Cancer Research Cell Death Mechanisms and Cancer Therapy  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martin, M. D.
Right arrow Articles by O’Connell, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, M. D.
Right arrow Articles by O’Connell, P.
[Cancer Research 61, 3578-3580, May 1, 2001]
© 2001 American Association for Cancer Research


Advances in Brief

Loss of Heterozygosity Events Impeding Breast Cancer Metastasis Contain the MTA1 Gene1

Michelle D. Martin, Kathy Fischbach, C. Kent Osborne, Syed K. Mohsin, D. Craig Allred and Peter O’Connell2

Breast Center [M. D. M., C. K. O., S. K. M., D. C. A., P. O.], Departments of Molecular and Cellular Biology [M. D. M., P. O.], Medicine [C. K. O.], and Pathology [S. K. M., D. C. A.], Baylor College of Medicine, Houston, Texas 77030, and Department of Life Sciences, University of Texas at San Antonio, San Antonio, Texas 78249 [K. F.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Breast cancer mortality is seldom attributable to the primary tumor, but rather to the presence of systemic (metastatic) disease. Axillary lymph node dissection can identify the presence of metastatic breast cancer cells and serves as a marker for systemic disease. Previous work in our laboratory determined that rates of loss of heterozygosity (LOH) of a 1.6-Mb region of chromosome 14q 31.2 is much higher in axillary lymph node-negative primary breast tumors than in axillary lymph node-positive primary breast tumors (P. O’Connell et al., J. Natl. Cancer Inst., 91: 1391–1397, 1999.). This unusual observation suggests that, whereas the LOH of this region promotes primary breast cancer formation, some gene(s) mapping to this 1.6-Mb region is rate-limiting for breast cancer metastasis. Thus, if primary breast cancers delete this region, their ability to metastasize decreases. To identify this gene(s), we have physically mapped this area of chromosome 14q, confirmed the position of two known genes and 13 other expressed sequence tags into this 1.6-Mb region. One of these, the metastasis-associated 1 (MTA1) gene, previously identified as a metastasis-promoting gene (Y. Toh et al., J. Biol. Chem., 269: 22958–22963, 1994.), mapped to the center of our 1.6-Mb target region. Thus, MTA1 represents a strong candidate for this breast cancer metastasis-promoting gene.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
One of the strongest prognostic factors for cancer-free survival after treatment of the primary tumor is the presence or absence of local metastatic spread. For women with axillary lymph node-negative breast cancer, 90% survive more than 5 years after diagnosis. This is compared with a 70% 5-year survival for women with axillary lymph node-positive disease, and only a 20% 5-year survival for women with distant metastases (1) . The development of the metastatic phenotype of a tumor cell involves a complicated series of events that include detachment of tumor cells from the primary tumor, invasion into and survival in the circulatory and lymphatic systems, extravasation, and induction of angiogenesis and growth at the metastatic site. The development of a genetic test that could predict the metastatic potential of a primary breast tumor would increase the effectiveness of breast cancer treatment.

Previous work in our laboratory involved LOH3 analysis to compare DNA samples from paired normal and breast tumor tissues to examine whether specific genetic changes in primary breast cancer can serve as markers of metastatic potential (2) . As expected, increasing rates of LOH were correlated with progressively higher stages of breast cancer (3 , 4) . Unlike all other 14 markers tested, LOH at marker D14S62 was much lower in metastases than in primary breast tumors. D14S62 LOH proved to be associated with node-negative primary cancers and thus with slower spread to distant sites. Higher resolution LOH studies narrowed this phenomenon to a 1.6-Mb region near marker D14S62 (2) . Here we have assembled a physical map and identified a minimum tiling path of three YAC clones that span this region. One of the ESTs that mapped into this region in our study was MTA1, a gene previously shown to be highly expressed in both metastatic breast cancer cell lines and metastatic gastrointestinal carcinomas (5 , 6) .


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
YAC DNA Preparation and Mapping.
CEPH YACs were selected for mapping of MTA1 by screening with D14S62 region markers or on the basis of available mapping information.4 Total YAC DNA from each clone was purified as described previously (4) . Each YAC clone was confirmed by PCR analysis using oligonucleotide primers for MTA1 and selected ESTs mapping into the region on the basis of the radiation hybrid mapping of chromosome 14 (Gene Map 1999 and the GDB). The primers used were a MTA1-expressed sequence tag (RH78599) designed by the Sanger Center and based on known human genomic chromosome 14 sequence.5 The primer sequences were 5'GGTTCGGATTTGGCTTGTTA3', which is contained within a unique sequence of the MTA1 cDNA; and 5'CGTGGTTCTGGACAAGGG3', which is contained in the adjacent genomic sequence of MTA1. PCR was performed in a Gene Amp PCR system 9600 (Perkin-Elmer Corp., Norwalk, CT) using ~20 ng of YAC DNA in a volume of 50 µl in 30 cycles at 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. A 20-µl volume of each product was electrophoresed in a 1% agarose gel, and PCR products were visualized by ethidium bromide staining.

BAC DNA Preparation and Mapping Analysis.
BAC 76E12 was obtained from Research Genetics (Birmingham, AL). Total BAC DNA was purified according to the protocol supplied by the manufacturer. MTA1 was mapped to BAC 76E12 by PCR analysis using the same oligonucleotide primers for MTA1 as above. PCR was performed in a Gene Amp PCR system 9600 (Perkin-Elmer Corp.) using ~30 ng of BAC DNA in a volume of 50 µl in 30 cycles at 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. A 10-µl volume of each product was electrophoresed in a 1% agarose gel, and PCR products were visualized by ethidium bromide staining.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
As part of our preliminary mapping studies of the region, we determined all of the ESTs that mapped into the target region according to the radiation hybrid-based NCBI Gene Map. A total of 12 ESTs, but no known genes, map to this 1.6-Mb metastasis-related region. However, we performed additional mapping analysis on the YACs used in the preliminary mapping analysis and confirmed two known genes and 13 ESTs that actually map to these YACs, rather to than their location indicated by the radiation hybrid-based NCBI Gene Map. Because of these findings, we included the region from marker D14S1066 to the telomere of chromosome 14 because of uncertainties inherent in radiation hybrid mapping to insure that we had complete coverage of the telomeric end of chromosome 14q. Approximately 392 ESTs map into this region, with 63 of these being previously identified genes. Table 1Citation summarizes the known genes in the region from D14S1066 to the telomere (including MTA1) considered to be possible metastasis candidate genes.


View this table:
[in this window]
[in a new window]

 
Table 1 Possible candidate genes in the 14q region of interest

 
MTA1 had been mapped previously using radiation hybrids onto the NCBI Gene Map some distance away from our region of interest near the telomere of chromosome 14q. We had, however, discovered several ESTs thought to map elsewhere on chromosome 14 that were actually mapped to our target region. Because MTA1 represented a promising candidate gene even though the gene map showed it to be outside our target region, we then tested PCR primers for the MTA1 gene onto our physical map of the region detected by our LOH studies. We determined MTA1 mapped onto YACs 859d4 and 765h7 (Fig. 1)Citation . These mapping studies were subsequently confirmed when we mapped the gene onto BAC 76E12, which has a completed draft sequence that confirms its mapping onto YAC 859d4. The MTA1 gene was therefore determined to map onto chromosome 14q in the vicinity of markers D14S62 and D14S51, or ~21 cM proximal to its previously reported location (see Fig. 1Citation ). Fig. 2, A and BCitation , summarizes the gel-mapping data for MTA1. MTA1 was mapped onto the overlapping YAC clones 859d4 and 756h7. Fig. 2BCitation indicates that MTA1 also maps to BAC 76E12, and its location to this sequenced BAC clone is confirmed by a BLAST search with MTA1 cDNA sequences.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. YAC and BAC mapping of MTA1. A 1.6-Mb section of the region of interest was mapped, spanning from marker D14S265 to marker D14S51. The position of MTA1 is shown relative to other markers on chromosome 14q. MTA1 was determined to map onto both YAC 756h7 and YAC 859d4 and also to BAC 76E12.

 


View larger version (62K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Gel-mapping data on MTA1. A, PCR amplification of MTA1 primers on YAC clones spanning the metastasis gene target region (band shown in Lanes 1, 9, and 12). Positive control was provided with 25 ng of human genomic DNA shown in Lane 1. B, PCR amplification of MTA1 primers on BAC clone 76E12. Two positives are shown in Lanes 5 and 6 that represent two different preparations of the same BAC. Twenty-five ng of human genomic DNA was once again used as a positive control (Lane 3). Product size in both experiments was ~124 bp.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
MTA1 was previously identified as a metastasis-promoting gene overexpressed in both rat and human metastatic cell lines (5) . The human MTA1 gene was cloned and sequenced by Nawa et al. (7) in 2000. In 1994, the rat gene was cloned and sequenced by the same group (5) . The expression of MTA1 in the human breast cancer cell line MDA-MB-231, a metastatic cell line, was determined to be approximately four times higher than its expression levels in the breast cancer cell line MDA-MB-468, which is nonmetastatic (5) . The rat cell lines MTC.4, a benign line that remains phenotypically stable with prolonged passage, and the highly metastatic line MTLn3 were also tested for expression of mta1 (the rat homologue). The expression level of mta1 was found to be 4-fold higher in the MTLn3 line than in the MTC.4 line by Northern blotting (8) . Different forms of cancer have also been shown to overexpress MTA1. Esophageal, colorectal, gastric, and pancreatic carcinomas have all been reported previously to express higher levels of MTA1 mRNA than paired normal tissues, and this overexpression correlated with the invasiveness or lymph node metastasis of each of the carcinomas (6 , 9 , 10) .

Recently, MTA1 has also been shown to be associated with histone deacetylase activity. Xue et al. (11) found that MTA1 was identical to one subunit of the nucleosome remodeling and histone deacetylation complex. This complex contains both ATP-dependent chromatin-remodeling and histone deacetylase activities (12) . Interestingly, two homologues of MTA1 have also been discovered. Zhang et al. (13 , 14) reported that a protein similar to MTA1 was also a component of the nucleosome remodeling and histone deacetylation complex. This gene, since designated MTA1-L1, has been cloned and shows significant homology to MTA1 (15) . MTA1-L1 maps to chromosome 11 on the NCBI Gene Map. An even more distantly related MTA1 homologue, now referred to as MTA2, maps to chromosome 2 on the NCBI Gene Map. The MTA1 (and MTA1-L1) proteins are both nuclear proteins containing motifs associated with transcriptional corepressors, gene methylation, and signal transduction (11) . All of these observations fit well our model in which LOH of the MTA1 region impedes metastasis. However, because LOH events involve the loss of large segments or entire chromosomes, loss of additional MTA1-region genes (see Table 1Citation ) could influence the metastasis phenotype.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by CA58183 and CA30195 from the National Cancer Institute, NIH, Department of Human Services. Back

2 To whom requests for reprints should be addressed, at Breast Center, Baylor College of Medicine, One Baylor Plaza, MS600, Houston, Texas 77030. Phone: (713) 798-1631; Fax: (713) 798-1659; E-mail: poconnell{at}breastcenter.tmc.edu Back

3 The abbreviations used are: LOH, loss of heterozygosity; MTA1, metastasis-associated 1; EST, expressed sequence tags; NCBI, National Center for Biotechnology Information; GDB, Genome Database; YAC, yeast artificial chromosome; BAC, bacterial artificial chromosome. Back

