Cancer Research Annual Meeting 2010  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagarajan, S.
Right arrow Articles by Selvaraj, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagarajan, S.
Right arrow Articles by Selvaraj, P.
[Cancer Research 62, 2869-2874, May 15, 2002]
© 2002 American Association for Cancer Research


Immunology

Glycolipid-anchored IL-12 Expressed on Tumor Cell Surface Induces Antitumor Immune Response1

Shanmugam Nagarajan and Periasamy Selvaraj2

Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia 30322


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Systemic or local administration of cytokine has been used as a mode to enhance the antitumor immune response induced by many cancer vaccines. We have investigated whether the expression of cytokines on the tumor cell surface as a glycolipid (GPI)-anchored form will be effective in inducing antitumor immune response using a GPI-anchored interleukin (IL)-12 (GPI-IL-12) as a model. GPI-IL-12-induced the proliferation of concanavalin A-activated T cells and induced IFN-{gamma} secretion by activated and allogeneic T cells, indicating that the membrane-expressed IL-12 can stimulate T cells. GPI-IL-12 expressed on the tumor cell surface prevented tumor growth in mice in a highly tumorigenic murine mastocytoma model. These results suggest that the cell surface-expressed GPI-IL-12 can be effective in inducing antitumor immune response, and GPI-anchored cytokines expressed on the tumor cell surface may be a novel approach to deliver cytokines at the immunization site during vaccination against cancer. Furthermore, purified GPI-anchored cytokines can be used to quickly modify tumor membranes by the protein transfer method to express the desired cytokines for vaccine development.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cytokines play a crucial role in the induction of antitumor immune response (1, 2, 3) . Preclinical studies have demonstrated that administration of cytokines such as IL3 -2 (4) , IL-4 (5) , or IL-12 (6 , 7) induce stimulation of antitumor immune responses in murine tumor models. However, systemic administration of cytokines such as IL-12 in human patients resulted in unwanted side effects (8) . This was circumvented by transfer of cytokine genes into tumor cells for localized secretion of cytokines at the tumor microenvironment (1 , 9) . Tumors transfected with genes specific for cytokines such as IL-12 and GM-CSF have been shown to induce tumor-specific immunity (3 , 9 , 10) . However, expression of cytokines by gene transfer procedure requires viral vectors and establishment of cell lines that are not desirable and are time consuming under clinical settings. Moreover, primary tumor cells are not very receptive for gene transfer. To circumvent these problems, many investigators have used different strategies, such as coinjecting tumors with fibroblasts secreting cytokines (11) or biodegradable gelatin polymers encapsulated with cytokines with tumor cell preparations (12) . We have investigated whether the expression of cytokines, such as IL-12, on a tumor cell surface in GPI-anchored form will be effective in inducing antitumor immune response. This form of cytokine could be used in a protein transfer technique to modify tumor membranes for vaccine preparation (13) . Moreover, membrane-associated cytokines may serve as a slow release depot at the immunization site.

In this study, we have attached a GPI anchor to both subunits of mouse IL-12 and expressed them on the tumor cell surface. Results show that the GPI-anchored IL-12 can stimulate T cells and can induce antitumor immune response in mice. These findings suggest that the expression of cytokines on tumor cell membranes may be an alternative approach to deliver cytokines for tumor vaccination.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines, mAbs, and Cytokines.
Murine mastocytoma (P815) and rat hybridomas against murine MHC class I (M1/42), CD54 (YN1.1), CD80 (1G10), and CD24 (M1/69) were purchased from American Type Culture Collection (Manassas, VA). Rat antimurine IL-12 hybridomas (C15.6 and C17.8) were kind gifts from Dr. Trinchieri (Wistar Institute, Philadelphia, PA). P815 cells were cultured in cDMEM [DMEM supplemented with 5% fetal bovine serum, 2 mM Glutamax I (Invitrogen, Carlsbad, CA), 1 mM sodium pyruvate, 100 units/ml penicillin, 100 µg/ml streptomycin, 55 µM ß-mercaptoethanol, and 50 µg/ml gentamicin]. The hybridomas were maintained in RPMI 1640 supplemented with 10% calf serum (Hyclone, Logan, UT), 2 mM glutamine, and other additives at concentrations mentioned above (complete RPMI 1640). All cell culture reagents were purchased from Mediatech, Inc. (Herndon, VA), unless indicated. Unconjugated and horseradish peroxidase- or FITC-conjugated-F(ab')2 goat antimouse IgG and F(ab')2 goat-antirat IgG were purchased from Jackson Immunochemicals (West Grove, PA). Mouse antihuman IFN-{gamma} mAbs (clones 2G1 and B133.5) were purchased from Pierce Endogen (Rockford, IL). Rat anti-murine IFN-{gamma} mAbs (clones R4-6A2 and XMG1.2) were kind gifts from Dr. K. Ziegler (Emory University, Atlanta, GA).

Construction of GPI-IL-12 and secIL-12 cDNAs.
A mammalian expression vector cassette with GPI-anchor signal sequence of CD59 (containing AflII linker at the 5' end of CD59 cDNA) was constructed by cloning a truncated human CD80-CD59 cDNA in pcDNA3neo (Invitrogen) at EcoRV/ApaI sites (Fig. 1A)Citation . This expression vector cassette was used to make cDNAs encoding the GPI-anchored form of mouse IL-12 (GPI-IL-12). IL-12 is a disulfide-linked heterodimer consisting of Mr 35,000 (p35) and Mr 40,000 (p40) polypeptides (9) . The coding regions (excluding the stop codon) of both subunits of IL-12 were PCR amplified using pNGVL3-IL-12 cDNA as the template using Pfu DNA polymerase (Stratagene, La Jolla, CA). The primers to amplify p35 cDNA were forward (catccagcagctcctctca) and reverse (cattgcttaaggcggagctcagatagccc); the following forward (gcacatcagaccaggcagct) and reverse (ccattgcttaaggatcggaccctgcagggaa) primers were used to amplify cDNA encoding the p40 subunit of IL-12. The reverse primers were designed to have an AflII linker (underlined). The truncated CD80 cDNA was excised from the tCD80-CD59-pcDNA3neo mammalian expression vector with EcoRV/AflII, which leaves the GPI-anchor addition signal sequence of CD59 with the vector cassette (Fig. 1A)Citation . The AflII-digested PCR products of p35 and p40 cDNAs were then cloned into the cassette containing a GPI-anchor addition signal sequence of CD59 at the EcoRV/AflII sites. Using this strategy, both p35-CD59 and p40-CD59 cDNAs were cloned into pcDNA3neo mammalian expression vector (Fig. 1A)Citation , and the p35-CD59 cDNA was further subcloned into the pUB6bla vector (Invitrogen). cDNA encoding secIL-12 was mobilized from pNGVL3-IL-12 and cloned into pUB6bla (pUB6bla-secIL-12) at KpnI and ApaI sites.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Chimeric recombinant IL-12-CD59 is expressed as a GPI-anchored form. A, a schematic of the strategy to construct chimeric GPI-IL-12. A mammalian expression vector cassette with GPI-anchor signal sequence of CD59 (containing an AflII linker at 5' end of CD59 cDNA) was used to construct cDNAs encoding recombinant GPIanchored IL-12. This expression vector cassette was constructed by cloning a truncated human CD80-CD59 cDNA in pcDNA3neo (p-tCD80-CD59) at EcoRV/ApaI sites. cDNAs encoding the GPI-anchored form of p35 and p40 subunits of mouse IL-12 were cloned into the expression vector cassette in pcDNA3neo at EcoRV/AflII sites. To have double selection after transfection, the p35-CD59 cDNA was mobilized from pcDNA3neo and subcloned into pUB6bla at KpnI and ApaI sites. Restriction enzymes AflII, ApaI, EcoRV, and KpnI are represented as A, Ap, E, and K, respectively. B, flow cytometric analysis of P815-GPI-IL-12 cells. P815 cells (top) were transfected with GPI-IL-12 cDNAs to establish P815-GPI-IL-12 cells as described in "Materials and Methods." P815-GPI-IL-12 cells were treated without (middle) or with (bottom) PIPLC. Cells were immunostained with anti-IL-12 or anti-MHC class I mAbs (filled histogram) or nonbinding rat IgG control (open histogram), followed by FITC-conjugated goat antirat IgG. The cells were analyzed in a FACScan flow cytometer. Number in the box, the mean fluorescent value for IL-12 expression.

 
Establishing Transfectants Expressing GPI-anchored or secIL-12.
P815 transfectants expressing GPI-IL-12 were established by transfecting murine p35-CD59-pUB6bla (10 µg) and p40-CD59-pcDNA3neo (10 µg) cDNAs by electroporation using a Bio-Rad gene pulser II (Hercules, CA). The electroporation was performed using the cells in serum-free RPMI 1640 pulsed at 960 µF and 0.25 kV/cm. After 48 h of transfection, the GPI-IL-12+ cells were enriched by biomagnetic selection using anti-IL-12 mAb (C17.8) and sheep antirat IgG magnetic beads (10 beads/cell) and two cycles of a panning method as described earlier (14) . The enriched GPI-IL-12+ cells (uncloned) were cultured in cDMEM containing 10 µg/ml blasticidin and 1 mg/ml G418. P815 cells secreting IL-12 (P815-secIL-12) were established by transfecting pUB6bla-secIL-12 cDNA. Cells secreting IL-12 were selected in cDMEM containing 10 µg/ml blasticidin. Single-cell clones of P815-GPI-IL-12 and secIL-12 were established by limited dilution cloning. The uncloned and cloned P815-GPI-IL-12 transfectants were used in this study. To determine the cell surface expression of IL-12, MHC class I, CD54, CD80, and CD24 on uncloned and cloned populations, the cells were stained with the appropriate mAbs and analyzed using a FACScan flow cytometer (Becton-Dickinson, San Jose, CA). To confirm the GPI linkage of cell surface-expressed IL-12, cells were treated with PIPLC (14) , followed by flow cytometric analysis. To determine the growth characteristics of GPI-IL-12+ tumor cells in vitro, P815 or P815-GPI-IL-12 cells (1 x 103) were cultured in cDMEM for 24 h at 37°C. The cells were then pulsed with [3H]thymidine (1 µCi/well) and incubated for another 18 h. [3H]Thymidine uptake was determined in a Packard top count scintillation counter.

Preparation of Isolated Membrane Vesicles from P815-GPI-IL-12 Transfectants.
Isolated membranes were prepared from P815 and P815-GPI-IL-12 cells by sucrose gradient ultracentrifugation, as described earlier (13 , 15) . Membranes were resuspended in protein-free RPMI 1640 with antibiotics and frozen in aliquot at -80°C. Protein concentrations of membranes were determined by the Bio-Rad dye-binding method using BSA as a standard. The expression of GPI-IL-12 and other surface markers on the isolated membranes were determined by ELISA using appropriate mAbs, as described earlier (15) . To quantitate IL-12 expressed on isolated membranes, GPI-IL-12+ isolated membranes (150 µg) were lysed in 20 mM Tris-HCl (pH 8.0) containing 1% octyl ß-glucoside for 1 h and centrifuged at 20,000 x g for 1 h to collect clear lysate. IL-12 in the lysate was determined by sandwich ELISA using anti-IL-12 mAbs (C17.8 and biotinylated-C15.6) and horseradish peroxidaseconjugated avidin. Color was developed using 3,3',5,5'-tetramethylbenzidine as substrate, and the reaction was stopped with 2 N H2SO4. The color that developed was read at 415 nm in an ELISA microplate reader (Molecular Devices, Sunnyvale, CA). Isolated membranes prepared from P815 cells were treated identically and used as a negative control.

Proliferation of PHA-activated Human T Cells and ConA-activated Murine Splenocytes.
T cells were enriched from peripheral blood mononuclear cells isolated from healthy donors as described (15) . PHA-activated human T cells were prepared using 1% PHA (Invitrogen) by standard procedure (16) . P815 and P815-GPI-IL-12 cells (stimulators) were treated with 50 µg/ml mitomycin C for 30 min at 37°C, washed extensively with complete RPMI 1640, and used in the proliferation assays. PHA-activated T cells (responders) were cocultured with mitomycin C-treated stimulator cells for 72 h. Cells were pulsed with 1 µCi/well [3H]thymidine (Amersham, Arlington Heights, IL) for the final 18 h and harvested using a Packard filtermate cell harvester (Meriden, CT). [3H]Thymidine uptake was counted in a Packard top count microplate scintillation and luminescence counter (Downers Grove, IL). Similarly, proliferation of ConA-activated splenocytes (responder) was done by coculturing responders with mitomycin C-treated stimulator cells for 72 h. The uptake of [3H]thymidine after an 18-h pulse with [3H]thymidine (1 µCi/well) was determined as described above.

MLTR and IFN-{gamma} Release Assay.
An allogeneic MLTR assay was carried out to determine the efficacy of GPI-IL-12 to induce alloantigen-specific T-cell stimulation. Mitomycin C-treated P815 (H-2d) or P815-GPI-IL-12 cells were cocultured for 72 h with unactivated splenocytes of C57BL/6 (H-2b) mice. Murine rsIL-12 was included as a positive control. The MLTR cultures were centrifuged, and the supernatant was analyzed for the release of IFN-{gamma} to determine the IL-12-dependent T-cell stimulation. IFN-{gamma} release was determined by sandwich ELISA using corresponding mAb pairs. Similarly, to determine the IL-12-dependent stimulation of activated T cells, P815-GPI-IL-12 cells or membranes isolated from P815-GPI-IL-12 cells were cocultured with ConA-activated mouse splenocytes or PHA-activated human T cells as responders. The release of IFN-{gamma} by activated T cells was used as a measure to determine the IL-12-dependent T-cell stimulation. Supernatants were collected after 48 h, and the release of human or murine IFN-{gamma} was determined by sandwich ELISA using paired mAbs.

Tumor Challenge Studies.
Female DBA/2 mice (6–8 weeks) were purchased from the Jackson Laboratory (Bar Harbor, ME) and maintained in the Emory University animal facility according to the regulations of the Institutional Animal Care and Use Committee. Mice (5–10 mice/group) were challenged (s.c.) with P815 or P815-GPI-IL-12 or P815-secIL-12 cells (5 x 105 cells/mice) and were monitored twice a week for tumor growth. Two measurements of tumors that are perpendicular to each other were measured using vernier calipers. Tumor size (mm2) was quantitated by multiplying the two diameters for each mouse in control and experimental groups. Mice were euthanized when tumor size reached >2 cm. To determine the presence of IL-12 in the systemic circulation, 3 mice/group received injections of serum-free RPMI 1640 or live P815, P815-GPI-IL-12, or P815-secIL-12 cells (5 x 105 cells in 200 µl of serum-free RPMI). Serum samples were collected and pooled (3 mice/group), and IL-12 and IFN-{gamma} in serum samples were quantitated by sandwich ELISA using appropriate mAbs.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chimeric IL-12-CD59 Is Expressed on the Cell Surface as a GPI-anchored Protein.
The cDNAs encoding the entire coding region of the p35 and p40 subunits of mouse IL-12 were ligated in-frame to a GPI-anchor addition signal sequence of CD59 in a mammalian expression vector cassette (Fig. 1A)Citation . Stable transfectants of a murine mastocytoma, P815, expressing mouse GPI-IL-12 were established by cotransfecting chimeric cDNAs of p35 and p40 subunits, as described in "Materials and Methods." Flow cytometric analysis of the P815-GPI-IL-12 transfectants showed cell surface expression of IL-12 (Fig. 1B)Citation . In addition, the expression of other cells surface markers, such as MHC class I, was not altered in these transfectants, as compared with the P815 cells (Fig. 1B)Citation . More than 90% of the GPI-IL-12 protein expressed on transfected cells was released by PIPLC treatment (Fig. 1B)Citation , indicating that the IL-12 is anchored to the cell surface via a GPI moiety.

Cell Surface-expressed GPI-IL-12 Induces T-Cell Proliferation.
Murine rsIL-12 has been shown to stimulate activated human and murine T cells (16) . Therefore, the functional integrity of GPI-IL-12 was determined for its ability to induce the proliferation of activated T cells. PHA-activated human T cells were cocultured with mitomycin C-treated P815-GPI-IL-12 cells. GPI-IL-12+ cells induced T-cell proliferation, and levels of proliferation were similar to those obtained using 0.5 ng/ml of rsIL-12 (Fig. 2A)Citation . Similarly, the ability of GPI-IL-12+ cells to induce the proliferation of ConA-activated murine splenocytes was also determined. P815-GPI-IL-12 cells were able to induce proliferation of ConA-activated splenocytes over P815 cells (Fig. 2B)Citation . It has been shown that some GPI-anchored proteins, such as CD16B, are released from the cell surface (17) . Therefore, to determine whether the induction of T-cell proliferation was mediated by the cell surface-expressed GPI-IL-12 and not because of shedding or secretion of IL-12, P815 and P815-GPI-IL-12 cells were cultured in cDMEM, and supernatants were collected after 48 h. Supernatants were centrifuged at 100,000 x g to remove any membrane fragments or particulate materials and tested for the presence of IL-12 in a T-cell proliferation assay using PHA-activated human T cells. As shown in Fig. 2CCitation , mitomycin C-treated P815-GPI-IL-12 induced proliferation of PHA-activated human T cells, whereas P815 or P815-CD86 cells did not. However, under similar assay conditions, the supernatant obtained from P815-GPI-IL-12 cells did not induce proliferation, suggesting that there is no detectable level of IL-12 released into the supernatant from P815-GPI-IL-12 cells. These findings indicate that GPI-IL-12 is expressed as a functionally active heterodimer on the cell surface.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Cell surface-expressed GPI-IL-12 stimulates T-cell proliferation. A, GPI-IL-12 expressed on mastocytoma cells induces proliferation of PHA-activated human T cells. Mitomycin C-treated P815 or P815-GPI-IL-12 cells (3 x 103/well) were cocultured with PHA-activated human T cells (104/well) for 72 h. Cells were harvested after an 18-h pulse with [3H]thymidine (1 µCi/well), and uptake of [3H]thymidine was counted using a Packard top count microplate scintillation and luminescence counter. The data are the means of triplicate values; bars, SD. B, GPI-IL-12 induces proliferation of ConA-activated mouse splenocytes. Splenocytes (from C57BL/6 mice) were activated with ConA (1 µg/ml) for 72 h. Mitomycin C-treated P815-GPI-IL-12 or P815 cells (3 x 103/well) were cocultured with ConA-activated splenocytes (104/well) for 72 h. Cells were pulsed with [3H]thymidine (1 µCi/well) for the last 18 h and harvested, and the uptake of [3H]thymidine was measured as described in A. Results are the means of triplicate values; bars, SD. C, the proliferation of activated T cells is mediated by the cell surface-expressed GPI-IL-12. Supernatants obtained from P815 and P815-GPI-IL-12 cells were centrifuged at 100,000 x g to remove any particulate material. The supernatant (100 µl) was added to the PHA-activated human T cells (104 cells in 100 µl), and the proliferation assay was done as described in "Materials and Methods" and in A. Mitomycin C-treated P815-GPI-IL-12 cells (3 x 103/well) was used as a positive control, and P815 and P815-CD86 cells (3 x 103/well) were included as negative controls. Values are means of triplicates; bars, SD.

 
GPI-IL-12 Induces the Release of IFN-{gamma} by Activated Splenocytes.
It has been well established that IL-12 can stimulate T and natural killer cells and induce the release of Th1-type cytokines such as IFN-{gamma} (9) . Therefore, the ability of the cell surface-expressed GPI-IL-12 in inducing the release of IFN-{gamma} was tested. P815 cells did not induce IFN-{gamma} release from the activated cells. However, coculturing P815-GPI-IL-12 cells induced IFN-{gamma} release by ConA-activated splenocytes (Fig. 3A)Citation .



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. GPI-IL-12 induces IFN-{gamma} release by T cells. A, GPI-IL-12 induces the release of IFN-{gamma} by ConA-activated splenocytes. ConA-activated mouse splenocytes (104/well) were cocultured with mitomycin C-treated P815 or P815-GPI-IL-12 cells (5 x 103/well). The supernatants were collected after 48 h, and the release of IFN-{gamma} was determined by sandwich ELISA using anti-murine IFN-{gamma} mAbs. Values are means of triplicate wells; bars, SD. B, GPI-IL-12 induces the release of IFN-{gamma} by allogeneic splenocytes. Splenocytes (104/well) from C57BL/6 mice (H-2b) were cocultured with P815 (H-2d) or P815-GPI-IL-12 cells (104/well). Supernatants were collected after a 72-h coculture, and the release of IFN-{gamma} was determined by sandwich ELISA. Values are means; bars, SD. C, P815-GPI-IL-12 membrane vesicles induce the release of IFN-{gamma} by activated murine splenocytes. Isolated membrane vesicles were prepared from P815-GPI-IL-12 cells. ConA-activated splenocytes (104/well) were cultured in the presence of GPI-IL-12+-isolated P815 membranes () or rsIL-12 ({square}). After 48 h, IFN-{gamma} released into the supernatant was quantitated by sandwich ELISA. To normalize the value for the IL-12 concentration, IL-12 expressed on the isolated membranes prepared from P815-GPI-IL-12 cells was determined by sandwich ELISA using anti-IL-12 mAbs as described in "Materials and Methods." Values are means of triplicate wells; bars, SD. Splenocytes cultured in the presence of membranes from P815 or medium alone were used as negative controls and represent zero IL-12 concentrations for rsIL-12 and P815-GPI-IL-12 membranes, respectively.

 
Augmentation of Allogeneic T-Cell Stimulation by GPI-IL-12.
The induction of allogeneic T-cell stimulation by GPI-IL-12 was determined in a MLTR assay. Unactivated splenocytes from C57BL/6 mice (H-2b) were cocultured with mitomycin C-treated P815 (H-2d) or P815-GPI-IL-12 cells. IFN-{gamma} released by the stimulated allogeneic splenocytes was measured to determine the IL-12-dependent T-cell stimulation. The addition of P815-GPI-IL-12 cells induced the release of IFN-{gamma} as compared with P815 control (Fig. 3B)Citation . Similar levels of IFN-{gamma} were observed when allogeneic splenocytes were cocultured with P815 cells mixed with rsIL-12. Under similar conditions, very low levels of IFN-{gamma} release by allogeneic T cells were seen in the presence of rsIL-12 alone, and P815 cells did not induce the release of IFN-{gamma}. These findings indicate that the increased release of IFN-{gamma} seen with P815-GPI-IL-12 is attributable to augmentation of alloantigen-mediated T-cell stimulation.

Membrane Vesicles Isolated from P815-GPI-IL-12 Cells Induce Release of IFN-{gamma} by Activated T Cells.
A potential application of making GPI-anchored cytokines such as GPI-IL-12 is that the purified GPI-IL-12 can be used to modify isolated tumor membranes for vaccine preparation by a protein transfer approach (13 , 15) . Moreover, the isolated tumor cell membranes expressing GPI-IL-12 can also be used as a vaccine for intratumoral administration. Therefore, the isolated cell membranes were prepared from P815-GPI-IL-12 cells and determined whether it can induce stimulation of activated T cells. The isolated membranes showed the expression of GPI-IL-12 and other surface markers such as MHC class I and CD54 (data not shown). The release of IFN-{gamma} by ConA-activated murine splenocytes and PHA-activated human T cells was used as a measure to determine the IL-12-dependent T-cell stimulation. The addition of GPI-IL-12+ isolated cell membranes in the proliferation assay resulted in the release of IFN-{gamma} by ConA-activated splenocytes. The level of IFN-{gamma} release induced by the GPI-IL-12+ isolated cell membranes is comparable with that seen with rsIL-12. Membranes prepared from P815 cells did not induce the release of IFN-{gamma} from the activated cells. Similarly, membranes prepared from P815-GPI-IL-12 cells also showed an increase in IFN-{gamma} release by PHA-activated human T cells (data not shown). These findings indicate that the isolated membranes expressing GPI-IL-12 retained its functional activity to stimulate activated T cells.

Antitumor Immune Response Induced by GPI-IL-12 Expressed on Tumor Cells.
Before using the P815-GPI-IL-12 transfectants in animal studies, the growth characteristics of P815-GPI-IL-12 cells in vitro were determined in a proliferation assay as described in "Materials and Methods." The basal proliferation of P815 and P815-GPI-IL-12 cells were similar (data not shown), indicating that transfecting GPI-IL-12 into mastocytoma cells did not change the growth characteristics of the cells in vitro. The ability of cell surface-expressed GPI-IL-12 to induce antitumor immune response in vivo was determined using a highly tumorigenic and moderately immunogenic mastocytoma tumor model. Mice were inoculated with live P815 or P815-GPI-IL-12 cells and monitored for tumor development and survival. To compare the efficiency of secretory versus GPI-anchored IL-12 in inducing an antitumor response tumor, studies were done using P815 cells expressing GPI-IL-12 (uncloned cells established by panning) or cloned P815-GPI-IL-12 or P815-secIL-12 cells. The mice inoculated with control P815 cells developed tumors by day 10, and the tumors grew progressively (Fig. 4A)Citation . All of the mice in this control group were either dead or euthanized (when the tumors reached the allowed limit), 44 days after inoculation of P815 cells (Fig. 4B)Citation . However, all of the mice inoculated with uncloned P815-GPI-IL-12 cells survived and were tumor free up to 55 days (Fig. 4)Citation . Tumors developed only after 55 days of tumor inoculation in 40% of mice, and all of the mice in this group developed tumors by day 80. Interestingly, all of the mice inoculated with cloned P815-GPI-IL-12 or P815-secIL-12 cells were tumor free even after 75 days (Fig. 4)Citation . To determine whether the tumors developed in mice that received injections of uncloned P815-GPI-IL-12 cells still express transfected-GPI-IL-12 in the absence of selection pressure, tumors were excised from one of the mice challenged with P815-GPI-IL-12 cells. Tumor cells were isolated by collagenase and dispase treatment, and the cell surface expression of IL-12 and other antigens were determined by flow cytometry. The expression levels of MHC class I and CD54 were not altered; however, the expression of GPI-IL-12 was completely lost in these tumor cells (data not shown).



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Induction of antitumor immune response by GPI-IL-12. DBA/2 mice (5–10/group) were inoculated s.c. in the right flank with 5 x 105 live P815 ({triangleup}) or uncloned P815-GPI-IL-12 ({bullet}) or cloned P815-GPI-IL-12 ({square}) or P815-secIL-12 () cells. The mice were monitored for tumor incidence (A) and tumor size (B) after tumor inoculation, as described in "Materials and Methods."

 
Next, we determined whether the antitumor immune response induced by GPI-IL-12 is attributable to either systemic or local effect. Mice were inoculated with live P815-GPI-IL-12 or P815-secIL-12 or wild-type P815 cells or RPMI 1640 medium alone. Serum samples were collected for 3 days, and serum IL-12 and IFN-{gamma} levels were estimated by sandwich ELISA. There was no difference in serum IL-12 levels between mice that received injections of P815-GPI-IL-12 or P815 cells or RPMI 1640 medium. However, under identical conditions, the serum IL-12 levels were increased ~2-fold after 3 days in mice that received injections of P815-secIL-12 cells (data not shown). We have also determined the serum IFN-{gamma} as a measure of IL-12 in the systemic circulation of these mice. Serum IFN-{gamma} levels were the same in mice that were given injections of P815-GPI-IL-12 or P815 cells or RPMI 1640 medium alone (data not shown). However, a time-dependent increase in IFN-{gamma} (2- and 4-fold at days 2 and 3 after inoculation, respectively) was seen in mice that received injections of P815-secIL-12 cells. These findings suggest that the antitumor immune response induced by GPI-IL-12 may be mediated by local effect, whereas secIL-12 may act through entering the systemic circulation. However, more detailed studies are needed to address the exact mechanism(s) of antitumor immune response induced by GPI-IL-12.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Recently, we have used a novel protein transfer approach using GPI-anchored costimulatory cell adhesion molecules to develop cancer vaccines (13 , 15) . GPI-anchored proteins have a unique property to intercalate spontaneously into the outer leaflet of the lipid bilayer. With the advent of recombinant technique, we (14) and others (18) have converted transmembrane proteins to GPI-anchored cell surface proteins. Using this approach, EG7 tumor membranes modified with GPI-CD80 have been shown to induce a potent antitumor immune response in the murine thymoma model (13) , suggesting that tumor membranes modified with GPI-anchored costimulatory molecules could be used as an effective cancer vaccine.

The present study investigated whether introducing a cytokine on tumor membranes as a GPI-anchored form can induce antitumor immune response. In this study, IL-12 was used as a model cytokine to determine whether the membrane-expressed GPI-anchored form of cytokine can induce an antitumor immune response. IL-12 is known to activate and enhance the development of antigen-specific CTLs (9) and can also attract inflammatory cells, natural killer cells, T cells, and other antigen-presenting cells to the vaccination site for a potent immune response (9) . Moreover, expression of IL-12 has been shown to induce antitumor immunity in many tumor systems (11 , 19 , 20) . The study presented here shows that GPI-anchored IL-12 is fully functional in inducing the proliferation of activated T cells and induction of IFN-{gamma} production by T cells. Our results also show that cell surface expression of IL-12 as a GPI-anchored form on mastocytoma completely protected the mice up to 55 days when challenged with uncloned cells. However, tumors developed after 55 days. Interestingly, all of the mice inoculated with cloned P815-secIL-12 or cloned P815-GPI-IL-12 cells were tumor free up to 95 days. This suggests that the tumor formation after 55 days in mice that received the injections of uncloned P815-GPI-IL-12 cells may be attributable to antigenic heterogeneity in cultured P815 cells. Using this tumor system, it has been shown that after nearly complete rejection, P815 tumors reappear after 55 days, and this is because of the emergence of escape variants with the loss of CTL epitopes (21) . Interestingly, analysis of surface markers on tumor cells excised from the tumors that appeared after 55 days showed that these tumors lost the expression of surface IL-12 (data not shown). This could be attributable to the lack of a selection marker for the transfectants in vivo. At present it is not clear whether reappearance of the tumors seen in our studies after an initial protection in an uncloned population is attributable to one or a combination of the following mechanisms: (a) the loss of IL-12 expression on tumor cells; (b) the loss of antigenic epitopes; and/or (c) a short-lived memory response induced by IL-12-expressing tumors. Additional studies are necessary to address these possibilities.

Studies have shown that other cytokines such as IL-2, IL-3, IL-4, and GM-CSF (22, 23, 24) are effective in stimulating immune cells when they are expressed on cell membranes. Tumors transfected with polypeptide membrane-anchored GM-CSF induced an antitumor immune response in mice (24) . The advantage of GPI-anchored cytokines over polypeptide-anchored cytokines is that the isolated tumor cell membranes can be modified within 2–4 h to express the desired cytokines by protein transfer for administration in clinical settings (13 , 15) . This procedure does not involve any viral vectors or live cells. Recently, we have shown that membranes prepared from surgically removed human tumor tissue can be modified to express GPIanchored costimulatory adhesion molecules (15) . Furthermore, isolated membranes that were frozen for 2 years can also be modified to express the desired GPI-anchored costimulatory molecules by protein transfer (15) . Such modified membranes efficiently provided costimulation for T-cell proliferation in vivo and in vitro (13 , 15) . Apart from the advantage of GPI-anchored cytokine use in protein transfer studies, isolated tumor membranes expressing GPI-anchored cytokines may also form a slow release depot at the immunization site. Furthermore, GPI-anchored cytokines incorporated onto cell membranes can form an insoluble depot at the immunization site and may last longer as compared with soluble cytokines. The availability of cytokines at the immunization site will bring immune cells to the vaccination site for better antigen uptake and stimulation, thus increasing the efficiency of cancer vaccines. The tumor membranes modified with GPI-anchored cytokines thus provide an alternative form of cytokine delivery to enhance antitumor immune response.


    ACKNOWLEDGMENTS
 
We thank Drs. A. M. Jabbar, G. Trinchieri, K. Ziegler, and J. M. Boss for providing IL-12 cDNA, antimouse IL-12 mAbs, antimouse IFN-{gamma} mAbs, and pUB6 vector, respectively. We thank Neil Poloso and Drs. V. Udhayakumar and U. M. Nagarajan for critical review of the manuscript, and we thank Barbara Sullivan for help in obtaining blood samples from mice.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by NIH Grant RO1 AI30631. Back

2 To whom requests for reprints should be addressed, at Department of Pathology and Laboratory Medicine, Room 7309, Woodruff Memorial Research Building, 1639 Pierce Drive, Emory University, Atlanta, GA 30322. E-mail: pselvar{at}emory.edu Back

3 The abbreviations used are: IL, interleukin; rsIL, recombinant soluble IL; GM-CSF, granulocyte/macrophage colony-stimulating factor; GPI, glycosylphosphatidyl inositol; mAb, monoclonal antibody; pUB6bla, pUB6blasticidin; secIL-12, secretory IL-12; PIPLC, phosphatidylinositol-specific phospholipase C; ConA, concanavalin A; PHA, phytohemagglutinin; MLTR, mixed lymphocyte tumor reaction. Back

Received 11/13/01. Accepted 3/18/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Pardoll D. M. Paracrine cytokine adjuvants in cancer immunotherapy. Annu. Rev. Immunol., 13: 399-415, 1995.[Medline]
  2. Trinchieri G. Biological properties and therapeutic applications of interleukin 12. Eur. Cytokine Netw., 8: 305-307, 1997.[Medline]
  3. Mach N., Dranoff G. Cytokine-secreting tumor cell vaccines. Curr. Opin. Immunol., 12: 571-575, 2000.[Medline]
  4. Rosenberg S. A., Mule J. J., Spiess P. J., Reichert C. M., Schwarz S. L. Regression of established pulmonary metastases and subcutaneous tumor mediated by the systemic administration of high-dose recombinant interleukin 2. J. Exp. Med., 161: 1169-1188, 1985.[Abstract/Free Full Text]
  5. Tepper R. I., Pattengale P. K., Leder P. Murine interleukin 4 displays potent antitumor activity in vivo. Cell, 57: 503-512, 1989.[Medline]
  6. Brunda M. J., Luistro L., Warrier R. R., Wright R. B., Hubbard B. R., Murphy M., Wolf S. F., Gately M. K. Antitumor and antimetastatic activity of interleukin 12 against murine tumors. J. Exp. Med., 178: 1223-1230, 1993.[Abstract/Free Full Text]
  7. Nastala C. L., Edington H. D., McKinney T. G., Tahara H., Nalesnik M. A., Brunda M. J., Gately M. K., Wolf S. F., Schreiber R. D., Storkus W. J., et al Recombinant IL-12 administration induces tumor regression in association with IFN-{gamma} production. J. Immunol., 153: 1697-1706, 1994.[Abstract]
  8. Marshall E. Cancer trial of interleukin 12 halted. Science (Wash. DC), 268: 1555 1995.[Free Full Text]
  9. Trinchieri G., Scott P. Interleukin 12: basic principles and clinical applications. Curr. Top. Microbiol. Immunol., 238: 57-78, 1999.[Medline]
  10. Dranoff G., Jaffee E., Lazenby A., Golumbek P., Levitsky H. I., Brose K., Jackson V., Hamada H., Pardoll D., Mulligan R. C. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting antitumor immunity. Proc. Natl. Acad. Sci. USA, 90: 3539-3543, 1993.[Abstract/Free Full Text]
  11. Tahara H., Zeh H. J., III, Storkus W. J., Pappo I., Watkins S. C., Gubler U., Wolf S. F., Robbins P. D., Lotze M. T. Fibroblasts genetically engineered to secrete interleukin 12 can suppress tumor growth and induce antitumor immunity to a murine melanoma in vivo. Cancer Res., 54: 182-189, 1994.[Abstract/Free Full Text]
  12. Golumbek P. T., Azhari R., Jaffee E. M., Levitsky H. I., Lazenby A., Leong K., Pardoll D. M. Controlled release, biodegradable cytokine depots: a new approach in cancer vaccine design. Cancer Res., 53: 5841-5844, 1993.[Abstract/Free Full Text]
  13. McHugh R. S., Nagarajan S., Wang Y. C., Sell K. W., Selvaraj P. Protein transfer of glycosylphosphatidylinositol-B7-1 into tumor cell membranes: a novel approach to tumor immunotherapy. Cancer Res., 59: 2433-2437, 1999.[Abstract/Free Full Text]
  14. McHugh R. S., Ahmed S. N., Wang Y-C., Sell K. W., Selvaraj P. Construction, purification, and functional reconstitution on tumor cells of glycolipid-anchored human B7-1 (CD80). Proc. Natl. Acad. Sci. USA, 92: 8059-8063, 1995.[Abstract/Free Full Text]
  15. Poloso N., Nagarajan S., Bumgarner G. W., Selvaraj P. Development of therapeutic vaccines by direct modification of cell membranes from surgically removed human tumor tissue with immunostimulatory molecules. Vaccine, 19: 2029-2038, 2001.[Medline]
  16. Schoenhaut D. S., Chua A. O., Wolitzky A. G., Quinn P. M., Dwyer C. M., McComas W., Familletti P. C., Gately M. K., Gubler U. Cloning and expression of murine IL-12. J. Immunol., 148: 3433-3440, 1992.[Abstract]
  17. Huizinga T. W. J., Van Der Schoot C. E., Jost C., Klaassen R., Kleijer M., Von dem Borne A. E. G. K., Roos D., Tetteroo P. A. T. The PI-linked receptor FcRIII is released on stimulation of neutrophils. Nature (Lond.), 333: 667-669, 1988.[Medline]
  18. Medof M. E., Nagarajan S., Tykocinski M. L. Cell-surface engineering with GPI-anchored proteins. FASEB J., 10: 574-586, 1996.[Abstract]
  19. Rao J. B., Chamberlain R. S., Bronte V., Carroll M. W., Irvine K. R., Moss B., Rosenberg S. A., Restifo N. P. IL-12 is an effective adjuvant to recombinant vaccinia virus-based tumor vaccines: enhancement by simultaneous B7-1 expression. J. Immunol., 156: 3357-3365, 1996.[Abstract]
  20. Coughlin C. M., Wysocka M., Trinchieri G., Lee W. M. The effect of interleukin 12 desensitization on the antitumor efficacy of recombinant interleukin 12. Cancer Res., 57: 2460-2467, 1997.[Abstract/Free Full Text]
  21. Uyttenhove C., Maryanski J., Boon T. Escape of mouse mastocytoma P815 after nearly complete rejection is due to antigen-loss variants rather than immunosuppression. J. Exp. Med., 157: 1040-1052, 1983.[Abstract/Free Full Text]
  22. Liger D., Nizard P., Gaillard C., vanderSpek J. C., Murphy J. R., Pitard B., Gillet D. The diphtheria toxin transmembrane domain as a pH-sensitive membrane anchor for human interleukin 2 and murine interleukin 3. Protein Eng., 11: 1111-1120, 1998.[Abstract/Free Full Text]
  23. Kim Y. S., Sonn C. H., Paik S. G., Bothwell A. L. Tumor cells expressing membrane-bound form of IL-4 induce antitumor immunity. Gene Ther., 7: 837-843, 2000.[Medline]
  24. Soo Hoo W., Lundeen K. A., Kohrumel J. R., Pham N. L., Brostoff S. W., Bartholomew R. M., Carlo D. J. Tumor cell surface expression of granulocyte-macrophage colony-stimulating factor elicits antitumor immunity and protects from tumor challenge in the P815 mouse mastocytoma tumor model. J. Immunol., 162: 7343-7349, 1999.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagarajan, S.
Right arrow Articles by Selvaraj, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagarajan, S.
Right arrow Articles by Selvaraj, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online