| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Department of Oncology, Albert Einstein Cancer Center, Bronx, New York 10467 [J. M. M., F. A., L. S., A. V., L. H. A.], Department of Pharmacology, Yale University School of Medicine, New Haven, Connecticut 06520 [M. B.], and Strang Cancer Prevention Center, New York, New York 10021 [M. K.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In normal colonic epithelial cells, APC in combination with glycogen synthase kinase 3ß and axin regulates free cytoplasmic ß-catenin levels by binding to and targeting ß-catenin for degradation by ubiquitination-dependent proteolysis (8, 9, 10, 11, 12) . This regulates the availability of free ß-catenin for binding with the TCF-LEF family of transcription factors (13, 14, 15) . Mutations in APC or ß-catenin can result in the failure of ß-catenin to be degraded, and subsequently, in an increase in ß-catenin-TCF complex formation. This, in turn, results in alterations in gene transcription (16, 17, 18) .
Because APC is important in homeostasis, a strong hypothesis is that in causing colon tumor formation, the loss of wild-type APC, and hence altered ß-catenin-TCF signaling, affects at least one of three pathways of colonic cell maturation: cell cycle arrest, lineage-specific cell differentiation, and apoptosis, all of which take place as cells migrate from the base of the colonic crypt toward the lumen (19 , 20) .
A role for ß-catenin-TCF in the regulation of apoptosis is not clear, with both pro- and antiapoptotic effects reported. A proapoptotic role is suggested by the induction of apoptosis subsequent to down-regulation of this pathway by the reintroduction of wild-type APC into APC mutant colon cancer cell lines (21 , 22) . In contrast, however, overexpression of APC in the intestinal epithelium has no effect on apoptosis (23) . Furthermore, the induction of apoptosis in certain instances is associated with the cleavage of APC (24 , 25) , suggesting that APC may, in fact, be a survival factor for colonic epithelial cells.
A role for ß-catenin-TCF signaling in the regulation of colonic cell proliferation is more clear. For example, overexpression of wild-type APC results in the induction of G0/G1 cell cycle arrest (26) , and the presence of functional ß-catenin-TCF binding sites have been identified in the promoters of the key cell cycle regulatory genes, cyclin D1 (27) and c-myc (28) . Furthermore, mice with a targeted inactivation of the TCF-4 gene show the loss of a functional stem cell compartment in the small intestine, and the animals die within 2 weeks of birth (29) .
It is important, however, that the loss of the stem cell compartment in the TCF-4-null mice was coincident with differentiation of cells in the midvillus compartment, suggesting that a primary affect of a loss of ß-catenin-TCF signaling may include premature cell differentiation. The present study, therefore, examines the role of the APC-ß-catenin-TCF pathway in the regulation of colonic epithelial cell differentiation along the absorptive cell lineage. We have used the Caco-2 colon cancer cell line, which undergoes cell cycle arrest and differentiation along the absorptive cell lineage with time in culture, modeling the phenotypic changes that absorptive cells undergo as they migrate along the crypt axis toward the lumenal surface (30, 31, 32) . In the present study, we demonstrate that these changes in cell maturation are linked to down-regulation of ß-catenin-TCF complex formation and signaling. This down-regulation was most likely attributable to the decrease in TCF-4 expression. Importantly, the premature down-regulation of ß-catenin-TCF signaling in undifferentiated Caco-2 cells by ectopic expression of wild-type APC, E-cadherin, or a dominant negative mutant form of TCF-4, results in concomitant premature activation of the promoters of two genes whose expression is characteristic of the absorptive cell lineage. The data, therefore, demonstrate a role for ß-catenin-TCF signaling in the regulation of lineage-specific differentiation of colonic epithelial cells.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Transfections.
The plasmids pTOPFLASH, pFOPFLASH (17)
, pGL3-iFABP (33)
, IAP2.4CAT (34)
, pGL3-SI (35)
, pGL3-CEA (36)
, CMV-APC (21)
, pBAT-EM2 (37)
, CMV-
N-TCF-4 (17)
, and -163CD1LUC (27)
have been described previously. In all cases, DNA was purified by the use of the Qiagen maxi-prep kit (Qiagen, Valencia, CA). Cells were grown and transfections done in 24-well plates using the Fugene (Boehringer-Mannheim) transfection reagent according to the manufacturer’s instructions. Cells were transfected with 0.1–0.5 µg of reporter plasmid, 0.1–1 µg of test plasmid, and 0.167 µg of CMV-ß-GAL, ß-actin-ß-GAL, or TK-Renilla as a control for transfection efficiency. Appropriate amounts of pBluescript were added to ensure that all cells received equivalent amounts of DNA. ß-catenin-TCF activity was determined by calculating the ratio of luciferase activity obtained from pTOPFLASH relative to pFOPFLASH.
