Cancer Research Audrey Hepburn  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karanikas, V.
Right arrow Articles by Coulie, P. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karanikas, V.
Right arrow Articles by Coulie, P. G.
[Cancer Research 61, 3718-3724, May 1, 2001]
© 2001 American Association for Cancer Research


Immunology

High Frequency of Cytolytic T Lymphocytes Directed against a Tumor-specific Mutated Antigen Detectable with HLA Tetramers in the Blood of a Lung Carcinoma Patient with Long Survival1

Vaios Karanikas, Didier Colau, Jean-François Baurain, Rita Chiari2, Joëlle Thonnard3, Ilse Gutierrez-Roelens, Céline Goffinet, Emile Van Schaftingen, Patrick Weynants, Thierry Boon and Pierre G. Coulie4

Cellular Genetics Unit [V.K., J-F.B, R.C., J.T., I.G-R., C.G., T.B., P.G.C.], and Biochemistry Unit [E.V.S.], Université de Louvain, B-1200 Brussels; Ludwig Institute for Cancer Research, Brussels Branch, B-1200 Brussels [D.C., P.W., T.B.]; and Service de Pneumologie et d’Anatomopathologie, Hôpital de Mont-Godinne, Université de Louvain, B-5530 Yvoir [P.W.], Belgium


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have identified an antigen recognized by autologous CTL on the lung carcinoma cells of a patient who enjoyed a favorable clinical evolution, being alive 10 years after partial resection of the primary tumor. The antigenic peptide is presented by HLA-A2 molecules and encoded by a mutated sequence in the gene coding for malic enzyme, an essential enzyme that converts malate to pyruvate. In the tumor cell line derived from the patient, only the mutated malic enzyme allele is expressed, because of a loss of heterozygosity in the region of chromosome 6 that contains this locus. Tetramers of soluble HLA-A2 molecules loaded with the antigenic peptide stained ~0.4% of the patient’s blood CD8 T cells. When these cells were stimulated in clonal conditions, 25% of them proliferated, and the resulting clones were lytic and specific for the mutated malic enzyme peptide. T-cell receptor analysis indicated that almost all of these antimalic CTLs shared the same receptor. Antimalic T cells were consistently found in blood samples collected from the patient between 1990 and 1999, at frequencies ranging from 0.1 to 0.4% of the CD8 cells. Their frequency appeared to double within 2 weeks after intradermal inoculation of lethally irradiated autologous tumor cells. These results indicate that nonmelanoma cancer patients may also have a high frequency of blood CTLs directed against a tumor-specific antigen.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Over the last decade, efforts to characterize antigens that are specifically recognized on human tumors by autologous T lymphocytes led to the identification of a large number of genes that code for such antigens (1) . These genes fall into five main groups: cancer-germ-line genes, which are expressed in tumors and not in normal cells except for male germ-line cells, which do not carry HLA molecules and, therefore, cannot present antigens to T cells; differentiation genes such as those that are expressed only in melanocytes and melanomas; genes that are mutated or overexpressed in tumor cells as compared with normal cells; and, finally, genes encoded by oncogenic viruses (1) .

Antigens that are encoded by cancer-germ-line genes such as the MAGE-A genes ought to be absolutely tumor-specific and could be used safely to vaccinate cancer patients. In a clinical trial involving immunization with the MAGE-3.A1 peptide, encoded by gene MAGE-3 and presented by HLA-A1, 25 melanoma patients with measurable tumors received three monthly injections of peptide, without adjuvant (2 , 3) . Seven patients showed tumor regressions, three of which were complete. Partial tumor regressions were also observed in other trials, involving injections of dendritic cells incubated with MAGE-1 and MAGE-3 peptides presented by HLA-A1 or HLA-A2 (4 , 5) . These results suggest that therapeutic vaccination with tumor-specific antigens may be effective, although the majority of patients fail to respond. One of the several causes that could explain the low proportion of clinical responses is a poor ability of the vaccine to stimulate a specific T-cell response. Somewhat surprisingly, we could not detect peptide-specific T cells in the blood of the HLA-A1 patients who received the MAGE-3.A1 peptide, even in those patients who showed tumor regression (2) . This could result either from a low immunogenicity of the vaccine or from the fact that such responses are not to be expected. For instance, CTLs that are truly tumor specific may not circulate in the blood, or those that are in the blood may be anergic and remain undetected after in vitro restimulation.

To obtain quantitative information on circulating tumor-specific CTLs, we resorted to the analysis of a few cancer patients who enjoyed unusually favorable clinical evolutions. One such patient is melanoma patient LB33, who is alive 12 years after the first appearance of metastases (6) . One of the several antigens recognized by autologous CTLs on LB33 melanoma cells is presented by HLA-A28 molecules and encoded by a mutated sequence in gene MUM-3 (7) . We showed with limiting dilution analysis and with tetramers that ~1% of blood CD8 cells of the patient were MUM-3-specific, and that these cells were responsive to restimulation in vitro. These results suggested that a strong CTL response, detectable in the blood with tetramers, was an achievable goal for therapeutic vaccination.

Admittedly, the case of patient LB33 could be a rare exception to the absence of CTLs directed against tumor-specific antigens in the blood. However, we report here a similar observation with a lung carcinoma patient. Patient LB37 presented in 1990 with a squamous-cell carcinoma of the lung that invaded the mediastinum and could be resected only partially. A cell line, LC-5, was derived from the tumor. The patient received adjuvant chemotherapy, and a complete tumor response was obtained. Subsequent to 1990, he was vaccinated with lethally irradiated autologous tumor cells. In 1993, enlarged mediastinal lymph nodes were shown to be invaded by tumor cells. The patient was treated with radiotherapy and then again with autologous vaccines. Remarkably, he has been without evidence of cancer for the last 7 years. We described previously the derivation of tumor-specific CTL clones from blood lymphocytes of this patient (8) . Here we report on the identification of the antigen that is recognized by these CTLs, and we show that it is recognized by a high frequency of blood CD8 T cells.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patient LB37.
Patient LB37 (HLA-A2, A26, B8, B51, Cw2, Cw7), a 55-year old man, presented in January 1990 with a squamous cell carcinoma of the lung. Thoracotomy showed a T2N2 tumor, which could be partially resected. The patient received two courses of cisplatin, vindesin, and mitomycin C as an adjuvant chemotherapy, and a complete response was obtained. From October 1990 on, the patient was vaccinated with intradermal inoculations of lethally irradiated autologous tumor cells, namely LC-5 cells and five clones derived from a population of LC-5 cells that survived a mutagen treatment with N-methyl-N'-nitro-nitrosoguanidine (MNNG). In May 1993, computed tomography indicated the presence of enlarged mediastinal lymph nodes, one of which was biopsied through mediastinoscopy and proved to have been invaded by squamous carcinoma cells. The patient was treated with radiotherapy (60 Gy). He has had no evidence of disease since then (Fig. 5)Citation . From 1994 onwards, the autologous vaccinations have been composed of irradiated LC-5 cells and irradiated autologous tumor cell clones selected from populations of cells transfected with granulocyte macrophage-colony stimulating factor and B7–1 constructs.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Clinical evolution of patient LB37. In 1990, the primary tumor was partially resected, and the patient was treated with chemotherapy (C). In 1993, the mediastinal metastasis was treated with radiotherapy (R). The patient was repeatedly vaccinated with intradermal inoculations of irradiated autologous tumor cells, either LC-5 cells alone ({blacktriangleup}) or a mixture of LC-5, of cells transfected with a GM-CSF cDNA, and of cells transfected with a B7–1 construct ({triangleup}). The proportions of CD8 cells labeled with tetramers containing the mutated malic enzyme peptide are indicated for blood samples collected between 1990 and 1999. The indicated CTL clones, all of them recognizing the same mutated malic enzyme peptide, were derived either from classical autologous mixed lymphocyte tumor cell cultures (MLTC) or from single tetramer-positive blood CD8 cells, sorted with a flow cytometer, and amplified with PHA and growth factors. These CTL clones expressed one of two TCRs: (Vß4) or (Vß5).

 
Cells.
Tumor cell line LB37-NSCLC-5 (LC-5) was derived as described previously (8) and maintained in Iscove’s medium (Life Technologies, Inc., Grand Island, NY), supplemented with 10% FCS (Life Technologies, Inc.) and AAG [L-arginine (116 mg/liter), L-asparagine (36 mg/liter), and L-glutamine (216 mg/liter)]. Autologous or allogeneic EBV-transformed B cells were maintained in Iscove’s medium (Life Technologies, Inc.) with 10% FCS and AAG. 293-EBNA cells, and P815 mastocytoma cells transfected with an HLA-A2 construct were cultured in DMEM (Life Technologies, Inc.) with 10% FCS. The TNF5 -sensitive WEHI-164c13 cells were cultured in RPMI 1640 (Life Technologies, Inc.) with 5% FCS (9) . The derivation and culture of CTL clones 110 and 1/7 were described previously (8) .

Construction and Screening of the cDNA Library.
Total RNA was extracted from LC-5 cells using the guanidine-isothiocyanate procedure (10) . Polyadenylated RNA was enriched with an oligo(dT)-cellulose column (mRNA Purification kit, Pharmacia Biotech, Uppsala, Sweden) and converted to cDNA with the Superscript Choice System (Life Technologies, Inc., Gaithersburg, MD) using an oligo(dT) primer [5'-ATAAGAATGCGGCCGCTAAACTA(T)18VZ with V = G or A or C and Z = G or A or T or C] containing a NotI site. The cDNA was ligated to HindIII-EcoRI adaptors (Stratagene, Heidelberg, Germany), phosphorylated, digested with NotI, and inserted into the HindIII and NotI sites of expression vector pCEP4 (Invitrogen, San Diego, CA). Escherichia coli DH5{alpha} were transformed by electroporation with the recombinant plasmids and selected with ampicillin (50 µg/ml). The library was divided into 1900 pools of 80–100 cDNA clones. Each pool was amplified for 4 h, and plasmid DNA was extracted using the QIAprep 8 plasmid kit (Qiagen, Hilden, Germany). Duplicate microcultures of 293-EBNA cells, plated in flat-bottomed 96 microwells (3–4 x 104/well) 24 h before transfection, were cotransfected with 1.5 µl of Lipofectamine (Life Technologies, Inc.), 100–200 ng of DNA from a pool of the cDNA library and 50 ng of plasmid pcDNA1/Amp containing a HLA-A*0201 genomic clone. Transfected cells were tested after 24 h for expression of the antigen in a CTL stimulation assay. Briefly, CTL clone 1/7 was added, and the TNF content of the supernatant was measured 24 h later by testing its cytotoxic effect on WEHI-164cl3 cells (9) with a MTT colorimetric assay (11) . One pool of cDNA proved positive. It was subcloned, and cDNA clone 94 was found to transfer the expression of the antigen. cDNA 94 was 1867 bp long and contained at its 3' end a polyadenylation signal and a polyadenylate tail.

Sequence Analysis.
To demonstrate that the malic enzyme gene of the tumor cells contained a point mutation, RNA extracted from LC-5 and from LB37-EBV-B cells was converted to cDNA using an oligo(dT) primer. The cDNA served as templates for four independent PCR amplifications with primers OPC602 (5'-TGCGGAGGGATGAATCCTC) and OPC586 (5'-GTGTTAAGGAAGCACGTCC). The PCR products were pooled and cloned into vector pCR3 with the Eukaryotic TA Cloning kit (Invitrogen). Six clones from the tumor cells and five clones from the EBV-B cells were sequenced with the BigDye Terminator Cycle Sequencing kit (Perkin-Elmer Applied Biosystems, Warrington, Great Britain), using primer OPC602. Products of the sequencing reactions were analyzed on an ABI 310 Sequencer (Perkin-Elmer). To prove that the mutation was present in the tumor cells in vivo, RNA was extracted from tumoral tissue obtained through a mediastinoscopy performed in 1993 for an enlarged mediastinal lymph node, and was converted to cDNA. Three independent PCR products, obtained with primers OPC632 (5'-GAAAATGAGGAGTTACTTAAAGATCCAC) and OPC633 (5'-ATCATTGAATGTGCAATACTGGTTTCG), were pooled and cloned in pCR3 as above. Seven independent clones were sequenced, and all of them corresponded to the mutated gene. Reverse-transcribed RNA from lung tumor samples was converted to cDNA and amplified by PCR, and the products were sequenced.

For the microsatellite analysis, genomic DNA was extracted from LC-5 and from autologous blood lymphocytes using the Qiagen genomic DNA purification kit. PCR amplification was performed on 20 ng of DNA using pairs of primers specific for microsatellites of chromosome 6. The forward primer was labeled with 32P and conditions for PCR amplification were 95°C for 4 min; 94°C for 40 s, 55°C for 50 s, and 72°C for 50 s for 30 cycles; and 72°C for 10 min. The PCR products were separated on a 6.5% acrylamide-bisacrylamide gel and revealed by autoradiography on Biomax film (Kodak, Eastman, NY).