4 For example, Internet address: http://www-genome.wi.mit.edu; http://www.gdb.org. Back

5 Internet address: http://www.sanger.ac.uk. Back

Received 1/25/01. Accepted 3/14/01.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. National Cancer Institute. SEER Cancer Statistics Review, 1973–1991. NIH Publ. No. 94-2789 NIH Bethesda, MD 1994.
  2. O’Connell P., Hilsenbeck S., Mohsin S., Fuqua S., Clark G., Osborne C., Allred D. C. Loss of heterozygosity at D14S62 and metastatic potential of breast cancer. J. Natl. Cancer Inst., 91: 1391-1397, 1999.[Abstract/Free Full Text]
  3. O’Connell P., Pekkel V., Fuqua S., Osborne C. K., Allred D. C. Molecular genetic studies of early breast cancer evolution. Breast Cancer Res. Treat., 32: 5-12, 1994.[Medline]
  4. O’Connell P., Pekkel V., Fuqua S. A., Osborne C. K., Clark G. M., Allred D. C. Analysis of loss of heterozygosity in 399 premalignant breast lesions at 15 genetic loci. J. Natl. Cancer Inst., 90: 697-703, 1998.[Abstract/Free Full Text]
  5. Toh Y., Pencil S. D., Nicolson G. L. A novel candidate metastasis-associated gene, mta1, differentially expressed in highly metastatic mammary adenocarcinoma cell lines. cDNA cloning, expression, and protein analyses. J. Biol. Chem., 269: 22958-22963, 1994.[Abstract/Free Full Text]
  6. Toh Y., Oki E., Oda S., Tokunaga E., Ohno S., Maehara Y., Nicolson G. L., Sugimachi K. Overexpression of the MTA1 gene in gastrointestinal carcinomas: correlation with invasion and metastasis. Int. J. Cancer, 74: 459-463, 1997.[Medline]
  7. Nawa A., Nishimori K., Lin P., Maki Y., Moue K., Sawada H., Toh Y., Fumitaka K., Nicolson G. Tumor metastasis-associated human MTA1 gene: its deduced protein sequence, localization, and association with breast cancer cell proliferation using antisense phosphorothioate oligonucleotides. J. Cell. Biochem., 79: 202-212, 2000.[Medline]
  8. Toh Y., Pencil S. D., Nicolson G. L. Analysis of the complete sequence of the novel metastasis-associated candidate gene, mta1, differentially expressed in mammary adenocarcinoma and breast cancer cell lines. Gene, 159: 97-104, 1995.[Medline]
  9. Iguchi H., Imura G., Toh Y., Ogata Y. Expression of MTA1, a metastasis-associated gene with histone deacetylase activity in pancreatic cancer. Int. J. Oncol., 16: 1211-1214, 2000.[Medline]
  10. Toh Y., Kuwano H., Mori M., Nicolson G. L., Sugimachi K. Overexpression of metastasis-associated MTA1 mRNA in invasive oesophageal carcinomas. Br. J. Cancer, 79: 1723-1726, 1999.[Medline]
  11. Xue Y., Wong J., Moreno G. T., Young M. K., Cote J., Wang W. NURD, a novel complex with both ATP-dependent chromatin-remodeling and histone deacetylase activities. Mol. Cell, 2: 851-861, 1998.[Medline]
  12. Toh Y., Kuninaka S., Endo K., Oshiro T., Ikeda Y., Nakashima H., Baba H., Kohnoe S., Okamura T., Nicolson G. L., Sugimachi K. Molecular analysis of a candidate metastasis-associated gene, MTA1: possible interaction with histone deacetylase 1. J. Exp. Clin. Cancer Res., 19: 105-111, 2000.[Medline]
  13. Zhang Y., LeRoy G., Seelig H. P., Lane W. S., Reinberg D. The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities. Cell, 95: 279-289, 1998.[Medline]
  14. Zhang Y., Ng H. H., Erdjument-Bromage H., Tempst P., Bird A., Reinberg D. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation. Genes Dev., 13: 1924-1935, 1999.[Abstract/Free Full Text]
  15. Futamura M., Nishimori H., Shiratsuchi T., Saji S., Nakamura Y., Tokino T. Molecular cloning, mapping, and characterization of a novel human gene, MTA1–L1, showing homology to a metastasis-associated gene, MTA1. J. Hum. Genet., 44: 52-56, 1999.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martin, M. D.
Right arrow Articles by O’Connell, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, M. D.
Right arrow Articles by O’Connell, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online