscon, AZ). For transiently transfected HEK293 cells, dansylated estramustine, fluorescent GFP, and phase-contrast images were generated simultaneously using Isee software (Inovision Corp., Durham, NC) to drive the CCD, a Ludl filter wheel, and a shutter attached to a Nikon TE300 inverted microscope. For stably transfected HEK293, dansylated estramustine, anti-ABCA2 conjugated to Rhodamine Red X, and DIC images were taken sequentially. A forced-air incubator encompasses the microscope so that cells can be observed at near-physiological conditions.
Analysis of Drug Sensitivity.
Estramustine sensitivity was analyzed using a tetrazolium salt microtiter plate assay (Cell Titer 96 Cell Proliferation Assay; Promega, Madison, WI). Cells were seeded in triplicate at 8000/well in 96-well dishes in complete medium supplemented with 10% fetal bovine serum. The next day, estramustine at various dilutions was added to the growth medium. Assays were performed at 72 h of growth in the presence of the drug.
| RESULTS |
|---|
|
|
|---|
9A, was 4.8 kb in length (Fig. 1)
1.4-kb of sequence at the 5' end of ABCA2 cDNA from the longest overlapping clones, 35 and 208 (Fig. 1)
For the 3' RACE experiment, we used gene-specific primers upstream from the predicted stop codon, (based on the mouse ORF; Ref. 21
) and generated a number of 300400-bp fragments containing putative stop codons and an additional
300 bp of 3'-UTR (data not shown). In addition, an interim BLAST search (25)
of the sequence of the
9A clone (Fig. 1)
returned a brain clone KIAA1062 (20)
with high identity to the last
4.7 kb of this clone and provided an additional
400 bp of 3'-UTR (Fig. 1)
. The assembled total sequence was 8056 bp with 7308 bp corresponding to the ORF, 50 bp 5'-UTR and 698 bp 3'-UTR (Fig. 1)
.
Primary Structure of ABCA2.
Nucleotide analysis revealed that the ABCA2 ORF was comprised of 7308 bp and encoded a 2436-amino acid protein with a predicted molecular weight of Mr 270,000 (Fig. 2A)
.
|
The ABCA2 protein is a full-size transporter that contains a tandem repeat of the recognizable hydrophobic domain with six transmembrane helices followed by highly conserved ABCs (Fig. 2A)
. Structurally, the hydrophobic domain spacing is reminiscent of that found in ABCA4 (Fig. 2, B and C)
. The cytosolic NH2 terminus is followed immediately by the first transmembrane segment and a long extra-cytosolic loop. The long hydrophilic linker portion of the protein (
700 amino acids) is separated into two halves by a HHD. This region of the protein, as suggested by Luciani et al. (21)
, may correspond to a putative regulatory domain similar to the one found in ABCC7. The potential sites of N-glycosylation are concentrated in 2 regions with the first 15 on the large extracellular loop and the second 6 between the putative HHD and the 7th transmembrane segment. Although there is evidence for these posttranslation modifications in the first region for ABCA4 (26)
, no data on glycosylation within the second region for ABC1-subfamily members is presently available. A number of potential phosphorylation sites were also apparent, including protein kinase C, casein kinase, tyrosine kinase and cAMP dependent-protein kinase. Many of them are located in the putative linker region of ABCA2. Of particular interest to the potential role of ABCA2 in the transport of steroids, a lipocalin signature (GQSRKLDGGWLKV) was identified at position 1424 within the putative regulatory domain and close to the HHD. This motif is characteristic of small lipocalin proteins that transport lipids, steroids, bilins, and retinoids (27)
.
ABCA2 Northern Blot Analysis.
The expression patterns of ABCA2 in a panel of normal adult human tissues was investigated by Northern blot analysis. As presented in Fig. 3
, ABCA2 is expressed as a single transcript of
8 kb. Of the 12 tissues analyzed, ABCA2 expression was highest in the brain, whereas lower levels of expression were observed in kidney and liver. These results are similar to those found with the mouse (21)
. For the National Cancer Institute tumor cell line panel, there was a broad pattern of ABCA2 expression (Table 1)
.
|
|
|
|
|
2-fold resistance to estramustine at the lower drug concentrations. At higher drug concentrations (>7 µM), the difference in cytotoxicity was diminished, perhaps reflecting a saturation of the transport system.