Malic enzyme activity was assayed at 30°C through the changes in A340. The reaction mixture contained 1 mM L-malate, 0.25 mM NADP+, 5 mM MgCl2, 50 mM KCl, 5 mM KF, and 25 mM HEPES (pH 7.1).

Peptides.
Peptides were synthesized on solid phase using F-moc for transient NH2-terminal protection as described previously (12) and were characterized by mass spectrometry. All of the peptides were >80% pure, as determined by analytical high-performance liquid chromatography. Lyophilized peptides were dissolved at 10 mg/ml in DMSO, aliquoted, and frozen at -20°C. Binding of wild-type and mutated malic enzyme peptides was tested with a competition assay, essentially as described previously (13) . Briefly, 1.5 x 105 T2 cells were incubated for 2.5 h with 70 nM of the fluorescent reference peptide (FLPSDC(FITC)FPSV) and varying concentrations of competitor malic enzyme peptides in serum-free PBS. Cells were then washed, fixed with paraformaldehyde, and analyzed by flow cytometry.

Tetramer Analysis.
An HLA-A*0201 cDNA clone was used as a template to amplify the sequence coding for the extracellular domains (amino acids 1–276 of the mature protein) of the HLA-A*0201 heavy chain with primers A1M8 (5'-AAGAAGGAGATATACCATGGGtTCaCACagtATGcgcTATTTtTttACATCCGTGTCCCGG) and A2b (5'-ATGATGCAGGGATCCTTCGAAGATGTCGTTCAGACCACCACCCGGCTCCCATCTCAGGGTG). A1M8 contains several base changes (small letters) designed to optimize protein expression in E. coli BL21(DE3)pLysS. The PCR product was digested with NcoI and SfuI and was cloned into a vector derived from pET3D (Stratagene) and containing a BirA biotinylation site in frame with the 3' end of the HLA sequence. Recombinant HLA-A*0201 molecules were folded in vitro with ß2-microglobulin (pHN1-ß2m; kindly provided by P. Moss, Oxford University, Oxford, England) and peptides FLDEFMEGV or FLDEFMEAV, as described previously (14) . Soluble complexes, purified by gel filtration, were biotinylated using the BirA enzyme (Avidity LCC, Denver, CO). PE- or APC-labeled tetramers were produced by mixing the biotinylated complexes with Extravidin-PE (Sigma Chemical Co., St. Louis, MO), or streptavidin-APC (Molecular Probes, Eugene, OR). Tetramer staining was performed as follows. PBMCs (1–5 x 106) were thawed, resuspended at about 107 cells/ml in X-Vivo10 medium (Life Technologies, Inc., Grand Island, NY) containing a titrated amount of malic enzyme peptide/HLA-A2 tetramers (100–400 nM of HLA molecules), and incubated for 15 min at 4°C. We observed no difference in the staining specificity of this tetramer whether the incubation took place at 4°C or at ambient temperature, and for some experiments the tetramer staining was performed at ambient temperature. Then, anti-CD8, coupled to PerCP, was added for a further 15 min at 4°C. Cells were washed, fixed with paraformaldehyde, and analyzed by flow cytometry. For the cloning experiments, labeled cells were washed and seeded at 1 cell/well in round-bottomed microplates using a FACS-VANTAGE (Becton Dickinson). The lymphocytes were restimulated by the addition of 125 ng/ml PHA-HA16 (Murex Biotech, Temple Hill Dartford, Kent, England), 100 units/ml IL-2, 5 ng/ml IL-4, 5 ng/ml IL-7 (Genzyme, Cambridge, MA), and a mixture of irradiated feeder cells consisting of allogeneic PBMCs (8 x 104/well) and LG2-EBV-B cells (2 x 104/well). For some experiments, IL-6 (100 units/ml) was used instead of IL-7, with no difference in cloning efficiency. On day 12, populations of cells were transferred into 2-ml wells and restimulated as above, but with a 10-fold higher number of feeder cells. Clones were maintained with weekly restimulations. Phenotypic analysis of PBMCs was performed using the following monoclonal antibodies conjugated to either FITC, PE, or PerCP: Leu2a (anti-CD8; PerCP; Becton Dickinson); and HI100 (anti-CD45RA; PE; PharMingen). Cells were washed, stained with tetramers for 15 min at ambient temperature and for an additional 15 min with antibodies at 4°C, washed, and fixed with paraformaldehyde. Isotype-matched antibodies and HLA-A2 tetramers with irrelevant peptides were used to verify the staining specificity, and as a guide for setting the markers to delineate positive and negative populations.

TCR V{alpha} and Vß usage of the CTL clones was assessed by reverse transciption-PCR and sequencing. cDNA served as a template for a PCR amplification using panels of V{alpha}- or Vß-specific forward primers and one reverse C{alpha} or Cß primer.6 The PCR products were purified and sequenced.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A Malic Enzyme cDNA Coding for an Antigen Recognized by CTL Clones on Autologous NSCLC Cells.
CTL clones 110 and 1/7 were derived from blood lymphocytes collected from patient LB37 in 1994 and 1995, respectively, and stimulated with the autologous NSCLC clonal line LC-5 (8) . Both clones lysed the tumor cells but did not lyse autologous PHA-activated T lymphocytes, autologous fibroblasts, or K562 cells (Fig. 1A)Citation . An anti-HLA-A2 monoclonal antibody inhibited the recognition of LC-5 cells by the two CTLs. CTL clone 1/7 lysed autologous EBV-transformed B cells, whereas CTL 110 did not. This suggested that the two CTLs recognized distinct antigens.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Characterization of antitumor CTL clones derived from NSCLC patient LB37 and identification of their target antigen. A, lytic activity of the CTL clones. Target cells included LC-5, a clonal line of the autologous lung tumor cells, autologous EBV-transformed B cells (EBV-B), autologous T lymphocytes activated with PHA and IL-2 (PHA-T), autologous fibroblasts (Fibro), and natural killer target cells K562. B, stimulation of CTL clones 1/7 and 110 by 293-EBNA cells cotransfected with expression vector pcDNA1/Amp containing an HLA-A*0201 genomic clone and with vector pCEP4 containing cDNA 94. Control stimulator cells included LC-5 cells and 293-EBNA cells transfected with the HLA-A2 or cDNA 94 construct alone.

 
We identified a cDNA clone, named 94, encoding the antigen recognized by CTL 1/7 by screening for CTL recognition cells transfected with a cDNA library derived from LC-5 cells and with an HLA-A2 construct. cDNA 94, which could also transfer the expression of the antigen recognized by CTL clone 110 (Fig. 1B)Citation , corresponded to the gene encoding the cytoplasmic form of malic enzyme. This ubiquitous enzyme catalyzes the oxidative decarboxylation of malate to pyruvate with concomitant reduction of NADP+ to NADPH. cDNA 94 contained an open reading frame corresponding to residues 70–572 of malic enzyme, which contains 572 amino acids.

Presence of a Point Mutation in the cDNA.
The malic enzyme sequence encoded by cDNA 94 matched exactly those present in data banks (HSU43944, L34035, and X77244) except for one amino acid. A cytosine to guanine substitution, at position 485 of cDNA 94, modifies the alanine residue (GCA), present at position 231 in recorded sequences, into glycine (GGA). To demonstrate that this difference is specific to the tumor, cDNA was prepared from LC-5 cells or from autologous EBV-B cells, and a fragment corresponding to nucleotides 331–838 of cDNA 94 was amplified by PCR, cloned, and sequenced. Six clones derived from the tumor cells were identical to cDNA 94, with G at position 485, whereas 5 clones derived from the EBV-B cells contained C at that position. These results indicated that the malic enzyme gene was mutated in the LC-5 tumor cells. The C-to-G mutation was also found in cDNA prepared from a biopsy of the mediastinal metastasis detected in 1993, indicating that the mutation occurred in vivo. Malic enzyme cDNA fragments corresponding to nucleotides 400–600 of cDNA 94 were produced from lung tumor samples of 11 patients, and sequenced. No mutation was found.

BLAST searches indicated that the alanine residue that is mutated in LC-5 cells is conserved among malic enzymes whether from eukaryotic or prokaryotic origin. To determine whether or not the mutation affects malic enzyme activity, we assayed this enzyme in extracts of LC-5 cells. An activity of 1.10 nmol/min/mg protein was observed, as compared with 0.78 nmol/min/mg protein in extracts of 293-EBNA cells. This indicates that LC-5 cells are not deficient in their ability to convert malate to pyruvate.

Loss of Heterozygosity for a Region of Chromosome 6 in the LB37 Tumor Cells.
Because all of the malic enzyme cDNA sequences derived from LC-5 cells contained the mutation, we suspected that the normal gene was either deleted or not expressed in the tumor. We analyzed microsatellite markers surrounding the malic enzyme locus, in 6q12, in DNA extracted from LC-5 and from autologous EBV-B cells. Loss of heterozygosity was observed in LC-5 cells for several markers on the long arm of chromosome 6 but not for markers in the 6p region (Fig. 2)Citation . We conclude that, in the LC-5 tumor cells, the normal copy of the malic enzyme gene is lost because of a deletion that appears to involve most of the long arm of chromosome 6.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Map of chromosome 6 and results of microsatellite analysis on DNA extracted from LC-5 cells. For all of the indicated markers, heterozygosity was found in DNA extracted from EBV-transformed B cells of patient LB37. On DNA from LC-5 cells, either heterozygosity (H) or loss of heterozygosity (LOH) was found.

 
Identification of the Antigenic Peptide.
The mutated glycine residue is part of a nine amino acid peptide, FLDEFMEGV, which contains the HLA-A2 binding motif: leucine or methionine in position 2, and leucine or valine in position 9. This peptide was used to sensitize autologous EBV-B cells to lysis by CTL clone 110. It was recognized with a half-maximal effect at 0.2 nM (Fig. 3A)Citation . Peptides with shorter or longer NH2 or COOH termini were recognized less efficiently, which suggested that FLDEFMEGV was the optimal antigenic peptide. The normal peptide, with alanine instead of glycine at position 8, was not recognized, even at 10 µM. Competition assays indicated that the normal and mutated peptides bound to HLA-A2 molecules with similar affinities, which indicated that the glycine residue is part of the epitope recognized by CTL 110.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Recognition of the antigenic peptide. A, lysis by CTL clone 110 of autologous EBV-transformed B cells incubated with malic enzyme peptides. 51Cr-labeled EBV-B cells from patient LB37 were incubated for 20 min at room temperature with the indicated concentrations of peptides. CTL 110 was added at an E:T ratio of 10, and chromium release was measured after 4 h at 37°C. The arrow in the list of peptides indicates the position of the mutated residue. B, recognition of mutated and normal malic enzyme peptides by CTL clones 110 and 1/7. For the lysis assay (top panels), 51Cr-labeled P815 mastocytoma cells, transfected with an HLA-A2 construct, were incubated for 20 min at room temperature with the indicated concentrations of peptides. CTLs were added at an E:T ratio of 10, and lysis was measured after 4 h. For the stimulation of TNF production (bottom panels), P815-A2 cells (20,000 cells/well) were incubated for 10 min at room temperature with the peptides before addition of the CTLs (2,000 cells/well). After 24 h, the amount of TNF produced by the CTLs was measured by testing the killing activity of the culture supernatant on the TNF-sensitive WEHI-164c13 cells.

 
Because CTL clone 1/7 lysed autologous EBV-B cells (Fig. 1A)Citation , the latter cells could not be used to present the antigenic peptides to this CTL. We resorted to P815 cells transfected with an HLA-A2 gene. CTL 1/7 lysed P815-A2 that was sensitized with the mutated malic peptide, with a half-maximal effect at 1 nM (Fig. 3B)Citation . Similar results were obtained with CTL 110. But contrary to CTL 110, CTL 1/7 recognized the normal peptide, although half-maximal lysis required 100 nM peptide. This recognition of the normal peptide was confirmed when CTL 1/7 was stimulated to produce TNF by P815-A2 cells incubated with peptides. In this assay, the mutated peptide was 300-fold more efficient than the normal peptide.

We conclude that CTL 1/7 and 110 recognize the same mutated peptide from malic enzyme, but that CTL 1/7 recognizes the normal peptide also, although with a much lower affinity.

Staining Antimalic T Cells with Soluble HLA/Peptide Complexes.
Soluble HLA-A2/peptide complexes were prepared with the mutated or the wild-type malic enzyme peptide, biotinylated, and multimerized with avidin conjugated to PE. CTL 110 was labeled with the "tetramer" containing the mutated malic peptide, but only weakly with that containing the normal peptide (Fig. 4A)Citation . CTL 1/7 was labeled with both tetramers, but the labeling was stronger with the tetramer containing the mutated peptide. These results are in agreement with the pattern of recognition of the mutated and normal peptides by the CTL clones (Fig. 3B)Citation .



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Labeling antimalic T lymphocytes with tetramers. A, CTL clones 110 and 1/7 were incubated alone or with PE-labeled HLA-A2 tetramers containing the mutated (FLDEFMEGV) or wild-type (FLDEFMEAV) peptide from malic enzyme, or the MAGE-A3 peptide FLWGPRALV. B, blood mononuclear cells collected from patient LB37 in 1998 were incubated with PE-tetramers containing the mutated malic peptide and with an anti-CD8 antibody coupled to PerCP, washed, and sorted by flow cytometry. The labeling by anti-CD8 antibodies and tetramers (right panel) was analyzed on lymphocytes, selected on the basis of their light-scattering properties (left panel).

 
Blood mononuclear cells collected from patient LB37 in October 1998 were labeled with an anti-CD8 antibody and tetramers containing the mutated peptide. Approximately 0.4% of CD8 T cells were stained (Fig. 4B)Citation . To assess the specificity of this staining, the tetramer-positive cells were seeded at 1 cell/well and stimulated with PHA, IL-2, IL-4, IL-7, and feeder cells. After 3 weeks, populations of lymphocytes were present in 26% of the 160 wells in which the presence of a sorted cell had been confirmed visually 2 h after the cloning. These populations proved to be antimalic CTL clones: all of the cells were labeled with the tetramer containing the mutated malic enzyme peptide and with tetramers containing the normal peptide, albeit with a lower intensity. This pattern of labeling corresponded to that of CTL clone 1/7. All of the clones displayed a pattern of lysis that was also similar to that of clone 1/7, namely a strong lysis of LC-5 cells and a weaker lysis of autologous EBV-B cells. We conclude that the blood of patient LB37 contained a high frequency of antimalic CD8 T cells, which appeared functional in so far as they proliferated after an in vitro stimulation.

Analysis of the Antimalic T-cell Response of Patient LB37.
We followed the frequency of CD8 cells labeled with the mutated malic tetramer in blood samples collected from patient LB37 between 1990 and 1999 (Fig. 5)Citation . These cells could be detected in all of the samples that were tested, at a frequency of 0.1–0.4% of the CD8 cells.

From November 1990 on, patient LB37 received injections of irradiated autologous tumor cells. We analyzed samples collected in October 1998 and in September 1999 on the day of a vaccine (3.5 and 4 months after the previous injection, respectively) and during the subsequent weeks (Fig. 5)Citation . The frequency of antimalic CD8 cells appeared to increase 2- to 3-fold within 1 or 2 weeks after the injections, and to return to base level (~0.4%) within 2 months. During the same period of time, the frequency of CD8 cells labeled with an HLA-A2 tetramer containing an antigenic peptide encoded by BMLF1, an early cytolytic gene of EBV, did not increase significantly. This suggests that the increases in the frequency of antimalic T cells did not result from a nonspecific immunostimulation.

Before the injection of autologous tumor cells, 26% of the tetramer-positive cells were CD45RA- (Fig. 6)Citation . Two weeks after the vaccine was given, this proportion was 49%. No significant change was observed for the CD8 cells labeled with the tetramer containing the BMLF1.A2 peptide, most of which were CD45RA-. These results are consistent with the hypothesis that the autologous vaccine restimulated some of the antimalic T cells, which proliferated and lost the expression of the CD45RA marker.



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Phenotypic analysis of antimalic CD8 T cells before and after vaccination with irradiated autologous tumor cells. PBMCs collected before and after vaccination in October 1998 were stained with the indicated APC-tetramers for 15 min at ambient temperature and with CD8-PerCP and CD45RA-PE for 15 min at 4°C, before being washed and fixed in 1% paraformaldehyde-PBS. The labeling by anti-CD45RA antibodies and tetramers was analyzed on CD8 lymphocytes, identified on the basis of forward- and side-scatter characteristics and of labeling by anti-CD8 antibodies.

 
Diversity of the Antimalic CTL Response of Patient LB37.
As expected, CTL clones 110 and 1/7 expressed different TCRs, using V{alpha}14-Vß4 and V{alpha}12-Vß5 gene segments, respectively (Fig. 7)Citation . The same V{alpha}12-Vß5 TCR was used by almost all (28/29) of the CTL clones that were tested and that were derived from tetramer-positive CD8 cells found in blood collected in 1990 or 1998, which indicated that the antimalic CTL response of patient LB37 is quasimonoclonal.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
NSCLC, which includes squamous, adeno-, and large-cell carcinomas, represents 60% of lung cancers. NSCLC cell lines are difficult to derive, but a few of them could be used to stimulate autologous lymphocytes and to derive tumor-specific CTLs (8 , 15) . Two antigens recognized by such CTLs were identified previously: a peptide presented by HLA-A2 molecules and encoded by HER2/neu, which is overexpressed in many tumors (16) , and a peptide presented on HLA-A28 and encoded by a mutated elongation factor 2 gene (17) . We describe here the third NSCLC antigen that is defined with autologous CTLs. It is also generated by a point mutation present in the tumor.

The change of alanine to glycine caused by the mutation corresponds to the loss of a methyl group on the side chain of the amino acid at position 8 of the antigenic peptide. According to previous structures of peptides bound to HLA-A2 molecules, this side chain points toward the TCR (18) . CTL clone 110 is perfectly specific for the mutated peptide, whereas CTL 1/7 also recognizes the normal peptide, although with a much lower affinity. This CTL recognizes EBV-B cells but not normal fibroblasts or activated T cells. A likely explanation for the lysis of autologous EBV-B cells by CTL 1/7 is that the high level of surface expression of HLA-A2 molecules on EBV-B cells leads to the presentation of a sufficient number of normal malic peptides for recognition by the CTLs. Fibroblasts or activated T lymphocytes would not be recognized because of their lower level of expression of HLA class I molecules. Another possibility is that the wild-type malic enzyme peptide can be processed by immunoproteasomes, present in EBV-transformed B cells, but not by standard proteasomes present in the other types of normal cells that were tested. A few antigenic peptides were described that are generated by the immunoproteasome but not by the standard proteasome, which operates a cleavage within the epitope (19 , 20) .

Almost all of the antimalic CTLs that we could detect in the blood of patient LB37 have the same TCRs as CTL clone 1/7 and lyse, although at a low level, autologous EBV-B cells. Notwithstanding, no clinical signs of autoimmunity were observed in patient LB37, which suggested that the incomplete tumor-specificity of the response is without serious consequences. This finding is important for immunotherapy, because it indicates that antigens recognized to a certain extent on EBV-B cells should not be excluded a priori from a further identification procedure.

There are many similarities between the tumor-specific CTL responses of lung cancer patient LB37 and of melanoma patient LB33 (7) . Both patients are long survivors (>10 years) after having metastatic tumors and having received injections of irradiated autologous tumor cells. Most of the tumor-specific CTLs derived from their blood recognize tumor-specific antigens resulting from point mutations. These CTLs were present before the patients received autologous vaccines, and then persisted at high numbers representing 0.1–1% of the blood CD8 cells. They are essentially monoclonal populations. They can be labeled with the relevant tetramers and respond to restimulation in vitro with antigen and growth factors. These corroborating results demonstrate that strong CTL responses against antigens that are absolutely tumor-specific can be detected in the blood of cancer patients using tetramers, and justify the use of this methodology to evaluate the immunization of cancer patients against tumor-specific antigens such as those encoded by the MAGE-A genes.

It is possible that antimalic CTL played a role in the clinical outcome of patient LB37. High numbers of tumor-specific CTLs were consistently found in the blood of patient LB37, between 1990 and 1999. Almost identical results, in terms of frequency and persistence, were found in melanoma patient LB33 (7) . These CTL responses may be contributing to the very long survival of these patients. The antigen that is presented to these autologous CTLs on the LB37 tumor cells is strictly tumor-specific and is encoded by a gene for which there is a loss of heterozygosity in the tumor. These tumor cells most likely cannot escape from CTL attack by losing the expression of the antigenic peptide. They have only one copy of the chromosomal region encoding malic enzyme, and the loss of this copy would be lethal because either malic enzyme or other proteins encoded in this region of chromosome 6 are essential for survival. It should be noted that the gene encoding N-acetylglucosamine-mutase, an essential enzyme for glycoprotein synthesis, is just next to that of malic enzyme in the human genome. The absence of an appropriate tumor sample unfortunately prevented us from demonstrating that the same gene deletion in chromosome 6 was present in the tumor in vivo.

It is noteworthy that a high number of antimalic T cells were already present in the blood of patient LB37 before the first vaccination with autologous tumor cells. A similar observation has been made for the anti-MUM-3 CTLs of melanoma patient LB33. This patient had received large amounts of IL-2 prior to the first collection of blood in which anti-MUM-3 CTL were found, leaving room for doubt about the fact that the tumor alone induced this CTL response. Patient LB37, however, did not receive immunostimulatory treatments, and the antimalic response was, therefore, most probably induced by the tumor. This was not reported before, although melanoma patients were shown to have high frequencies of blood CTLs against Melan-A/MART-1 or tyrosinase peptides presented on HLA-A2 (21, 22, 23) . But considering that these antigens are also present on melanocytes, and that normal individuals may also have anti-Melan-A/MART-1 CTLs in their blood, it is impossible to evaluate the role played by tumor cells in the induction of these CTLs in melanoma patients.

It is remarkable that essentially all of the antimalic CTLs that were present in the blood of patient LB37 express the same TCR. We also observed the dominance of one clone in the antimelanoma CTL response of patient LB33 (7) . In addition, although patients LB33 and LB37 received multiple injections of autologous tumor cells, which express several antigens, their antitumor CTL response appears to be locked on one antigen recognized by one CTL clone. A simple explanation for the dominance of one antigen/CTL pair is that it results from the proliferation of the first antitumor CTL precursor that was stimulated, possibly by cells of the tumor. It is then maintained at each vaccination because the increased frequency of this CTL favors its restimulation before that of other precursors of CTL, until the antigen is cleared. This model, which was proposed earlier (24) , is not without consequence for vaccination. For example, if the vaccine is a recombinant protein or consists of a sequence encoding several antigenic peptides, it leads to the presentation of various antigens on the same cells. If, as it is the case for patients LB33 and LB37, the T-cell response is monoclonal, this dominance will persist throughout the vaccination protocol. A tumor variant with a loss of the corresponding antigen could then escape, although vaccinations are pursued with several other antigens.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. TCR usage among CTLs specific for mutated malic enzyme.

 

    ACKNOWLEDGMENTS
 
We thank Thérèse Aerts and Catherine Muller for expert technical assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Belgian Programme on Interuniversity Poles of Attraction initiated by the Belgian State, Prime Minister’s Office, Science Policy Programing, and by grants from the Fonds J. Maisin (Belgium); the Fondation Salus Saguinis (Belgium); the Fédération Belge contre le Cancer (Belgium); the FB Assurances and VIVA (Belgium); and by the Axe Immunologie des Tumeurs, Ligue Nationale contre le Cancer, Paris, France. Back

2 Present address: Dipartimento di Medicina Clinica e Sperimentale, Sezione di Medicina Interna e Scienze Oncologiche, Policlinico Monteluce, Via Brunamonti, 06100 Perugia, Italy. Back

3 Present address: Unité de Recherche et Développement, SmithKline Beecham Biologicals, Rue de l’Institut 89, B-1330 Rixensart, Belgium. Back

4 To whom requests for reprints should be addressed, at Cellular Genetics Unit, Université de Louvain, 74 avenue Hippocrate, UCL 7459, B-1200 Brussels, Belgium. Back

5 The abbreviations used are: TNF, tumor necrosis factor; TCR, T-cell receptor; NSCLC, non-small cell lung carcinoma; APC, allophycocyanin; PBMC, peripheral blood mononuclear cell; PE, phycoerythrin; PerCP, peridinin chlorophyll protein; IL, interleukin; PHA, phytohemaglutinin-A. Back

6 Internet address: http://imgt.cnusc.fr:8104. Back

Received 11/17/00. Accepted 2/21/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Van den Eynde B., van der Bruggen P. T cell-defined tumor antigens. Curr. Opin. Immunol., 9: 684-693, 1997.[Medline]
  2. Marchand M., van Baren N., Weynants P., Brichard V., Dréno B., Tessier M-H., Rankin E., Parmiani G., Arienti F., Humblet Y., Bourlond A., Vanwijck R., Liénard D., Beauduin M., Dietrich P-Y., Russo V., Kerger J., Masucci G., Jäger E., De Greve J., Atzpodien J., Brasseur F., Coulie P. G., van der Bruggen P., Boon T. Tumor regressions observed in patients with metastatic melanoma treated with an antigenic peptide encoded by gene MAGE-3 and presented by HLA-A1. Int. J. Cancer, 80: 219-230, 1999.[Medline]
  3. Marchand M., Weynants P., Rankin E., Arienti F., Belli F., Parmiani G., Cascinelli N., Bourlond A., Vanwijck R., Humblet Y., Canon J-L., Laurent C., Naeyaert J-M., Plagne R., Deraemaeker R., Knuth A., Jäger E., Brasseur F., Herman J., Coulie P.G., Boon T. Tumor regression responses in melanoma patients treated with a peptide encoded by gene MAGE-3. Int. J. Cancer, 63: 883-885, 1995.[Medline]
  4. Thurner B., Haendle I., Roder C., Dieckmann D., Keikavoussi P., Jonuleit H., Bender A., Maczek C., Schreiner D., von den Driesch P., Brocker E. B., Steinman R. M., Enk A., Kampgen E., Schuler G. Vaccination with MAGE-3A1 peptide-pulsed mature, monocyte-derived dendritic cells expands specific cytotoxic T cells and induces regression of some metastases in advanced stage IV melanoma. J. Exp. Med., 190: 1669-1678, 1999.[Abstract/Free Full Text]
  5. Nestle F. O., Alijagic S., Gilliet M., Sun Y., Grabbe S., Dummer R., Burg G., Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med., 4: 328-332, 1998.[Medline]
  6. Coulie P. G., Ikeda H., Baurain J-F., Chiari R. Antitumor immunity at work in a melanoma patient. Adv. Cancer Res., 76: 213-242, 1999.[Medline]
  7. Baurain J-F., Colau D., van Baren N., Landry C., Martelange V., Vikkula M., Boon T., Coulie P. G. High frequency of autologous antimelanoma CTLs directed against an antigen generated by a point mutation in a new helicase gene. J. Immunol., 164: 6057-6066, 2000.[Abstract/Free Full Text]
  8. Weynants P., Thonnard J., Marchand M., Deloos M., Boon T., Coulie P. G. Derivation of tumor-specific cytolytic T cell clones from two lung cancer patients with long survival. Am. J. Respir. Dis., 159: 55-62, 1999.
  9. Espevik T., Nissen-Meyer J. A highly sensitive cell line, WEHI 164 clone 13, for measuring cytotoxic factor/tumor necrosis factor from human monocytes. J. Immunol. Methods, 95: 99-105, 1986.[Medline]
  10. Davis L. G., Dibner M. D., Battey J. F. Guanidine isothiocyanate preparation of total RNA. Basic Methods in Molecular Biology, 130-135, Elsevier Science Publishing Co., Inc. New York 1986.
  11. Hansen M. B., Nielsen S. E., Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J. Immunol. Methods, 119: 203-210, 1989.[Medline]
  12. Atherton E., Logan C. J., Sheppard R. C. Peptide synthesis. Part 2. Procedures for solid phase synthesis using N{alpha}-fluorenylmethysoxycarbamylamino-acid on polymide supports. Synthesis of substance P and of acyl carrier protein 65-74 decapeptide. J. Chem. Soc. Perkin Trans. I, 1: 538-546, 1981.
  13. van der Burg S. H., Ras E., Drijfhout J. W., Benckhuijsen W. E., Bremers A. J., Melief C. J., Kast W. M. An HLA class I peptide-binding assay based on competition for binding to class I molecules on intact human B cells. Identification of conserved HIV-1 polymerase peptides binding to HLA-A*0301. Hum. Immunol., 44: 189-198, 1995.[Medline]
  14. Altman J. D., Moss P. A. H., Goulder P. J. R., Barouch D. H., McHeyzer-Williams M. G., Bell J. I., McMichael A. J., Davis M. M. Phenotypic analysis of antigen-specific T lymphocytes. Science (Wash. D. C.), 274: 94-96, 1996.[Abstract/Free Full Text]
  15. Slingluff C. L., Cox A. L., Stover J. M., Jr., Moore M. M., Hunt D. F., Engelhard V. H. Cytotoxic T-lymphocyte response to autologous human squamous cell cancer of the lung: epitope reconstitution with peptides extracted from HLA-Aw68. Cancer Res., 54: 2731-2737, 1994.[Abstract/Free Full Text]
  16. Yoshino I., Goedegebuure P. S., Peoples G. E., Parikh A. S., DiMaio J. M., Lyerly H. K., Gazdar A. F., Eberlein T. J. HER2/neu-derived peptides are shared antigens among human non-small cell lung cancer and ovarian cancer. Cancer Res., 54: 3387-3390, 1994.[Abstract/Free Full Text]
  17. Hogan K. T., Eisinger D. P., Cupp S. B. R., Lekstrom K. J., Deacon D. D., Shabanowitz J., Hunt D. F., Engelhard V. H., Slingluff C. L., Ross M. M. The peptide recognized by HLA-A68.2-restricted, squamous cell carcinoma of the lung-specific cytotoxic T lymphocytes is derived from a mutated elongation factor 2 gene. Cancer Res., 58: 5144-5150, 1998.[Abstract/Free Full Text]
  18. Hausmann S., Biddison W. E., Smith K. J., Ding Y. H., Garboczi D. N., Utz U., Wiley D. C., Wucherpfennig K. W. Peptide recognition by two HLA-A2/Tax11–19-specific T cell clones in relationship to their MHC/peptide/TCR crystal structures. J. Immunol., 162: 5389-5397, 1999.[Abstract/Free Full Text]
  19. Gileadi U., Moins-Teisserenc H. T., Correa I., Booth B. L., Jr., Dunbar P. R., Sewell A. K., Trowsdale J., Phillips R. E., Cerundolo V. Generation of an immunodominant CTL epitope is affected by proteasome subunit composition and stability of the antigenic protein. J. Immunol., 163: 6045-6052, 1999.[Abstract/Free Full Text]
  20. Sewell A. K., Price D. A., Teisserenc H., Booth J., B. L., Gileadi U., Flavin F. M., Trowsdale J., Phillips R. E., Cerundolo V. IFN-{gamma} exposes a cryptic cytotoxic T lymphocyte epitope in HIV-1 reverse transcriptase. J. Immunol., 162: 7075-7079, 1999.[Abstract/Free Full Text]
  21. Lee P. P., Yee C., Savage P. A., Fong L., Brockstedt D., Weber J. S., Johnson D., Swetter S., Thompson J., Greenberg P. D., Roederer M., Davis M. M. Characterization of circulating T cells specific for tumor-associated antigens in melanoma patients. Nat. Med., 5: 677-685, 1999.[Medline]
  22. Pittet M. J., Valmori D., Dunbar P. R., Speiser D. E., Liénard D., Lejeune F., Fleischhauer K., Cerunodolo V., Cerottini J-C., Romero P. High frequencies of naive Melan-A/MART-1-specific CD8+ T cells in a large proportion of human histocompatibility leukocyte antigen (HLA)-A2 individuals. J. Exp. Med., 190: 705-715, 1999.[Abstract/Free Full Text]
  23. Valmori D., Dutoit V., Lienard D., Lejeune F., Speiser D., Rimoldi D., Cerundolo V., Dietrich P., Cerottini J. C., Romero P. Tetramer-guided analysis of TCR ß-chain usage reveals a large repertoire of melan-A-specific CD8+ T cells in melanoma patients. J. Immunol., 165: 533-538, 2000.[Abstract/Free Full Text]
  24. Brichard V. G., Warnier G., Van Pel A., Morlighem G., Lucas S., Boon T. Individual differences in the orientation of the cytolytic T cell response against mouse tumor P815. Eur. J. Immunol., 25: 664-671, 1995.[Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
F. El Hage, V. Stroobant, I. Vergnon, J.-F. Baurain, H. Echchakir, V. Lazar, S. Chouaib, P. G. Coulie, and F. Mami-Chouaib
Preprocalcitonin signal peptide generates a cytotoxic T lymphocyte-defined tumor epitope processed by a proteasome-independent pathway
PNAS, July 22, 2008; 105(29): 10119 - 10124.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Parmiani, A. De Filippo, L. Novellino, and C. Castelli
Unique Human Tumor Antigens: Immunobiology and Use in Clinical Trials
J. Immunol., February 15, 2007; 178(4): 1975 - 1979.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Sensi and A. Anichini
Unique Tumor Antigens: Evidence for Immune Control of Genome Integrity and Immunogenic Targets for T Cell-Mediated Patient-Specific Immunotherapy
Clin. Cancer Res., September 1, 2006; 12(17): 5023 - 5032.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Kubuschok, F. Neumann, R. Breit, M. Sester, C. Schormann, C. Wagner, U. Sester, F. Hartmann, M. Wagner, K. Remberger, et al.
Naturally Occurring T-Cell Response against Mutated p21 Ras Oncoprotein in Pancreatic Cancer
Clin. Cancer Res., February 15, 2006; 12(4): 1365 - 1372.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Lennerz, M. Fatho, C. Gentilini, R. A. Frye, A. Lifke, D. Ferel, C. Wolfel, C. Huber, and T. Wolfel
The response of autologous T cells to a human melanoma is dominated by mutated neoantigens
PNAS, November 1, 2005; 102(44): 16013 - 16018.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. So, M. Takenoyama, M. Mizukami, Y. Ichiki, M. Sugaya, T. Hanagiri, K. Sugio, and K. Yasumoto
Haplotype Loss of HLA Class I Antigen as an Escape Mechanism from Immune Attack in Lung Cancer
Cancer Res., July 1, 2005; 65(13): 5945 - 5952.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Sensi, G. Nicolini, M. Zanon, C. Colombo, A. Molla, I. Bersani, R. Lupetti, G. Parmiani, and A. Anichini
Immunogenicity without Immunoselection: A Mutant but Functional Antioxidant Enzyme Retained in a Human Metastatic Melanoma and Targeted by CD8+ T Cells with a Memory Phenotype
Cancer Res., January 15, 2005; 65(2): 632 - 640.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Parmiani, A. Testori, M. Maio, C. Castelli, L. Rivoltini, L. Pilla, F. Belli, V. Mazzaferro, J. Coppa, R. Patuzzo, et al.
Heat Shock Proteins and Their Use as Anticancer Vaccines
Clin. Cancer Res., December 15, 2004; 10(24): 8142 - 8146.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Nagorsen, C. Scheibenbogen, F. M. Marincola, A. Letsch, and U. Keilholz
Natural T Cell Immunity against Cancer
Clin. Cancer Res., October 1, 2003; 9(12): 4296 - 4303.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Willhauck, C. Scheibenbogen, M. Pawlita, T. Mohler, E. Thiel, and U. Keilholz
Restricted T-Cell Receptor Repertoire in Melanoma Metastases Regressing after Cytokine Therapy
Cancer Res., July 1, 2003; 63(13): 3483 - 3485.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Novellino, N. Renkvist, F. Rini, A. Mazzocchi, L. Rivoltini, A. Greco, P. Deho, P. Squarcina, P. F. Robbins, G. Parmiani, et al.
Identification of a Mutated Receptor-Like Protein Tyrosine Phosphatase {kappa} as a Novel, Class II HLA-Restricted Melanoma Antigen
J. Immunol., June 15, 2003; 170(12): 6363 - 6370.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. A. E. Marijt, M. H. M. Heemskerk, F. M. Kloosterboer, E. Goulmy, M. G. D. Kester, M. A. W. G. van der Hoorn, S. A. P. van Luxemburg-Heys, M. Hoogeboom, T. Mutis, J. W. Drijfhout, et al.
Hematopoiesis-restricted minor histocompatibility antigens HA-1- or HA-2-specific T cells can induce complete remissions of relapsed leukemia
PNAS, March 4, 2003; 100(5): 2742 - 2747.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. Salgia, T. Lynch, A. Skarin, J. Lucca, C. Lynch, K. Jung, F. S. Hodi, M. Jaklitsch, S. Mentzer, S. Swanson, et al.
Vaccination With Irradiated Autologous Tumor Cells Engineered to Secrete Granulocyte-Macrophage Colony-Stimulating Factor Augments Antitumor Immunity in Some Patients With Metastatic Non-Small-Cell Lung Carcinoma
J. Clin. Oncol., February 15, 2003; 21(4): 624 - 630.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Echchakir, G. Dorothee, I. Vergnon, J. Menez, S. Chouaib, and F. Mami-Chouaib
Cytotoxic T lymphocytes directed against a tumor-specific mutated antigen display similar HLA tetramer binding but distinct functional avidity and tissue distribution
PNAS, July 9, 2002; 99(14): 9358 - 9363.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
G. Parmiani, C. Castelli, P. Dalerba, R. Mortarini, L. Rivoltini, F. M. Marincola, and A. Anichini
Cancer Immunotherapy With Peptide-Based Vaccines: What Have We Achieved? Where Are We Going?
J Natl Cancer Inst, June 5, 2002; 94(11): 805 - 818.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Valmori, C. Scheibenbogen, V. Dutoit, D. Nagorsen, A. M. Asemissen, V. Rubio-Godoy, D. Rimoldi, P. Guillaume, P. Romero, D. Schadendorf, et al.
Circulating Tumor-reactive CD8+ T Cells in Melanoma Patients Contain a CD45RA+CCR7- Effector Subset Exerting ex Vivo Tumor-specific Cytolytic Activity
Cancer Res., March 1, 2002; 62(6): 1743 - 1750.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. G. Coulie, V. Karanikas, D. Colau, C. Lurquin, C. Landry, M. Marchand, T. Dorval, V. Brichard, and T. Boon
A monoclonal cytolytic T-lymphocyte response observed in a melanoma patient vaccinated with a tumor-specific antigenic peptide encoded by gene MAGE-3
PNAS, August 28, 2001; 98(18): 10290 - 10295.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karanikas, V.
Right arrow Articles by Coulie, P. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karanikas, V.
Right arrow Articles by Coulie, P. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online