Gel Shift Analysis.
Nuclear extracts were prepared as reported previously (38)
with the addition of 1 mM phenylmethylsulfonyl fluoride (Sigma Chemical Co., St. Louis, MO) to the STKM lysis buffer [30% sucrose (w/v), 40 mM Tris (pH 7.5), 37 mM KCL, 12 mM MgCl2, and 0.8% Triton X-100; Sigma Chemical Co.]. Binding reactions were performed as reported (17)
, except that the poly [I, C] concentration was adjusted to 400–600 ng per reaction. The double-stranded wild-type (GCACCCTTTGATCTTACC) and mutant (GCACCCTTTGGCCTTACC) TCF oligonucleotides (Promega Co.) were labeled with Promega’s 5'-end labeling kit and 
-[32P]dATP (6000 Ci/mmol; NEN, Boston, MA). Anti-ß-catenin antibody was obtained from Transduction Laboratories (Lexington, KY) and anti-CD4 (control) antibody from Quidel Corp. (San Diego, CA). Gel shifts were analyzed in 4% polyacrylamide, 1x Tris-borate EDTA gels, dried, and the data were analyzed using a PhosphorImager:425 (Molecular Dynamics, Sunnyvale, CA).
Western Blot Analysis, Immunoprecipitation.
Total cellular protein was isolated in immunoprecipitation buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% IGEPAL, 0.5% sodium deoxycholate, 1 mM EDTA, 5 µg/ml leupeptin, 1 µg/ml aprotinin, 1 µM phenylmethylsulfonyl fluoride, and 0.7 µg/ml pepstatin]. Membrane and cytosolic fractions were prepared as described elsewhere (39)
. The association of ß-catenin with E-cadherin and APC was assessed in IP experiments, and in all cases 300 µg of total cell protein were used. ß-catenin-E-cadherin complex formation was determined by IP with anti ß-catenin (Transduction Labs, Lexington KY) and detection with anti-E-cadherin (Transduction Labs). APC-ß-catenin complexes were detected by IP with anti-APC (Ab-1; Oncogene Research Products, Cambridge, MA) and then with anti-ß-catenin (Transduction Labs).
Antibodies directed against ß-catenin (1:4000; Transduction Labs), E-cadherin (1:8000; Transduction Labs), TCF-4 (4 µg/ml; Upstate Bioscientific, Lake Placid, NY), APC (1 µg/ml, Oncogene Research Products), and actin (1:2000; Sigma Chemical Co.) were used in Western blot analyses. Proteins (2–100 µg) were resolved in prepoured Tris-glycine SDS gels (Bio-Rad, Richmond CA), and transferred to a nitrocellulose membrane overnight (Bio-Rad). Blots were blocked in 5% nonfat milk in PBS, and incubated with the primary antibody and appropriate secondary antibody for 1 h each. Antibody-binding was detected using enhanced chemiluminescence reagent according to the manufacturer’s instructions.
Immunofluorescence.
Subcellular localization of ß-catenin and E-cadherin was examined by immunofluorescence. Caco-2 cells grown on 0.05% gelatin-coated coverslips were harvested at confluence (day 0) or 21 days thereafter. Monolayers were washed in HBSS and fixed in 4% paraformaldehyde for 20 min at room temperature. Before staining, cells were washed in PBS/5 mM MgCl2, permeabilized in 0.3% Triton X-100/50 mM Tris/150 mM NaCl, for 10 min, washed in Tris/glycine buffer (200 mM Tris/100 mM glycine) for 5 min, and blocked in 2% BSA/2% FBS, for 1 h at 37°C. For undifferentiated Caco-2 cells, monolayers were incubated with anti-E-cadherin (1:2000) or anti-ß-catenin (1:2000) for 1 h at 37°C, washed, and incubated with a Cy3-conjugated antimouse antibody (1:750) for 1 h at 37°C. For colocalization studies, monolayers were initially probed for E-cadherin as described above, after which monolayers were washed and then incubated with a FITC-conjugated anti-ß-catenin antibody (1:2000; Transduction Laboratories). Monolayers were postfixed in 0.1% paraformaldehyde, and were nuclei stained with 1 µg/ml DAPI. Cells were visualized using a BX60 fluorescence microscope (Olympus America, Melville, NY) equipped with a DAPI and High Q (for detection of FITC and Cy3 dyes) filter set (Chroma Technology, Brattelboro, VT) and a x60 Plan Apo 1.4 numerical aperture objective. Images were acquired in grayscale with a SPOT RT-cooled CCD camera (Diagnostica Instruments, Sterling Heights, MI) and SPOT RT software (Diagnostica Instruments).
Characterization of APC Truncation Mutation.
Protein truncation mutations within codons 657-1693 of the APC gene were identified by PCR and IVTT. Two overlapping segments of the APC gene covering codons 657-1284 and 1099–1693 were amplified from genomic DNA using two pairs of specific PCR primers. The primers were based on those described by Levy et al. (40)
, but were modified to contain suitable restriction sites as follows: (a) codons 657-1284: forward primer, 5' GCGGATCCTAATACGACTCACTATAGGAACAGACCACCATGGGAGAGAACAA CTGTCTACAAACT-3'; reverse primer, 5' GGAATTCAGCTGATGACAAAGATGAT A-3'; and (b) codons 1099–1693: forward primer, 5'-GCGGATCCTAATACGACTCACTATAGGAACAGACCACCATGGTTTCTCCATACAGGTCACGG-3'; reverse primer, 5'-GGAATTCTGTAGGAATGGTAT CTCGT-3'. PCR was performed in 50-µl reactions containing 100 ng of genomic DNA, 0.2 µM primers, 0.2 mM dNTPs, 2.5 units of PfuTurbo (Stratagene) in 1x Pfu buffer [20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)SO4, 2 mM MgSO4, 0.1% Triton X-100, and 0.1 mg/ml BSA]. Cycling conditions for both segments were as follows: 94°C for 5 min and then 35 cycles of 94°C for 1 min; 57°C for 1 min; 72°C for 5 min; and finally one cycle of 72°C for 10 min. Reaction products were purified using a QIAquick PCR purification kit (Qiagen) and then used as templates in IVTT assays performed with the TNT Quick coupled reticulocyte lysate system (Promega) according to the manufacturer’s protocol. [35S]-methionine-labeled polypeptides were analyzed by 12% SDS-PAGE and fluorography. APC truncation mutation in Caco-2 cells was characterized further by sequence analysis of the PCR products. Internal sequencing primers used were selected from those reported previously (2)
.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
10-fold in fully differentiated cells (day 21; Fig. 1A
). As a control, we performed the same experiment in the SW480 cell line, which has high levels of ß-catenin-TCF signaling because of a mutation in the APC gene, but which does not undergo differentiation with time in culture. In contrast to Caco-2 cells, no change in ß-catenin-TCF activity was observed in SW480 cells cultured for 0, 2, 5, 7, or 21 days postconfluence (data not shown).
|
. Finally, statistical analysis demonstrated a significant correlation between the decrease in ß-catenin-TCF activity and complex formation during Caco-2 cell differentiation (r = 0.89; P = 0.015).
Down-Regulation of ß-Catenin-TCF Signaling Is Independent of APC.
Caco-2 cells have been reported previously to be APC mutant, but the nature of the APC mutation has not been characterized (41)
. IVTT and then DNA sequencing revealed a nonsense mutation at codon 1367, a C
T transition changing Gln (CAG) to a stop codon (TAG). Consistent with these findings and the previous report, we detected low levels of a 170kDa-truncated form of APC in Caco-2 cells, levels of which remained constant during Caco-2 cell differentiation (Fig. 2)
. Furthermore, an antibody directed against the NH2 terminus of APC was able to immunoprecipitate ß-catenin in Caco-2 cells. The amount of APC-ß-catenin complex, however, remained unchanged during Caco-2 cell differentiation (Fig. 2)
, demonstrating that down-regulation of ß-catenin-TCF signaling was independent of APC.
|
. In contrast, total ß-catenin protein levels increased significantly during Caco-2 cell differentiation (Fig. 3)
.
|
, top panel).
|
2-fold as the cells underwent differentiation (Fig. 4
, middle panel). Furthermore, immunoprecipitation experiments demonstrated a significant (10-fold) increase in the amount of E-cadherin-ß-catenin complex over the same time course (Fig. 4
, bottom panel). The increase in total ß-catenin levels, therefore, most likely reflects an increase in the E-cadherin-associated membrane fraction of ß-catenin.
To confirm this further, we examined the subcellular distribution of ß-catenin by immunofluorescence staining. As shown in Fig. 5
, and consistent with the subcellular fractionation studies, ß-catenin staining was exclusively localized to the cell membrane in fully differentiated Caco-2 cells (panel B). Similarly to ß-catenin, staining for E-cadherin was also exclusively found at the cell membrane (panel C), and merging of the ß-catenin and E-cadherin images (panel D) confirmed the colocalization of the two proteins to the cell membrane. Similar results were observed in undifferentiated Caco-2 cells, although the intensity of ß-catenin staining was considerably less (data not shown). No nuclear ß-catenin staining was observed at any stage during Caco-2 cell differentiation.
|
The effect of the ß-catenin-TCF pathway on the regulation of differentiation in colonic epithelial cells, however, is unknown. To test this, we examined the effect of down-regulation of ß-catenin-TCF signaling on the promoter activities of four genes linked to cell differentiation: ALP, iFABP, CEA, and SI.
First, we tested whether the promoter activities of these genes were regulated during spontaneous Caco-2 cell differentiation. Vectors containing the promoters of the ALP, iFABP, CEA, and SI genes linked to chloramphenicol acetyltransferase (CAT) or luciferase reporters were transfected into Caco-2 cells at different stages during the spontaneous maturation of these cells, and their activity was determined. As shown in Fig. 6
, the promoter activities of all markers increased 2- to 4-fold during Caco-2 cell differentiation. Thus, transcriptional up-regulation of these genes accompanied the decrease in ß-catenin-TCF signaling.
|
N-TCF-4 (a dominant negative mutant of TCF-4), wild-type APC, or E-cadherin, in undifferentiated Caco-2 cells (day 0 postconfluence), in each case, and as expected, resulted in significant down-regulation of ß-catenin-TCF signaling (Fig. 7, A–C)
. Also, and consistent with previous reports (27
, 42)
, down-regulation of the pathway by these mechanisms resulted in a decrease in cyclin D1 promoter activity in undifferentiated Caco-2 cells (data not shown).
|
. In contrast, in each case, the down-regulation of ß-catenin-TCF activity failed to induce any significant change in CEA or sucrase-isomaltase promoter activities (Fig. 7, A–C)
. |
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Several previous observations have suggested a role for ß-catenin-TCF signaling in the regulation of intestinal epithelial cell proliferation (27, 28, 29 , 42) . Consistent with these observations, the present study demonstrates an additional link between cell proliferation and ß-catenin-TCF signaling. ß-catenin-TCF signaling and complex formation was greatest in undifferentiated, proliferating Caco-2 cells (day 0) and gradually diminished with time after confluence (days 2–21) as Caco-2 cells underwent G0/G1 cell cycle arrest and differentiation along the absorptive cell lineage. Consistent with the down-regulation of ß-catenin-TCF signaling, the expression of the c-myc and cyclin D1 genes have been shown previously to be down-regulated as Caco-2 cells undergo these changes (31 , 45) .
The constitutively high levels of ß-catenin-TCF signaling in undifferentiated Caco-2 cells is consistent with the fact that these cells have a mutant APC gene. Protein truncation assays and sequencing analysis demonstrated the presence of a stop mutation in codon 1367 (exon 15), which is located in the mutation cluster region of the APC gene. This mutation would be expected to result in the translation of a truncated APC protein that retains its ability to bind ß-catenin, but which would be unable to target ß-catenin for degradation. To test this prediction, we examined whether changes in the levels of APC contributed to the down-regulation of ß-catenin-TCF signaling. We were able to detect low levels of this truncated APC protein and also of ß-catenin-APC complex, but levels of both remained constant during Caco-2 cell differentiation, suggesting that APC plays a minimal role in the down-regulation of ß-catenin-TCF signaling during the differentiation of these cells.
In parallel with the down-regulation of ß-catenin-TCF signaling during Caco-2 cell differentiation, TCF-4 protein levels decreased significantly. As TCF-4 is the DNA-binding component of the ß-catenin-TCF complex, its down-regultion most likely mediates the loss of ß-catenin-TCF-4 signaling during Caco-2 cell differentiation. In contrast to TCF-4, total ß-catenin levels increased significantly during Caco-2 cell differentiation. This increase, however, was attributable to an increase in the E-cadherin-associated membrane fraction of ß-catenin, whereas cytosolic ß-catenin levels, which is the critical parameter for ß-catenin-TCF signaling (46)
, remained unchanged over the time course. That the increase in ß-catenin was attributable to an increase in the E-cadherin-associated membrane fraction was demonstrated, first, by immunoprecipitation experiments, which showed increased ß-catenin-E-cadherin complex formation, and, second, by immunofluorescence staining, which showed strong colocalization of ß-catenin and E-cadherin in differentiated Caco-2 cells. It is important to note, however, that whereas E-cadherin levels increased 2-fold during Caco-2 cell differentiation, E-cadherin-ß-catenin complex formation increased 10-fold. This discrepancy may be explained by the fact that E-cadherin levels are very high, even in undifferentiated Caco-2 cells. The greater increase in E-cadherin-ß-catenin complex formation, therefore, may reflect the progressive sequestration of ß-catenin by the high levels of E-cadherin that are present even before the increase that occurs during differentiation.
In addition to undergoing cell cycle arrest, colonic epithelial cells undergo differentiation along one of three cell lineages as they migrate upwards along the crypt axis (19 , 20) . Caco-2 cells model differentiation along the absorptive cell lineage as shown by the increased promoter activities of four genes that encode markers of absorptive cell differentiation: ALP, CEA, SI, and iFABP protein. These observations are consistent with previous reports demonstrating that the enzymatic activity and expression of ALP, CEA and SI are increased in Caco-2 cells over this same time course (32) , as well as during the upward migration along the crypt axis of colonic epithelial cells in vivo (47) .
That down-regulation of ß-catenin-TCF signaling may play a role in inducing colonic epithelial cell differentiation is suggested, first, by the observation that the progressive differentiation of Caco-2 cells over time is accompanied by the simultaneous down-regulation of this pathway; and, second, the rapid down-regulation of ß-catenin-TCF signaling in undifferentiated Caco-2 cells by three independent mechanisms: ectopic expression of a dominant negative mutant form of TCF-4 (N-TCF-4), WT-APC, or E-cadherin, which resulted in consistent increases in the promoter activities of ALP and iFABP. Down-regulation of this pathway, however, had no effect on the promoter activities of the CEA or SI genes, suggesting that whereas down-regulation of the ß-catenin-TCF pathway results in the promotion of a more differentiated phenotype, the effect on cell differentiation is not complete. Pathways in addition to ß-catenin-TCF signaling, therefore, must be activated or down-regulated for the complete differentiation of colonic epithelial cells. This incomplete induction of cell differentiation subsequent to down-regulation of ß-catenin-TCF signaling is not surprising. We have demonstrated previously that the patterns of cell differentiation induced in Caco-2 cells by differentiation-inducing agents, such as sodium butyrate, differs from the pattern of cell differentiation induced during spontaneous Caco-2 cell differentiation (32)
. Furthermore, we have recently demonstrated by microarray analysis that the extent of gene reprogramming during Caco-2 cell differentiation is extensive and extremely complex (45)
, representing modulation of multiple pathways. It is likely, therefore, that the complete differentiation of colonic epithelial cells requires the interaction of multiple pathways, with the ß-catenin-TCF pathway only one component, albeit an important one, of the maturation program.
The mechanism by which down-regulation of ß-catenin-TCF signaling induces the promoter activities of ALP and iFABP requires additional investigation. Increased ß-catenin-TCF complex formation results in transcriptional activation, whereas in the present study we demonstrate increased transcriptional activation in response to down-regulation of the pathway. The effects observed, therefore, most likely reflect an indirect effect on ß-catenin-TCF signaling, requiring additional transcription factors. For example, down-regulation of ß-catenin-TCF signaling may result in the down-regulation of transcription factors whose normal role is to repress the expression of genes associated with the onset of cell differentiation. There is clear precedent for this hypothesis because it was recently shown that APC induces expression of the transcription factor CDX2 (48) , which has been shown to induce differentiation of the IEC-6 cell line (49) . Finally, the present findings that link down-regulation of ß-catenin-TCF signaling to the induction of absorptive cell differentiation is consistent with observations made in TCF-4-null mice. In these animals, down-regulation of the pathway by the targeted inactivation of TCF-4 results in the premature onset of differentiation. In comparison with controls, in which fully differentiated epithelial cells are observed primarily in the villus, fully differentiated cells were observed significantly earlier, in the intervillus region, in mutant mice (29) .
In conclusion, these observations suggest that, in addition to its role in regulating cell proliferation, the ß-catenin-TCF signaling pathway plays an additional role in regulating colonic epithelial cell differentiation.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by CA77552 and P13330 from the National Cancer Institute. J. M. M. was supported in part by a postdoctoral fellowship from the American Institute for Cancer Research. 
2 To whom requests for reprints should be addressed, at Department of Oncology, Montefiore Medical Center, Albert Einstein Cancer Center, 111 East 210th Street, Bronx, NY 10467. Phone: (718) 920-2093; Fax: (718) 882-4464; E-mail: john_mariadason{at}netzero.net
3 The abbreviations used are: APC, adenomotous polyposis coli; TCF, T cell factor; IP, immunoprecipitation; DAPI, 4',6-diamidino-2-phenylindole; IVTT, in vitro transcription and translation; ALP, alkaline phosphatase; iFABP, intestinal fatty acid binding protein; CEA, carcinoembryonic antigen; SI, sucrase isomaltase.
Received 11/ 1/00. Accepted 2/13/01.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
a T lymphocyte specific transcription factor containing a sequence-specific HMG box. EMBO J., 10: 123-132, 1991.[Medline]
This article has been cited by other articles:
|
|
 |
|
  S.-T. Chiu, K.-J. Chang, C.-H. Ting, H.-C. Shen, H. Li, and F.-J. Hsieh Over-expression of EphB3 enhances cell-cell contacts and suppresses tumor growth in HT-29 human colon cancer cells Carcinogenesis, September 1, 2009; 30(9): 1475 - 1486. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Vidrich, J. M. Buzan, B. Brodrick, C. Ilo, L. Bradley, K. S. Fendig, T. Sturgill, and S. M. Cohn Fibroblast growth factor receptor-3 regulates Paneth cell lineage allocation and accrual of epithelial stem cells during murine intestinal development Am J Physiol Gastrointest Liver Physiol, July 1, 2009; 297(1): G168 - G178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-J. Kim, S. Y. Yoon, J.-T. Kim, E. Y. Song, H. G. Lee, H. J. Son, S. Y. Kim, D. Cho, I. Choi, J. H. Kim, et al. NDRG2 expression decreases with tumor stages and regulates TCF/{beta}-catenin signaling in human colon carcinoma Carcinogenesis, April 1, 2009; 30(4): 598 - 605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Wilson, D.-S. Byun, S. Nasser, L. B. Murray, K. Ayyanar, D. Arango, M. Figueroa, A. Melnick, G. D. Kao, L. H. Augenlicht, et al. HDAC4 Promotes Growth of Colon Cancer Cells via Repression of p21 Mol. Biol. Cell, October 1, 2008; 19(10): 4062 - 4075. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Mason, S. McFarlane, P. G. Johnston, P. Crowe, P. J. Erwin, M. M. Domostoj, F. C. Campbell, S. Manaviazar, K. J. Hale, and M. El-Tanani Agelastatin A: a novel inhibitor of osteopontin-mediated adhesion, invasion, and colony formation Mol. Cancer Ther., March 1, 2008; 7(3): 548 - 558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Pannequin, N. Delaunay, C. Darido, T. Maurice, P. Crespy, M. A. Frohman, M. S. Balda, K. Matter, D. Joubert, J.-F. Bourgaux, et al. Phosphatidylethanol Accumulation Promotes Intestinal Hyperplasia by Inducing ZONAB-Mediated Cell Density Increase in Response to Chronic Ethanol Exposure Mol. Cancer Res., November 1, 2007; 5(11): 1147 - 1157. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, C.-H. Lee, D. D. Luo, A. Krupa, D. Fraser, and A. Phillips Polarity of Response to Transforming Growth Factor-beta1 in Proximal Tubular Epithelial Cells Is Regulated by beta-Catenin J. Biol. Chem., September 28, 2007; 282(39): 28639 - 28647. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Bastide, C. Darido, J. Pannequin, R. Kist, S. Robine, C. Marty-Double, F. Bibeau, G. Scherer, D. Joubert, F. Hollande, et al. Sox9 regulates cell proliferation and is required for Paneth cell differentiation in the intestinal epithelium J. Cell Biol., August 9, 2007; 178(4): 635 - 648. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Gumireddy, F. Sun, A. J. Klein-Szanto, J. M. Gibbins, P. A. Gimotty, A. J. Saunders, P. G. Schultz, and Q. Huang In vivo selection for metastasis promoting genes in the mouse PNAS, April 17, 2007; 104(16): 6696 - 6701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Larriba, N. Valle, H. G Palmer, P. Ordonez-Moran, S. Alvarez-Diaz, K.-F. Becker, C. Gamallo, A. G. de Herreros, J. M. Gonzalez-Sancho, and A. Munoz The inhibition of Wnt/{beta}-catenin signalling by 1{alpha},25-dihydroxyvitamin D3 is abrogated by Snail1 in human colon cancer cells Endocr. Relat. Cancer, March 1, 2007; 14(1): 141 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Wilson, D.-S. Byun, N. Popova, L. B. Murray, K. L'Italien, Y. Sowa, D. Arango, A. Velcich, L. H. Augenlicht, and J. M. Mariadason Histone Deacetylase 3 (HDAC3) and Other Class I HDACs Regulate Colon Cell Maturation and p21 Expression and Are Deregulated in Human Colon Cancer J. Biol. Chem., May 12, 2006; 281(19): 13548 - 13558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Peignon, S. Thenet, C. Schreider, S. Fouquet, A. Ribeiro, E. Dussaulx, J. Chambaz, P. Cardot, M. Pincon-Raymond, and J. Le Beyec E-cadherin-dependent Transcriptional Control of Apolipoprotein A-IV Gene Expression in Intestinal Epithelial Cells: A ROLE FOR THE HEPATIC NUCLEAR FACTOR 4 J. Biol. Chem., February 10, 2006; 281(6): 3560 - 3568. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yang, W. Yang, J. Mariadason, A. Velcich, M. Lipkin, and L. Augenlicht Dietary Components Modify Gene Expression: Implications for Carcinogenesis J. Nutr., November 1, 2005; 135(11): 2710 - 2714. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Yang, L. Bancroft, J. Liang, M. Zhuang, and L. H. Augenlicht p27kip1 in Intestinal Tumorigenesis and Chemoprevention in the Mouse Cancer Res., October 15, 2005; 65(20): 9363 - 9368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Yang, A. Velcich, I. Lozonschi, J. Liang, C. Nicholas, M. Zhuang, L. Bancroft, and L. H. Augenlicht Inactivation of p21WAF1/cip1 Enhances Intestinal Tumor Formation in Muc2-/- Mice Am. J. Pathol., April 1, 2005; 166(4): 1239 - 1246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Jay, P. Berta, and P. Blache Expression of the Carcinoembryonic Antigen Gene Is Inhibited by SOX9 in Human Colon Carcinoma Cells Cancer Res., March 15, 2005; 65(6): 2193 - 2198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yoshii, K. Mizuno, T. Hirose, A. Nakajima, H. Sekihara, and S. Ohno sPAR-3, a splicing variant of PAR-3, shows cellular localization and an expression pattern different from that of PAR-3 during enterocyte polarization Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G564 - G570. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chakrabarty, H. Wang, L. Canaff, G. N. Hendy, H. Appelman, and J. Varani Calcium Sensing Receptor in Human Colon Carcinoma: Interaction with Ca2+ and 1,25-Dihydroxyvitamin D3 Cancer Res., January 15, 2005; 65(2): 493 - 498. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Fujino, G. A. Vielhauer, and J. W. Regan Prostaglandin E2 Selectively Antagonizes Prostaglandin F2{alpha}-stimulated T-cell Factor/{beta}-Catenin Signaling Pathway by the FPB Prostanoid Receptor J. Biol. Chem., October 15, 2004; 279(42): 43386 - 43391. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Jette, P. W. Peterson, I. T. Sandoval, E. J. Manos, E. Hadley, C. M. Ireland, and D. A. Jones The Tumor Suppressor Adenomatous Polyposis Coli and Caudal Related Homeodomain Protein Regulate Expression of Retinol Dehydrogenase L J. Biol. Chem., August 13, 2004; 279(33): 34397 - 34405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Keller, T. Ezaki, R.-J. Guo, and J. P. Lynch Cdx1 or Cdx2 expression activates E-cadherin-mediated cell-cell adhesion and compaction in human COLO 205 cells Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G104 - G114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Yang, L. Bancroft, C. Nicholas, I. Lozonschi, and L. H. Augenlicht Targeted Inactivation of p27kip1 Is Sufficient for Large and Small Intestinal Tumorigenesis in the Mouse, Which Can Be Augmented by a Western-Style High-Risk Diet Cancer Res., August 15, 2003; 63(16): 4990 - 4996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. H. Augenlicht, A. Velcich, L. Klampfer, J. Huang, G. Corner, M. Aranes, C. Laboisse, B. Rigas, M. Lipkin, K. Yang, et al. Application of Gene Expression Profiling to Colon Cell Maturation, Transformation and Chemoprevention J. Nutr., July 1, 2003; 133(7): 2410S - 2416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Duchesne, S. Charland, C. Asselin, C. Nahmias, and N. Rivard Negative Regulation of beta -Catenin Signaling by Tyrosine Phosphatase SHP-1 in Intestinal Epithelial Cells J. Biol. Chem., April 11, 2003; 278(16): 14274 - 14283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. N. Verma, R. M. Surabhi, A. Schmaltieg, C. Becerra, and R. B. Gaynor Small Interfering RNAs Directed against {beta}-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells Clin. Cancer Res., April 1, 2003; 9(4): 1291 - 1300. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Fleet, L. Wang, O. Vitek, B. A. Craig, and H. J. Edenberg Gene expression profiling of Caco-2 BBe cells suggests a role for specific signaling pathways during intestinal differentiation Physiol Genomics, March 18, 2003; 13(1): 57 - 68. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chakrabarty, V. Radjendirane, H. Appelman, and J. Varani Extracellular Calcium and Calcium Sensing Receptor Function in Human Colon Carcinomas: Promotion of E-Cadherin Expression and Suppression of {beta}-Catenin/TCF Activation Cancer Res., January 1, 2003; 63(1): 67 - 71. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Genter, D. M. Burman, S. Vijayakumar, C. L. Ebert, and B. J. Aronow Genomic analysis of alachlor-induced oncogenesis in rat olfactory mucosa Physiol Genomics, December 26, 2002; 12(1): 35 - 45. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. H. Augenlicht, J. M. Mariadason, A. Wilson, D. Arango, W. Yang, B. G. Heerdt, and A. Velcich Short Chain Fatty Acids and Colon Cancer J. Nutr., December 1, 2002; 132(12): 3804S - 3808. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Mariadason, D. Arango, G. A. Corner, M. J. Aranes, K. A. Hotchkiss, W. Yang, and L. H. Augenlicht A Gene Expression Profile That Defines Colon Cell Maturation in Vitro Cancer Res., August 15, 2002; 62(16): 4791 - 4804. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Wolter and J. Stein Resveratrol Enhances the Differentiation Induced by Butyrate in Caco-2 Colon Cancer Cells J. Nutr., July 1, 2002; 132(7): 2082 - 2086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Brabletz, A. Jung, S. Reu, M. Porzner, F. Hlubek, L. A. Kunz-Schughart, R. Knuechel, and T. Kirchner Variable beta -catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment PNAS, August 28, 2001; 98(18): 10356 - 10361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Yang, A. Velcich, J. Mariadason, C. Nicholas, G. Corner, M. Houston, W. Edelmann, R. Kucherlapati, P. R. Holt, and L. H. Augenlicht p21WAF1/cip1 Is an Important Determinant of Intestinal Cell Response to Sulindac in Vitro and in Vivo Cancer Res., August 1, 2001; 61(16): 6297 - 6302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Rockman, S. A. Currie, M. Ciavarella, E. Vincan, C. Dow, R. J. S. Thomas, and W. A. Phillips Id2 Is a Target of the beta -Catenin/T Cell Factor Pathway in Colon Carcinoma J. Biol. Chem., November 21, 2001; 276(48): 45113 - 45119. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