|
| DISCUSSION |
|---|
|
|
|---|
50%) for mouse Abca2 has been generated (21)
and, premised on an extrapolation of the degree of amino acid identity, ABCA2 can be regarded as orthologous. The estimated topology of ABCA2 is reminiscent of that seen in ABCA4 (26
, 28
, 29)
. The large size of this protein (Mr
270,000) makes it the largest ABC transporter reported to date. The extracellular loop between the first two transmembrane segments, together with the regulatory domain, account for the size difference compared with other full-size transporters. ABCA2 has a large number of potential sites for both glycosylation and phosphorylation. A total number of 21 putative glycosylation sites were identified. This is the highest number thus far described for any ABC transporter. The phosphorylation of ABCA2 may play a functional regulatory role, because the activity of other ABC transporters such as ABCC7 (CFTR) is modulated by protein kinase A (30)
, implying a possible similar role for kinases and ABCA2. The expression of ABCA2 in the lysosome/endosome compartment is unusual among those ABC1-subfamily members thus far characterized. For example, ABCA1 is suggested to localize to Golgi vesicles and plasma membrane (15) , whereas ABCA4 is found in the disc membrane of the retinal rod outer segment (31) . The only other described mammalian ABC transporter located in lysosomes is ABCA9 (32) . Like most of the other intracellular organelle ABC transporters, ABCB9 is a half-transporter, which means that it contains one ABC and TMD and would require a partner to function as a dimer. Thus, ABCA2 is distinct in that it has a full transporter structure (2* ABC + 2*TMD). Furthermore, ABCA2 does not contain the recognizable lysosomal signal sequence, implying that it contains a novel lysosomal targeting sequence yet to be defined.
The merged images of ABCA2 and other cellular organelles indicated partial colocalization was also present in both the endoplasmic reticulum and Golgi. Presumably, these results can be explained by the synthesis and processing of the protein. In particular, the large number of posttranslational sites (particularly glycosylation) may influence its passage through the Golgi. Additionally, ABCA2 showed partial association with peroxisomes. Many of the individual peroxisomal vesicles did not costain with ABCA2, and the overall pattern of merged staining was less compelling than for the endosome/lysosome compartment. Analysis of large numbers of cells indicated that the colocalization of ABCA2 with peroxisomes was less consistent than with endosomes/lysosomes. We confirmed the lysosomal localization of ABCA2 in several cell lines and with different transfection protocols. Whether the transporter has a role in general lysosomal function or facilitates specialized lysosome transport remains to be determined.
The tissue distribution of ABCA2 shows prevalence of expression in the central nervous system, brain, and spinal cord. This is in agreement with the data of Luciani et al., who showed a similar tissue distribution for mouse Abca2 (21) . Lower, but significant, levels of expression were also observed in the kidney and liver. Thus far, several ABC transporters have been identified at the blood-brain barrier (e.g., ABCB1 and ABCC1), and their role in the transport of xenobiotics is documented (33 , 34) . Although the high level of ABCA2 in neuronal tissue implies a functional association, its presence in other tissues also suggests a more general role for this transporter.
In some cases, ABC transporters have been shown to participate in the active transport of a variety of substrates (35
, 36)
. The data from our earlier study on estramustine-resistance clearly linked ABCA2 expression with resistance to this drug in an ovarian carcinoma cell line (19)
. Other resistance has been shown in this selected cell line, including changes in expression of tubulin isotopes and
phosphorylation (37)
. Because acquired resistance is frequently accompanied by multiple cellular adaptations, ABCA2 may be a contributory factor in cell response without providing the entire resistant phenotype. Estramustine is a synthetic nitrogen mustard derivative of estradiol with an unexpected antimitotic activity (38)
. Thus, although estramustine would not represent a natural substrate for ABCA2, its crystal structure has shown that it maintains a structural component that is identical to the steroid estradiol (39)
. Another possible clue to the function of ABCA2 is the presence of lipocalin signature motifs in the putative regulatory domain of the protein. Lipocalins are a family of proteins linked to the transport of retinoids, steroids (including cholesterol), lipids, and bilins (27)
. They are characterized by the presence of eight antiparallel, ß-sheet peptide conformations (up to 200 amino acids in length) that form a binding site for hydrophobic substrates. The signature motif resides near the start of the first ß-strand. In ABCA2, the lipocalin-binding site would hypothetically span partial regions of both the regulatory (hydrophilic) and membrane (hydrophobic) domains. Perhaps not coincidentally, the locus of some members of this family (Lipocalin 1 and 2) is on 9q34, where ABCA2 resides (19
, 21
, 40
, 41)
. In addition, ABCA2-related proteins (ABCA1, ABCA4, and ABCA7) are suggested to play a role in lipid transport (42
, 43)
. Thus, it is possible that lipid or lipid-steroid complexes bind to this lipocalin component of ABCA2, facilitating their transport and sequestration into endosomal/lysosomal vesicles. Such vesicular compartments could eventually provide metabolic or secretory pathways for these molecules. The high expression of the transporter in the central nervous system may also bring into consideration such substrates as neurotransmitters and/or bioactive amino acids or peptides as possible endogenous substrates.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 This work was supported in part by NIH Grants CA06927 and RR05539, by NIH Grant CA53893 (to K. D. T.), and by an appropriation from the Commonwealth of Pennsylvania. Sequence data from this article have been deposited with GenBank and European Molecular Biology Laboratory Data Libraries under Accession No. AF178941. ![]()
2 Present address: Merck and Company, Inc., West Point, PA. ![]()
3 To whom requests for reprints should be addressed, at Department of Pharmacology, Fox Chase Cancer Center, 7701 Burholme Avenue, Philadelphia, PA 19111. Phone: (215) 728-3137; Fax: (215) 728-4333; E-mail: kd_tew{at}fccc.edu ![]()
4 The abbreviations used are: ABC, ATP-binding cassette; RACE, rapid amplification of cDNA ends; oligo(dT), oligodeoxythymidylic acid; AP, adaptor primer; UTR, untranslated region; ORF, open reading frame; HHD, highly hydrophobic domain; TMD, transmembrane domain; DIC, differential interference contrast. ![]()
5 Internet address: http://www.expasy.ch/tools/scnpsit1.html. ![]()
6 Internet address: http://www.med.rug.nl/mdl/humanabc.htm. ![]()
Received 8/28/00. Accepted 2/13/01.
| REFERENCES |
|---|
|
|
|---|
chain, prostaglandin-D-synthase, oncogene-24p3, and progestagen-associated endometrial protein map to HSA9 and MMU2. Genomics, 23: 145-150, 1994.[Medline]
This article has been cited by other articles:
![]() |
J. T. Mack, V. Beljanski, A. M. Soulika, D. M. Townsend, C. B. Brown, W. Davis, and K. D. Tew "Skittish" Abca2 Knockout Mice Display Tremor, Hyperactivity, and Abnormal Myelin Ultrastructure in the Central Nervous System Mol. Cell. Biol., January 1, 2007; 27(1): 44 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Efferth, J.-P. Gillet, A. Sauerbrey, F. Zintl, V. Bertholet, F. de Longueville, J. Remacle, and D. Steinbach Expression profiling of ATP-binding cassette transporters in childhood T-cell acute lymphoblastic leukemia. Mol. Cancer Ther., August 1, 2006; 5(8): 1986 - 1994. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Tucker, Z. Lipatova, V. Beljanski, D. M. Townsend, and K. D. Tew Evaluation of Lipophilins as Determinants of Tumor Cell Response to Estramustine J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1158 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Tew, J. T. Boyd, Z. J. Chen, W. Davis Jr., F. Fazilev, V. Findlay, L. Gate, K. Ile, A. Soulika, and D. M. Townsend Glutathione and ABC Transporters as Determinants of Sensitivity to Oxidative and Nitrosative Stress J. Nutr., November 1, 2004; 134(11): 3205S - 3206S. [Full Text] [PDF] |
||||
![]() |
G. D. Leonard, T. Fojo, and S. E. Bates The Role of ABC Transporters in Clinical Practice Oncologist, October 1, 2003; 8(5): 411 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Lockhart, R. G. Tirona, and R. B. Kim Pharmacogenetics of ATP-binding Cassette Transporters in Cancer and Chemotherapy Mol. Cancer Ther., July 1, 2003; 2(7): 685 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Davis Jr, Z. J. Chen, K. E. Ile, and K. D. Tew Reciprocal regulation of expression of the human adenosine 5'-triphosphate binding cassette, sub-family A, transporter 2 (ABCA2) promoter by the early growth response-1 (EGR-1) and Sp-family transcription factors Nucleic Acids Res., February 1, 2003; 31(3): 1097 - 1107. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. R. Su, M. F. Linton, and S. Fazio Rapid quantification of murine ABC mRNAs by real time reverse transcriptase-polymerase chain reaction J. Lipid Res., December 1, 2002; 43(12): 2180 - 2187. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |