| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Dendreon Corporation, Seattle, Washington 98121
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
To achieve this, it is important to understand the molecular mechanisms of prostate cancer development and to identify new biochemical markers for disease diagnosis and progression. To date, there are very few prostate-specific markers available. The best-known and well-characterized markers of proven prostate cancer diagnostic value are the proteins PAP2 , PSA (2, 3, 4, 5, 6, 7, 8) , and prostate-specific membrane antigen (9, 10, 11, 12, 13) . Each of these proteins has also become the target for novel immunotherapy approaches to the treatment of the disease (14, 15, 16) .
In this study, we report the identification of a novel gene, designated trp-p8, which is preferentially expressed in prostate. Expression of trp-p8 is mostly restricted to normal prostate epithelial cells and is up-regulated in prostate carcinomas. Cloning of a full-length human trp-p8 cDNA revealed a transcript corresponding to 1104 amino acid polypeptide sharing homology with the trp family of calcium channels (17) . Trp-p8 showed particularly high homology with the human TRPC7 gene, a putative Ca2+ channel protein of the trp family, which is highly expressed in brain tissue (18) . Trp-p8 also showed significant homology to human melastatin, another trp family-related protein expressed in melanocytes and believed to be a tumor suppressor gene (19 , 20) . Perhaps of greatest interest is the observation that the trp-p8 gene appears to be expressed in a large spectrum of nonprostatic neoplastic lesions.
Trp-p8 represents a novel, mostly prostate-restricted as well as pantumor-expressed marker with significant potential use in disease diagnosis and monitoring of disease progression during treatment. It may also serve as a novel target for cancer therapy.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The subtracted prostate cDNA, highly enriched for prostate-specific partial cDNA sequences, was amplified using the primer pair NP1 (5-TCGAGCGGCCGCCCGGGCAGGT-3)/NP2(5-AGGGCGTGGTGCGGAGGGCGGT) on a Perkin-Elmer GeneAmp 9600 Cycler for 11 cycles with the following thermal cycling profile: 94°C for 10 s; 68°C for 30 s; and 72°C for 5 min. This was followed by one additional round at 72°C for 5 min. The products were ligated into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA) and transformed into Escherichia coli strain TOP-10F (Invitrogen). Individual ampicillin-resistant bacterial transformants were screened by PCR for the presence of inserts using the M13 Reverse (5-CAGGAAACAGCTATGA-3) and M13 Forward (5-GTAAAACGACGGCCAGTG-3) primer pair and the following thermal cycling profile: 94°C for 15 s; 55°C for 30 s; and 72°C for 1 min for 30 cycles. This was followed by one additional round at 72°C for 6 min. The original trp-p8 insert in the pCR2.1 plasmid was sequenced using the M13 reverse primer (5-CAGGAAACAGCTATGA-3) and the M1320 primer (5-GTAAAACGACGGCCAGTG-3) on an ABI 373 DNA Sequencer. DNA sequences were analyzed using Sequencher 3.0 software (Gene Codes Corporation, Ann Arbor, MI).
Isolation of Complete Trp-p8 cDNA
The full-length cDNA encoding trp-p8 was isolated from a cDNA library prepared from normal human prostate poly(A)+RNA using both the 5' and 3' RACE method (Marathon cDNA amplification Kit; Clontech Laboratories). 5' RACE was carried out with the AP1 (5-CCATCCTAATACGACTCACTATAGGGC-3)/(5-GCCGAGTAATAGGAGACACGTCGTGG-3) primer pair. 3' RACE amplification reaction was carried out with the AP1 (5-CCATCCTAATACGACTCACTATAGGGC-3)/(5-TGGAAACTGGTTGCGAACTTCCG-3) primer pair. The thermal cycling profile for all of the RACE reactions was 94°C for 15 s and 68°C for 4 min for 30 cycles using Advantage cDNA Polymerase Mix (Clontech Laboratories). 5' and 3' RACE products of approximately 4 kb and 1.6 kb, respectively, were isolated by agarose gel electrophoresis, ligated into the pCR2.1 TA vector (Invitrogen), and transformed into competent E. coli cells. Individual ampicillin-resistant bacterial colonies were screened by PCR for the presence of an insert with the primer pair AP2 (5-ACTCACTATAGGGCTCGAGCGGC-3)/(5-GCCGAGTAATAGGAGACACGTCGTGG-3) for the 5' RACE products and the primer pair AP2 (5-ACTCACTATAGGGCTCGAGCGGC-3)/(5-CAAAGTCATTTGGCAGCAGACCAGG-3) for the 3' RACE products using a thermal cycling profile of 94°C for 15 s, 55°C for 30 s, and 72°C for 1 min for 35 cycles, followed by one additional round at 72°C for 6 min. PCR products were resolved by agarose gel electrophoresis, and individual bacterial transformants were grown in liquid culture (Luria-Broth supplemented with ampicillin 100 µg/ml) before preparation of plasmid DNA. The complete DNA sequence of individual RACE products was determined by automated fluorescent sequencing using an ABI 373 DNA sequencer in conjunction with custom DNA primers and the Primer Island Transposition Kit (PE Applied Biosystems, Foster City, CA). The near full-length trp-p8 cDNA was amplified and cloned using primers that correspond to the ends of the 5' and 3' RACE sequences.
Expression of Recombinant Trp-p8
Expression in Bac-to-Bac Baculovirus System (Life Technologies, Inc.).
Trp-p8 cDNA was amplified using AdvanTaq DNA Polymerase (Clontech) and primers TACTACGATATCATGAGGAACAGAAGGAATGACACTCTGGACA and TTATTATTAAATGCGGCCGCACTTAGTGATGGTGATGGTGATGAGGTGGAGGTGGTTTGATTTTATTAGCAATCTCTTTCAGAAGACC, digested with NotI and EcoRV and inserted into NotI- and StuI-digested pFASTBac-1 plasmid. All of the subsequent procedures were performed according to the manufacturers protocols. Briefly, pFASTBac-1 plasmid carrying trp-p8 insert was used to transform competent DH10Bac E. coli cells. White colonies were screened for transposition event by PCR, and high molecular weight DNA of selected clones was used to transfect Sf21 insect cells grown in Sf-900 II medium. Resulting viral stock was amplified twice. Infected cells were collected 2472 h after infection, lysed in PBS containing 8 M urea and protease inhibitors cocktail (Roche Molecular Biochemicals), diluted in SDS-PAGE sample buffer, and separated on 816% polyacrylamide gradient SDS-PAGE gels (Novex/Invitrogen). The separated proteins were transferred on nitrocellulose membrane (Protran; Bio-Rad), blocked, and developed with COOH-terminal oligohistidine-specific mouse monoclonal antibody (Invitrogen), followed by horseradish peroxidase-conjugated sheep antibodies specific for mouse immunoglobulin (Amersham/Pharmacia). The blots were visualized by enhanced chemiluminescence (Amersham/Pharmacia).
Expression in E. coli (pTriEx-1 System; Novagen).
Trp-p8 cDNA was amplified using AdvanTaq DNA Polymerase (Clontech) and primers ATATATATACCATGGGGAACAGAAGGAATGACACTCTGGACAGCACCCGGACC and TTATTATTAAATGCGGCCGCACTTAGTGATGGTGATGGTGATGAGGTGGAGGTGGTTTGATTTTATTAGCAATCTCTTTCAGAAGACC, digested with NcoI and NotI, and cloned into pTriEx-1 vector, which was previously cut with the same restriction enzymes. The resulting DNA was used to transform (DE3) pLacI expression hosts (Novagen). Overnight bacterial cultures were inoculated into fresh Luria-Bertani medium supplemented with ampicillin and chloramphenicol, grown for 35 h, and induced with 1 mM isopropyl-1-thio-ß-d-galactopyranoside for 3 h. Bacterial pellet was collected and lysed, and the expression was verified as described above for baculovirus system.
Transient Expression in Mammalian Cells.
EcoRV- and NotI-digested trp-p8 cDNA, prepared as described above, was cloned into EcoRV and NotI sites of the pCR3.1 plasmid (Invitrogen). The resulting DNA (510 µg) was transfected into COS-7 cells (80% confluent in 6-well tissue culture plates) using 2 µl of Lipofectamine2000 (Life Technologies, Inc.)/well. DNA-liposome complexes were formed for 15 min in 100 µl of serum-free Iscoves modified Dulbeccos medium. Eight h after the transfection, the cells were infected with vaccinia virus carrying T7 RNA polymerase, harvested, and lysed as described for the baculovirus-infected cells.
Poly(A)+ RNA Preparation
Total RNA was extracted from cells using Trizol Reagent (Life Technologies, Inc.), following the manufacturers instructions. Poly(A)+ RNA were isolated using mRNA Purification Kit (Pharmacia, Palo Alto, CA). The final RNA preparation was resuspended in 10 mM Tris·Cl, 1 mM EDTA (pH 8.0), prepared with diethylpyrocarbonate-treated water, and quantitated by light absorbency at 260 nm.
RT-PCR
First strand cDNA was prepared using human poly(A)+ RNAs and the SMART PCR cDNA Synthesis Kit (Clontech). Briefly, 5 µl of template-primer mixture, containing 1 µg of Poly(A)+ RNA, were incubated at 70°C for 2 min. Superscript II reverse transcription mix (5 µl) was added, and reverse transcription was carried out at 42°C for 1 h. The reaction mix was diluted with 45 µl of 10 mm Tris·Cl, 1 mM EDTA (pH 8.0) buffer, and reaction was terminated at 72°C for 7 min. The primer pair (5-GATTTTCACCAATGACCGCCG-3)/(5-CCCCAGCAGCATTGATGTCG-3) was used to assess expression with a thermal cycling profile of 94°C for 15 s, 65°C for 15 s, and 72°C for 30 s (30 cycles), followed by one additional round at 72°C for 6 min. Amplification products (503 bp) were resolved by agarose gel electrophoresis and visualized by ethidium bromide staining and UV light.
Northern and Dot Blot Analysis
Northern blots, in which 2 µg of Poly(A)+ RNA from the tissue indicated were loaded into each lane, and human RNA master blot, in which the amount of RNA+ was normalized (Clontech), were used. Trp-p8 342 bp ("original fragment") and human G3PDH were used as probes. The filters were prehybridized in ExpressHyb solution (Clontech) for 30 min at 65°C and for 2 h in the same solution containing 1 x 106 cpm/ml 32P-labeled probe at 65°C. The filters were washed in 2 x SSC, 0.1% SDS for 15 min at room temperature and then with a solution containing 0.1 x SSC, 0.1% SDS for 15 min at room temperature and for 1 h at 68°C. Filters were exposed to a Kodak XR film for 1 h to 3 days at -70°C.
Virtual Northern Blots
A SMART PCR cDNA Synthesis Kit (Clontech) was used to generate SMART cDNAs from poly(A)+ RNA samples isolated from different tissues. Then, cDNAs were electrophoresed on an agarose gel, denatured, transferred onto a nylon membrane, and hybridized to the 32P-labeled probes as described above.
Cell Culture
The human prostate cancer cell lines LNCaP (ATCC CRL 1740), PC 3 (ATCC CRL 1435), and DU145 (ATCC HTB 81), as well as the melanoma G361 (ATCC CRL1424), the colorectal adenocarcinoma SW480 (ATCC CCL228), and the lung carcinoma A549 (ATCC CCL185) cell lines, were obtained from American Type Culture Collection. The cells were propagated in DMEM containing 10% fetal bovine serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 250 ng/ml fungizone (Life Technologies, Inc.)
In Situ Hybridization
The tissues used in this study were formalin-fixed, paraffin-embedded archival blocks donated by regional hospitals to the tissue bank of LifeSpan BioSciences in Seattle, Washington. The tissues had been removed at surgery, fixed in 10% neutral buffered formalin for 1624 h, processed, and embedded in paraffin. Serial 4-µm sections were then stained with H&E or used in the in situ hybridization studies. Two pathologists independently evaluated the samples for diagnostic verification and grading. Adjacent serial sections were then screened for the presence of preserved RNA by hybridization with an antisense collagen control riboprobe. Only tissues that passed the hybridization test with similar levels of signal were used in subsequent hybridization analyses for trp-p8. After hybridization, the slides were then independently evaluated by two pathologists for interpretation of the in situ hybridization signal.
Serial tissue sections from paraffin samples were hybridized with probes that had been synthesized from linearized plasmids (pCR 2.1; Invitrogen) containing the original partial cDNA fragment of trp-p8 gene (342 bp) isolated from the subtracted library. In these studies, digoxigenin-labeled riboprobes transcribed from the T7 site (antisense and sense probes) were used. After transcription, the probes were subjected to electrophoresis onto a 1% agarose gel to determine the size and purity of the riboprobes. In addition to the antisense trp-p8 probes, adjacent tissue sections were hybridized with both sense and antisense
-(1) Type I collagen riboprobes, and a subset of the slides was also hybridized with the sense orientation trp-p8 riboprobe. Tissue sections from paraffin blocks were digested with proteinase K for 3 to 4 min and then hybridized with the antisense probe at a concentration of 1 µg/ml at 60°C. The hybridization signals were visualized with NBT/BCIP substrates using two cycles of an alkaline phosphatase TSA amplification system (NEN Life Sciences). The specimens were then counterstained with methyl green. The signal was developed within 3040 min at room temperature. The slides were then imaged using a Sony digital photo camera and a Nikon microscope.
| RESULTS |
|---|
|
|
|---|
The eight chosen clones were further analyzed for prostate-specific expression pattern by Northern and dot blots. One clone that displayed the most restricted prostate-specific expression pattern was chosen. The full-length cDNA was isolated and sequenced as described in "Materials and Methods." This cDNA was designated trp-p8.
Trp-p8 Nucleic Acid Sequence and Predicted Protein Structure Analysis.
The entire 5694-bp nucleotide sequence designated as trp-p8 cDNA is shown in Fig. 1
. The sequence contains a single open reading frame with an apparent translational initiation site at nucleotide positions 4143 and with a stop codon at nucleotide positions 33533355 (22)
. The trp-p8 cDNA has a 2338-bp 3'-untranslated region, which includes a poly(A) tail.
|
-helices at the COOH-terminus of the protein and a large NH2-terminal hydrophilic domain (Fig. 2)
|
|
|
|
|
|
|
|
In normal prostate sections, the epithelial cells showed moderately positive hybridization reaction (Fig. 10E)
. The strongest signal was seen within the reserve (basal) cell layer and also at the luminal surface of the epithelium. Vascular smooth muscle tissue and endothelium remained negative. In benign prostatic hyperplasia, the hyperplastic epithelium stained more intensely than normal prostate epithelium (Fig. 10F)
. Within cystic glands, the signal was decreased or largely negative. Fourteen of the 16 prostatic carcinomas hybridized strongly with the trp-p8 probe (Fig. 10, G and H)
. The remaining two prostatic carcinomas displayed a moderate hybridization signal. In cases in which the adjacent normal or hyperplastic epithelium was present in the same section, the signal in the carcinomas was stronger than in normal tissue, although signal varied both between cancer cells within the same section, as well as between different patients. The location of the signal in carcinomas was similar to the benign epithelium, but the cytoplasm was more uniformly positive in carcinomas. The expression of trp-p8 was variable among the patients, ranging from moderate in normal prostate, moderate to high in BPH, and high in prostate cancer.
|
|
|
Analysis of normal lung tissue samples showed that two of three were moderately positive for hybridization signal within Type II pneumocytes and some bronchial epithelial cells, although the dot blot analysis of the normal lung mRNA yielded negative results. The bronchoalveolar carcinoma was strongly positive in areas displaying a Type II pneumocyte differentiation pattern. Overall, although results were variable, depending on the type and progression of the tumor, 8 of 10 samples revealed weak to very strong positive signals.
Three of four melanomas were positive for hybridization, although the melanoma cells showed a high degree of staining variability. The stronger hybridization signal was seen toward the deeper areas of invasion, and often-superficial melanoma cells were negative for hybridization. The single case of melanoma that appeared negative was a superficially spreading melanoma, a less malignant type of melanoma (Fig. 11, F and G)
.
Hybridization of the control (sense orientation) trp-p8 RNA probe to various human tissues was negative (Fig. 12)
.
|
| DISCUSSION |
|---|
|
|
|---|
The deduced protein sequence revealed seven transmembrane domains in the COOH-terminal region of trp-p8. Database alignments of the predicted protein structure showed a strong homology to the trp family of proteins. The trp family consists of a number of C. elegans, Drosophila, and human trp proteins (24, 25, 26, 27) . Trp proteins regulate an influx of Ca2+ through the plasma membrane of the cells (28, 29, 30) . Activation of these channels is a highly regulated process itself, which is dependent on the release of Ca2+ from the internal stores; therefore, they are named capacitative calcium entry channels (31) . Different agonists, such as hormones, growth factors, and light, which trigger the production of inositol 1,4,5-triphosphate and release of Ca2+ from the internal stores, can activate capacitative calcium entry channels. Trp proteins share structural similarity with vertebrate voltage-gated Ca2+ channels (26 , 28 , 30 , 32) . A comparison of trp-p8 with the Drosophila trp proteins revealed that there is a high conservation in the distribution and sequence of the transmembrane domains of these proteins. This analysis suggests that the trp-p8 may be a Ca2+ channel protein. The sequence from amino acid 991 to amino acid 1022 of trp-p8 is a highly conserved region between human and Drosophila trp proteins, which also suggests that trp-p8 likely belongs to the trp gene superfamily. Although the function of C. elegans trp proteins is not yet known, it has been shown that Drosophila trp proteins, which highly resemble human trp proteins, act as Ca2+ channels (29) . Functional studies to confirm the putative role of trp-p8 as a calcium channel, as well as to elucidate its role in regulating metastatic potential of prostate cancer, are currently underway.
Analysis of trp-p8 mRNA expression in different prostate cancer cell lines revealed expression in the LNCaP cell line and the lack of expression in the DU 145 and PC-3 cell lines. The LNCaP cell line is derived from a lymph node metastases, DU145 is derived from brain metastases, and PC-3 is derived from bone metastases of prostate cancer patients (33, 34, 35) . The LNCaP cell line has been reported to produce prostate-specific proteins such as PAP, PSA, and prostate specific membrane antigen, whereas expression of these antigens in DU145 and PC-3 cells was not detectable or very low (36) . Of the three studied cell lines, only LNCaP, the sole trp-p8 expresser, was found to be androgen-dependent. However, conclusions based exclusively on patterns of expression of proteins in vitro by established cell lines have to be drawn with considerable caution. The expression can be significantly altered by culture conditions and may vary from expression by a tumor in vivo. Therefore, we have conducted extensive in situ mRNA hybridization studies of the primary human cancers and corresponding normal tissues.
We have analyzed a number of radical prostatectomy cases for trp-p8 expression via in situ hybridization. Moderate mRNA expression was observed in normal prostate, whereas the expression in prostate cancer appears to be elevated. Reserve (basal) epithelial cells were usually the most intensively stained in the normal prostate; however, the stain was observed throughout all of the neoplastic cells in the cancerous tissue. In addition to the normal prostate and prostate cancer, we have examined tissue sections of neoplasm of different origin such as breast adenocarcinoma, melanoma, colorectal adenocarcinoma, and lung adenocarcinoma. We have found that trp-p8 mRNA is expressed in all of these types of cancerous tissues. It appears that trp-p8 gene is most abundantly expressed in a prostate; however, it is also ectopically re-expressed in different forms of cancer of epithelial histogenesis.
Normal, nonmutated genes that encode shared tumor antigens have been classified in two major groups: (a) differentiation antigens shared on melanoma and melanocytes (melanocyte/differentiation antigens: MART-1 and MART-2); and (b) differentiation antigens shared on a variety of tumors as well as normal testis (cancer/testis antigens: MAGE, GAGE, BAGE, and NY-ESO-1; Refs. 37 , 38 ). Although expression of this gene needs further evaluation on the protein level, trp-p8 does not seem to fall in either of these groups. It is expressed predominantly in the normal prostate, as well as in melanoma and in a variety of tumors. Only a trace amount of trp-p8 has been identified in testis.
The trp-p8 gene sequence revealed the highest homology to TRPC7, a gene primarily expressed in human brain. The trp-p8 cDNA also showed homology to melastatin, normally expressed in melanocytes. Thus, contrary to melastatin, which is thought to be a tumor suppressor gene, trp-p8 could be an oncogene or tumor promoter gene. Although a limited number of melanoma samples were analyzed, the intensity of trp-p8 expression showed a direct correlation to melanoma aggressiveness, which distinguishes it from melastatin. The expression of melastatin was inversely correlated with melanoma aggressiveness and metastatic potential (19 , 20) .
The adult prostate is maintained through equilibrium between cell growth and cell death rates. Recent reports (39) show the link between elevation of intracellular Ca2+, androgen levels, and apoptotic prostatic cell death. Although it is premature to draw conclusions about the role of trp-p8 in the function of the normal prostate, the possibility exists that the trp-p8 gene product is involved in the regulation of intercellular Ca2+. An overexpression of trp-p8 in prostate cancer could suggest the role in the protection of the prostate cancer cells from apoptosis in malignancy.
Considering its mostly prostate-restricted expression, its suggested association with tumor, and its presumed membrane-bound nature, trp-p8 could be used for in vivo imaging, as well as a target for immunotherapy. Its potential function as a Ca2+ channel protein also raises the possibility of pharmacological intervention with specific Ca2+ channel blockers. This use could extend not only to prostate carcinomas but also to diagnosis and treatment of other, nonprostatic tumors. Overall, trp-p8 could prove a clinically useful marker of carcinomas and serve as a target against which novel therapies can be directed.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 To whom requests for reprints should be addressed, at Dendreon Corporation, 3005 First Avenue, Seattle, WA 98121. ![]()
2 The abbreviations used are: PAP, prostatic acid phosphatase; PSA, prostate-specific antigen; trp, transient receptor potential; RT-PCR, reverse transcription PCR; BPH, benign prostate hyperplasia; RACE, rapid amplification of cDNA ends. ![]()
Received 12/28/99. Accepted 3/ 1/01.
| REFERENCES |
|---|
|
|
|---|
1-antichymotrypsin before diagnosis of prostate cancer. Lancet, 344: 1594-1598, 1994.[Medline]
This article has been cited by other articles:
![]() |
C. D. Johnson, D. Melanaphy, A. Purse, S. A. Stokesberry, P. Dickson, and A. V. Zholos Transient receptor potential melastatin 8 channel involvement in the regulation of vascular tone Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1868 - H1877. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Morenilla-Palao, M. Pertusa, V. Meseguer, H. Cabedo, and F. Viana Lipid Raft Segregation Modulates TRPM8 Channel Activity J. Biol. Chem., April 3, 2009; 284(14): 9215 - 9224. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lazzeri, E. Costantini, and M. Porena Review: TRP family proteins in the lower urinary tract: translating basic science into new clinical prospective Therapeutic Advances in Urology, April 1, 2009; 1(1): 33 - 42. [Abstract] [PDF] |
||||
![]() |
F. J. P. Kuhn, C. Kuhn, and A. Luckhoff Inhibition of TRPM8 by Icilin Distinct from Desensitization Induced by Menthol and Menthol Derivatives J. Biol. Chem., February 13, 2009; 284(7): 4102 - 4111. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Bode, Y.-Y. Cho, D. Zheng, F. Zhu, M. E. Ericson, W.-Y. Ma, K. Yao, and Z. Dong Transient Receptor Potential Type Vanilloid 1 Suppresses Skin Carcinogenesis Cancer Res., February 1, 2009; 69(3): 905 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Sabnis, M. Shadid, G. S. Yost, and C. A. Reilly Human Lung Epithelial Cells Express a Functional Cold-Sensing TRPM8 Variant Am. J. Respir. Cell Mol. Biol., October 1, 2008; 39(4): 466 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamamura, S. Ugawa, T. Ueda, A. Morita, and S. Shimada TRPM8 activation suppresses cellular viability in human melanoma Am J Physiol Cell Physiol, August 1, 2008; 295(2): C296 - C301. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Sabnis, C. A. Reilly, J. M. Veranth, and G. S. Yost Increased transcription of cytokine genes in human lung epithelial cells through activation of a TRPM8 variant by cold temperatures Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L194 - L200. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. De Petrocellis, V. Vellani, A. Schiano-Moriello, P. Marini, P. C. Magherini, P. Orlando, and V. Di Marzo Plant-Derived Cannabinoids Modulate the Activity of Transient Receptor Potential Channels of Ankyrin Type-1 and Melastatin Type-8 J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 1007 - 1015. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, M.-H. Li, K. Inoue, X.-P. Chu, J. Seeds, and Z.-G. Xiong Transient Receptor Potential Melastatin 7 like Current in Human Head and Neck Carcinoma Cells: Role in Cell Proliferation Cancer Res., November 15, 2007; 67(22): 10929 - 10938. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. P. Kuhn, G. Knop, and A. Luckhoff The Transmembrane Segment S6 Determines Cation versus Anion Selectivity of TRPM2 and TRPM8 J. Biol. Chem., September 21, 2007; 282(38): 27598 - 27609. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Malkia, R. Madrid, V. Meseguer, E. de la Pena, M. Valero, C. Belmonte, and F. Viana Bidirectional shifts of TRPM8 channel gating by temperature and chemical agents modulate the cold sensitivity of mammalian thermoreceptors J. Physiol., May 15, 2007; 581(1): 155 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, Q. Tong, K. Conrad, J. Wozney, J. Y. Cheung, and B. A. Miller Regulation of TRP channel TRPM2 by the tyrosine phosphatase PTPL1 Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1746 - C1758. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Andersson, M. Nash, and S. Bevan Modulation of the Cold-Activated Channel TRPM8 by Lysophospholipids and Polyunsaturated Fatty Acids J. Neurosci., March 21, 2007; 27(12): 3347 - 3355. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. U. Bai, A. Kaseb, S. Tejwani, G. W. Divine, E. R. Barrack, M. Menon, A. B. Pardee, and G. P.-V. Reddy Identification of prostate cancer mRNA markers by averaged differential expression and their detection in biopsies, blood, and urine PNAS, February 13, 2007; 104(7): 2343 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Mahieu, G. Owsianik, L. Verbert, A. Janssens, H. De Smedt, B. Nilius, and T. Voets TRPM8-independent Menthol-induced Ca2+ Release from Endoplasmic Reticulum and Golgi J. Biol. Chem., February 2, 2007; 282(5): 3325 - 3336. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kiselyov, A. Soyombo, and S. Muallem TRPpathies J. Physiol., February 1, 2007; 578(3): 641 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nilius, G. Owsianik, T. Voets, and J. A. Peters Transient Receptor Potential Cation Channels in Disease Physiol Rev, January 1, 2007; 87(1): 165 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
S M Gribble, D Kalaitzopoulos, D C Burford, E Prigmore, R R Selzer, B L Ng, N S W Matthews, K M Porter, R Curley, S J Lindsay, et al. Ultra-high resolution array painting facilitates breakpoint sequencing J. Med. Genet., January 1, 2007; 44(1): 51 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Caterina Transient receptor potential ion channels as participants in thermosensation and thermoregulation Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R64 - R76. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. V. Abeele, A. Zholos, G. Bidaux, Y. Shuba, S. Thebault, B. Beck, M. Flourakis, Y. Panchin, R. Skryma, and N. Prevarskaya Ca2+-independent Phospholipase A2-dependent Gating of TRPM8 by Lysophospholipids J. Biol. Chem., December 29, 2006; 281(52): 40174 - 40182. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Gudermann and S. Roelle Calcium-dependent growth regulation of small cell lung cancer cells by neuropeptides Endocr. Relat. Cancer, December 1, 2006; 13(4): 1069 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Potier, V. Joulin, S. Roger, P. Besson, M.-L. Jourdan, J.-Y. LeGuennec, P. Bougnoux, and C. Vandier Identification of SK3 channel as a new mediator of breast cancer cell migration. Mol. Cancer Ther., November 1, 2006; 5(11): 2946 - 2953. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Roosterman, T. Goerge, S. W. Schneider, N. W. Bunnett, and M. Steinhoff Neuronal control of skin function: the skin as a neuroimmunoendocrine organ. Physiol Rev, October 1, 2006; 86(4): 1309 - 1379. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-R. Yang, M.-J. Lin, L. S. McIntosh, and J. S. K. Sham Functional expression of transient receptor potential melastatin- and vanilloid-related channels in pulmonary arterial and aortic smooth muscle Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1267 - L1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tong, W. Zhang, K. Conrad, K. Mostoller, J. Y. Cheung, B. Z. Peterson, and B. A. Miller Regulation of the Transient Receptor Potential Channel TRPM2 by the Ca2+ Sensor Calmodulin J. Biol. Chem., April 7, 2006; 281(14): 9076 - 9085. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, I. Hirschler-Laszkiewicz, Q. Tong, K. Conrad, S.-C. Sun, L. Penn, D. L. Barber, R. Stahl, D. J. Carey, J. Y. Cheung, et al. TRPM2 is an ion channel that modulates hematopoietic cell death through activation of caspases and PARP cleavage Am J Physiol Cell Physiol, April 1, 2006; 290(4): C1146 - C1159. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang and G. J Barritt TRPM8 in prostate cancer cells: a potential diagnostic and prognostic marker with a secretory function? Endocr. Relat. Cancer, March 1, 2006; 13(1): 27 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Premkumar, M. Raisinghani, S. C. Pingle, C. Long, and F. Pimentel Downregulation of Transient Receptor Potential Melastatin 8 by Protein Kinase C-Mediated Dephosphorylation J. Neurosci., December 7, 2005; 25(49): 11322 - 11329. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Clapham, D. Julius, C. Montell, and G. Schultz International Union of Pharmacology. XLIX. Nomenclature and Structure-Function Relationships of Transient Receptor Potential Channels Pharmacol. Rev., December 1, 2005; 57(4): 427 - 450. [Full Text] [PDF] |
||||
![]() |
S. Thebault, L. Lemonnier, G. Bidaux, M. Flourakis, A. Bavencoffe, D. Gordienko, M. Roudbaraki, P. Delcourt, Y. Panchin, Y. Shuba, et al. Novel Role of Cold/Menthol-sensitive Transient Receptor Potential Melastatine Family Member 8 (TRPM8) in the Activation of Store-operated Channels in LNCaP Human Prostate Cancer Epithelial Cells J. Biol. Chem., November 25, 2005; 280(47): 39423 - 39435. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Parry, D. Schneider, D. Hudson, D. Parkes, J.-A. Xuan, A. Newton, P. Toy, R. Lin, R. Harkins, B. Alicke, et al. Identification of a Novel Prostate Tumor Target, Mindin/RG-1, for Antibody-Based Radiotherapy of Prostate Cancer Cancer Res., September 15, 2005; 65(18): 8397 - 8405. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Birder More than just a barrier: urothelium as a drug target for urinary bladder pain Am J Physiol Renal Physiol, September 1, 2005; 289(3): F489 - F495. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nilius, T. Voets, and J. Peters TRP Channels in Disease Sci. Signal., August 2, 2005; 2005(295): re8 - re8. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Weil, S. E. Moore, N. J. Waite, A. Randall, and M. J. Gunthorpe Conservation of Functional and Pharmacological Properties in the Distantly Related Temperature Sensors TRVP1 and TRPM8 Mol. Pharmacol., August 1, 2005; 68(2): 518 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Bidaux, M Roudbaraki, C Merle, A Crepin, P Delcourt, C Slomianny, S Thebault, J-L Bonnal, M Benahmed, F Cabon, et al. Evidence for specific TRPM8 expression in human prostate secretory epithelial cells: functional androgen receptor requirement Endocr. Relat. Cancer, June 1, 2005; 12(2): 367 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang and G. J. Barritt Evidence that TRPM8 Is an Androgen-Dependent Ca2+ Channel Required for the Survival of Prostate Cancer Cells Cancer Res., November 15, 2004; 64(22): 8365 - 8373. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Padinjat and S. Andrews TRP channels at a glance J. Cell Sci., November 15, 2004; 117(24): 5707 - 5709. [Full Text] [PDF] |
||||
![]() |
C.-L. Huang The Transient Receptor Potential Superfamily of Ion Channels J. Am. Soc. Nephrol., July 1, 2004; 15(7): 1690 - 1699. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Andersson, H. W. N. Chase, and S. Bevan TRPM8 Activation by Menthol, Icilin, and Cold Is Differentially Modulated by Intracellular pH J. Neurosci., June 9, 2004; 24(23): 5364 - 5369. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Maeda, S. Nagata, C. D. Wolfgang, G. L. Bratthauer, T. K. Bera, and I. Pastan The T Cell Receptor {gamma} Chain Alternate Reading Frame Protein (TARP), a Prostate-specific Protein Localized in Mitochondria J. Biol. Chem., June 4, 2004; 279(23): 24561 - 24568. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, S. Jones, K. Brody, M. Costa, and S. J. H. Brookes Thermosensitive transient receptor potential channels in vagal afferent neurons of the mouse Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G983 - G991. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. Cantiello Regulation of calcium signaling by polycystin-2 Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1012 - F1029. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Bera, S. Das, H. Maeda, R. Beers, C. D. Wolfgang, V. Kumar, Y. Hahn, B. Lee, and I. Pastan NGEP, a gene encoding a membrane protein detected only in prostate cancer and normal prostate PNAS, March 2, 2004; 101(9): 3059 - 3064. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Clapham, C. Montell, G. Schultz, and D. Julius International Union of Pharmacology. XLIII. Compendium of Voltage-Gated Ion Channels: Transient Receptor Potential Channels Pharmacol. Rev., December 1, 2003; 55(4): 591 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhaskar, D. A. Law, E. Ibsen, D. Breinberg, K. M. Cass, R. B. DuBridge, F. Evangelista, S. M. Henshall, P. Hevezi, J. C. Miller, et al. E-Selectin Up-Regulation Allows for Targeted Drug Delivery in Prostate Cancer Cancer Res., October 1, 2003; 63(19): 6387 - 6394. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Henshall, D. E. H. Afar, J. Hiller, L. G. Horvath, D. I. Quinn, K. K. Rasiah, K. Gish, D. Willhite, J. G. Kench, M. Gardiner-Garden, et al. Survival Analysis of Genome-Wide Gene Expression Profiles of Prostate Cancers Identifies New Prognostic Targets of Disease Relapse Cancer Res., July 15, 2003; 63(14): 4196 - 4203. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lee, J. Chen, L. Sun, S. Wu, K. R. Gray, A. Rich, M. Huang, J.-H. Lin, J. N. Feder, E. B. Janovitz, et al. Expression and Characterization of Human Transient Receptor Potential Melastatin 3 (hTRPM3) J. Biol. Chem., May 30, 2003; 278(23): 20890 - 20897. [Abstract] [Full Text] [PDF] |
||||
![]() |
V Sydorenko, Y Shuba, S Thebault, M Roudbaraki, G Lepage, N Prevarskaya, and R Skryma Receptor-coupled, DAG-gated Ca2+-permeable cationic channels in LNCaP human prostate cancer epithelial cells J. Physiol., May 1, 2003; 548(3): 823 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, X. Chu, Q. Tong, J. Y. Cheung, K. Conrad, K. Masker, and B. A. Miller A Novel TRPM2 Isoform Inhibits Calcium Influx and Susceptibility to Cell Death J. Biol. Chem., April 25, 2003; 278(18): 16222 - 16229. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Vanden Abeele, M. Roudbaraki, Y. Shuba, R. Skryma, and N. Prevarskaya Store-operated Ca2+ Current in Prostate Cancer Epithelial Cells. ROLE OF ENDOGENOUS Ca2+ TRANSPORTER TYPE 1 J. Biol. Chem., April 18, 2003; 278(17): 15381 - 15389. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Strange From Genes to Integrative Physiology: Ion Channel and Transporter Biology in Caenorhabditis elegans Physiol Rev, April 1, 2003; 83(2): 377 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Herness and R. K. Naz A Novel Human Prostate-specific Gene-1 (HPG-1): Molecular Cloning, Sequencing, and Its Potential Involvement in Prostate Carcinogenesis Cancer Res., January 15, 2003; 63(2): 329 - 336. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Carnesecchi, A. Bradaia, B. Fischer, D. Coelho, M. Scholler-Guinard, F. Gosse, and F. Raul Perturbation by Geraniol of Cell Membrane Permeability and Signal Transduction Pathways in Human Colon Cancer Cells J. Pharmacol. Exp. Ther., November 1, 2002; 303(2): 711 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dalrymple, D.M. Slater, D. Beech, L. Poston, and R.M. Tribe Molecular identification and localization of Trp homologues, putative calcium channels, in pregnant human uterus Mol. Hum. Reprod., October 1, 2002; 8(10): 946 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Bera, R. Maitra, C. Iavarone, G. Salvatore, V. Kumar, J. J. Vincent, B. K. Sathyanarayana, P. Duray, B. K. Lee, and I. Pastan PATE, a gene expressed in prostate cancer, normal prostate, and testis, identified by a functional genomic approach PNAS, March 5, 2002; 99(5): 3058 - 3063. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lane, G. Hao, and S. S. Gross S-Nitrosylation Is Emerging as a Specific and Fundamental Posttranslational Protein Modification: Head-to-Head Comparison with O-Phosphorylation Sci. Signal., June 12, 2001; 2001(86): re1 - re1. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |