
[Cancer Research 62, 3009-3013, June 1, 2002]
© 2002 American Association for Cancer Research
T-cell Factor-4 Frameshift Mutations Occur Frequently in Human Microsatellite Instability-high Colorectal Carcinomas but Do Not Contribute to Carcinogenesis1
Stefan Ruckert2,
Elke Hiendlmeyer2,
Wolfgang M. Brueckl2,
Ursula Oswald,
Kurt Beyser,
Wolfgang Dietmaier,
Angela Haynl,
Claudia Koch,
Josef Rüschoff,
Thomas Brabletz,
Thomas Kirchner and
Andreas Jung3
Pathologisches Institut [S. R., E. H., U. O., A. H., C. K., T. B., T. K., A. J.] and Medizinische Klinik I [W. M. B.] der Friedrich-Alexander-Universität Erlangen-Nürnberg, D-91054 Erlangen; Institut für Pathologie, Klinikum Kassel, 34125 Kassel [K. B., J. R.]; and Pathologisches Institut der Universität Regensburg, 93053 Regensburg [W. D.], Germany
 |
ABSTRACT
|
|---|
Colorectal carcinomas with microsatellite instability accumulate errors in short repetitive DNA repeats, especially mono and dinucleotide repeats. One such error-prone A9 monorepeat is found in exon 17 of the TCF-4 gene. TCF-4 and ß-catenin form a transcription complex, which is important for both maintenance of normal epithelium and development of colorectal tumors. To elucidate the relevance of frameshift mutations in the TCF-4 in colorectal carcinogenesis, a variety of investigations in human tumors and cell lines was performed. It was found that mutations in the TCF-4 A9 repeat do not contribute to tumorigenesis and seem to be passenger mutations.
 |
Introduction
|
|---|
Mutations of the tumor suppressor gene APC4 are found in the majority of sporadic CRC (6080%), mostly in the MCR (1)
. Sporadic CRC can be divided into two subgroups, based on the functional status of their mismatch repair system. Colorectal tumors with defective mismatch repair, mostly because of deficits of hMLH-1 or hMSH-2, cannot repair errors made by DNA polymerases in microsatellites, which are short DNA tandem repeats (2)
. These tumors display a phenotype of MSI and comprise
15% of all CRC. The remaining 85% have stable microsatellites (MSS). About 60% of colorectal MSI tumors accumulate frameshift mutations in A or, less frequently, G-stretches in the MCR of APC, whereas
80% of the MSS tumors show mainly transitions or transversions in the same region (3)
. The lower number of APC mutations in colorectal MSI tumors is supplemented by mutations in other genes that are part of the canonical WNT signal transduction pathway (4)
, which is linked to colorectal carcinogenesis (1
, 5) , e.g., mutations are found in exon 3 of the ß-catenin gene (6)
or exon 7 of the axin-2/conductin gene (7)
in
25% of all MSI-H cases each and
39% of MSI-H cases in exon 17 (8)
of the TCF-4 gene (9)
. Mutations in the axin-2/conductin gene and in most of the TCF-4 cases (8)
are found in short monorepeats, whereas mutations in the destruction box of the ß-catenin gene are mostly transitions or transversions (6)
. Moreover, mutations in the APC or ß-catenin genes are found to be mutually exclusive (10)
. Mutations in the tumor suppressor APC occur very early during CRC development and are the rate-limiting step; thus, APC has been termed the gatekeeper (5)
. Altogether, this indicates a high selection pressure for the presence of the oncogenic transcription factor ß-catenin in colorectal carcinogenesis because of loss of degradation (1)
. Consequently, mutation of the A9 repeat in exon 17 of the TCF-4 gene should result in a gain of transcriptional activity, e.g., via loss of binding sites for suppressive molecules, such as CtBP (8)
or Grg/TLE family members (11)
, and concomitantly, loss of binding of chromatin remodeling complexes containing Osa/Brahma (12)
. Such altered TCF-4 molecules could have either a higher affinity for the binding of ß-catenin or could facilitate the structural reorganization of chromatin (13)
, thus leading to transcriptional activation. On the other hand, TCF-4 mutations may have only modifying effects in the process of colorectal carcinogenesis or may exhibit passenger mutations without affecting carcinogenesis, as MSI-H tumors show a predisposition for mutation of short monorepeats (14)
. Inactivation of TCF-4 by mutation seems to be rather unlikely, as mice lacking TCF-4 die shortly after birth because of a general defect in the genetic maintenance program of crypt cells of the small intestine (15)
. To investigate the possible role of mutations in the A9 stretch in exon 17 of the TCF-4 gene for colorectal carcinogenesis in greater depth, we screened a panel of 46 human MSI-H colorectal tumors for these TCF-4 mutations and alterations of the ß-catenin gene exon 3 and compared this spectrum of mutations with the morphology of the tumors. Next, we performed transient transfection experiments using the TOP-FLASH system as a readout for ß-catenin activity. Finally, we generated a mutated TCF-4 A8 (A8 repeat) using in vitro mutagenesis and compared its transactivation capacity with that of WT TCF-4 in the TOP-FLASH system to shed light on the functional consequences of this mutation for transactivation. It was revealed that mutations of the A9 monorepeat in exon 17 of TCF-4 had no significant effect and thus may contribute only marginally to the carcinogenesis of colorectal tumors or are only passenger mutations (14)
.
 |
Materials and Methods
|
|---|
Detection of MSI and Mutations in the TCF-4 and ß-catenin Genes.
Paraffin-embedded tumor tissue of patients with CRC from the archives of the Institutes for Pathology in Erlangen, Kassel, and Regensburg, Germany were screened for MSI as described elsewhere (16)
. Briefly, tissue sections were stained using monoclonal antibodies specific for MLH-1 (clone 168-1; PharMingen, Heidelberg, Germany) and MSH-2 (NA27; Oncogene, Schwalbach, Germany). Cases displaying loss of either MLH-1 or MSH-2 expression were tested for MSI using DNA isolated from microdissected areas containing tumor or normal colonic epithelium as template, using hereditary nonpolyposis colorectal carcinoma MSI Test kits (Roche Diagnostics, Mannheim, Germany) following Roches recommendations. MSI-H was scored when at least two of the markers BAT25, BAT26, D2S123, D5S346, or D17S250 were found to be unstable in tumors compared with normal tissue. Tumors (46) fulfilling these criteria were selected. The status of the A9 repeat of exon 17 in the TCF-4 gene was tested using fragment analysis. Briefly, DNA obtained from normal or tumor tissue by microdissection was used together with the primer pair GTTTCTTGCCTCTATTCACAGATAACTC (6-FAM labeled) and GTTTCTTGTTCACCTTGTATGTAGCGAA (Interactiva, Ulm, Germany) in PCR reactions [1 x Ampli-Taq Gold buffer, 1 unit of Ampli-Taq Gold (Applied Biosystems, Weiterstadt, Germany), 2.5 mM MgCl2, 200 µM deoxynucleotide triphosphates, and 200 nM primers; 35 cycles with annealing at 58°C and a final extension step at 72°C for 45 min]. Both primers carried a GTTTCTT sequence at their 5' ends to suppress the addition of extra A residues at the 3' end of the complementary DNA strand during PCR (17)
. Consequently, nearly single peak fractions for A9 or A8 PCR product were seen after electrophoretic separation using POP-4 (4% w/v performance optimized polymer) and short capillaries on a Genetic Analyser 310 (all Applied Biosystems). Threshold values discriminating the three possible allelic distributions of the A9 repeat in the TCF-4 gene (A9/A9 = A9, A9/A8 = het, and A8/A8 = A8) were generated by simply dividing the values of the A9 peaks by the A8 peaks obtained from DNA isolated from CRC cell lines SW480 (A9), LS174T (het), and Lovo (A8). All PCR products resulting in borderline values were confirmed by sequence analysis using the primer GTTCACCTTGTATGTAGCGAA and Big Dye terminator sequencing kits (Applied Biosystems) following the manufacturers recommendations. ß-catenin exon 3 mutations were detected using TCCAATCTACTAATGCTAATACT and CATTGCCTTACTGAAAGTCAG in a first and CTACTAATGCTAATACTGTTTCG and CAAGTAGCTGGTAAGAGTATTA primers in a second nested PCR [1 x Ampli-Taq Gold buffer, 1 unit of Ampli-Taq Gold (Applied Biosystems), 2.5 mM MgCl2, 200 µM deoxynucleotide triphosphates, and 200 nM primers; 35 cycles with annealing at 57°]. Sequencing was performed as described above using CTACTACTGCTAATACTGTTTCG (forward) and TAATACTCTTACCAGCTACTTG (reverse) primers after purification of the PCR products using PCR purification kits (InVitrogen, Karlsruhe, Germany) following InVitrogens recommendations.
Generation of pTCF-4 A8.
An A8 mutation was introduced into the WT TCF-4-encoding expression vector pTCF-4 (gift from Bert Vogelstein) using Quickchange kits (Stratagene, Heidelberg, Germany) and the double-stranded oligonucleotide GCCCTTGCAGGAGAAAAAAAAGTGCGTTCGCTAC. Success of mutation, giving rise to the expression vector pTCF-4 A8, was verified by sequencing using the primer CAGACCTCAGCGCTCCTAAG (16241605, acc. no.Y11306) as described above.
Transient Transfection Assays.
HCT116, Lovo, LS174T, SW48 (MSI), HT29, SW480 (MSS), and 293T (human embryonic kidney) cells (American Type Culture Collection, Manassas, VA) were maintained in DMEM containing 50 µM 2-mercaptoethanol and 10% (v/v) FCS (InVitrogen). Cells were cotransfected with constant amounts (90 ng) of the firefly luciferase reporter constructs TOP-FLASH or FOP-FLASH (gifts from Hans Clevers) as a readout for ß-catenin/TCF-4 activity and 10 ng of the renilla luciferase reporter construct ptk-RL (Promega, Heidelberg, Germany) for standardization of transfections, using 0.7 µl of Superfect (Qiagen, Hilden, Germany). In other experiments, various amounts of expression vectors p
45ß-catenin, pTCF-4, pdnTCF-4 (gifts from Bert Vogelstein), and pTCF-4 A8 were cotransfected in 48 cluster well plates together with TOP-FLASH reporter constructs. pcI-neo (Promega) or pcDNA3.1 f(-) (InVitrogen) was added to make up DNA to constant amounts of 360 ng. After overnight incubation (1826 h), cells were harvested, and luciferase values were analyzed using Dual Light kits (Promega) following Promegas recommendations. All transfections were done at least in triplicates. For comparison of ß-catenin/TCF-4 activity, FOP-FLASH values were set to 1, and TOP-FLASH values were based on this value.
 |
Results
|
|---|
Mutations in the A9 repeat in the TCF-4 exon 17 (Fig. 1, A and B)
were found in 33.3% of investigated cases (15 of 45, 1 case failed). Only 1 case in our collection exhibited a homozygous mutation (Fig. 1A)
. Exon 3 mutations in the destruction box of ß-catenin were found in 10.5% of cases (4 of 38, 7 cases failed) in codons 32, 39, 41, and 45 (data not shown). Both values fall within the range of published data (6
, 9)
. Moreover, the 4 cases displaying ß-catenin mutations possessed heterozygous mutations in the TCF-4 gene simultaneously. First of all, we compared the mutation state of TCF-4 and ß-catenin with the histology of the tumors, as different growth patterns have been described for MSI-CRC. This may be because of the genetic profile of the tumors (2
, 18)
. But irrespective of TCF-4 or ß-catenin mutations, our MSI-H colorectal tumors displayed both 21 well-differentiated (Fig. 2, AD)
and 25 poorly differentiated tumors (Fig. 2, EG)
. No correlation between growth pattern of tumors and mutations in the TCF-4 or ß-catenin genes was found. For homozygous TCF-4 mutations (A8), a comparison was not possible as just a single case with a well-differentiated growth pattern (Fig. 2A)
made up this group in our collection. Secondly, we considered whether mutations in the A9 repeat of TCF-4 influence the activity of ß-catenin/TCF-4 complexes, as A8 mutations lead to a loss of both binding sites for the negative regulator CtBP (Fig. 4A)
. Moreover, it cannot be excluded that TCF-4 and TCF-4 A8 differ with respect to their binding to other proteins, as loss of the COOH terminus may affect the tertiary structure of TCF-4 (Fig. 4A)
.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 1. Sequence of PCR products generated from DNA of tumors from patients (AC) or cell lines (DF) showing homozygous (A8; A and D) or heterozygous mutations (het; B and E) or WT TCF-4 sequences (A9; C and F).
|
|

View larger version (122K):
[in this window]
[in a new window]
|
Fig. 2. H&E-stained histological sections of colorectal tumors displaying well (AD) or poorly differentiated growth patterns (EG). Mutation state of the TCF-4 and ß-catenin genes is given. WT TCF-4 (TCF-4), heterozygous mutated TCF-4 (TCF-4 het), homozygous mutated TCF-4 (TCF-4 A8), WT ß-catenin (ß-cat WT), and mutated ß-catenin (ß-cat Mut).
|
|
Therefore, transient transfections were performed. First of all, the behavior of our TCF-4 expression clone was investigated, as TCF-4 is known to be an ambivalent transcription factor that can either activate or suppress transcription (11)
. 293T cells were transiently transfected with increasing amounts of pTCF-4, which resulted in an optimum curve with the rather low amount of 1.6 ng of pTCF-4 yielding the maximum transactivation value (Fig. 3A
, black bars). The addition of pdn-TCF-4, even at higher amounts, led to an additional suppression compared with TCF-4 (Fig. 3
A, striped bars). Thus, the observed suppressive effects induced by higher amounts of pTCF-4 are specific. Next, MSI and MSS cell lines were transiently transfected with the reporter constructs TOP-FLASH and FOP-FLASH, and the activity of the cell lines (Fig. 3B)
was compared, assuming that mutations in the TCF-4 gene will affect ß-catenin/TCF-4-induced transcription. However, no gross difference was observed between the different cell lines, especially comparing Lovo cells (TCF-4 A8) and MSS cell lines SW480 and HT29 (Fig. 3B)
expressing WT TCF-4. Thus, mutations in the A9 repeat of TCF-4 exon 17 do not effectively influence the ß-catenin-mediated transactivation rate. Thirdly, it could be possible that binding of TCF-4 to DNA is affected indirectly by mutations in the A9 repeat, again because of effects on the structure of the whole molecule. Therefore, we performed competition experiments by transiently cotransfecting TOP-FLASH reporter with plasmids expressing dominant negative TCF-4 (dnTCF-4). Assuming a different affinity of TCF-4 A8 for DNA, one would expect different dose-dependent suppression behavior of cell lines with different TCF-4 forms (A9, het, A8). But again, no gross difference was observed between Lovo, LS174T, HCT116, or SW48 cells (Fig. 3C)
, and, thus, mutations in the A9 repeat of TCF-4 do not strongly influence the ß-catenin transactivation system. Unfortunately, LS174T and Lovo, besides their TCF-4 A8 mutation, have additional alterations in their ß-catenin, APC, or other genes, respectively (Fig. 3C)
, so the effects of TCF-4 mutations on the ß-catenin system may be masked and are hence not comparable. Thus, we finally constructed a mutated form of TCF-4 (pTCF-4 A8) by in vitro mutagenesis, which carries an A8 instead of the A9 repeat (Fig. 4B)
. This expression plasmid was transiently cotransfected with the reporter construct TOP-FLASH and constitutively active ß-catenin expression plasmid p
45-ß-catenin into 293T cells. pTCF-4 was used in concentrations at which it had suppressive effects (Fig. 3A)
, because it was expected that loss of both CtBP-binding sites in the TCF-4 molecule should lead to loss of suppression. Both pTCF-4 and pTCF-4 A8 inhibited the activity built up by p
45-ß-catenin in a comparable dose-dependent manner (Fig. 4C)
. Thus, mutations of the A9 monorepeat in exon 17 of the TCF-4 gene do not seem to influence the activity of ß-catenin and may therefore be only accompanying passenger mutations.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 3. In A, luciferase activity of TOP-FLASH luciferase constructs in 293T cells is dependent on the amount of TCF-4 present and can be suppressed specifically by the addition of dn-TCF-4. B, luciferase activity of TOP-FLASH luciferase constructs in comparison with FOP-FLASH (set to 1) of MSI and MSS colorectal cell lines. C, luciferase activity of TOP-FLASH reporter constructs in MSI colorectal cell lines cotransfected with increasing amounts (90 or 135 ng) of pdnTCF-4 of DNA. The value for TOP-FLASH without the addition of pdnTCF-4 (0 ng) was set to 1. Mutation state of the TCF-4, ß-catenin, and APC genes for the four MSI cell lines used. For an explanation of TCF-4 nomenclature, see the legend to Fig. 2
. For ß-catenin and APC, the numbers given indicate the codons affected by mutation.
|
|
 |
Discussion
|
|---|
The collection used in this study is a homogeneous MSI-H group of colorectal carcinomas and displays mutation rates for TCF-4 and ß-catenin, as well as histological patterns that have been described previously (6
, 9
, 18)
. Therefore, we consider our tumor collection to be valid for deducing the function of TCF-4. The ambiguity of the sequence data (Fig. 1, A and D)
is probably attributable to the structure of the PCR products, because sequences generated from subcloned PCR products no longer show this ambiguity (data not shown). Moreover, the sequence AAAAAAAACT is clearly readable (Fig. 1, A and D)
, which stands in contrast with sequence data from heterozygous PCR products (het). Sequences generated from PCR products of heterozygous tumors show ambiguities throughout the total sequence, whereas homozygous A8 stretch-based PCR products show up again later, with clearly readable sequences. As a clear distinction of the three combinations of the TCF-4 alleles was possible, despite some sequence ambiguity, this procedure was favored because of the chance of higher throughput compared with subcloning. Firstly, we wanted to see whether mutations in the TCF-4 or ß-catenin genes were connected with distinctive growth patterns, but no correlation between the mutation status of TCF-4 or ß-catenin and growth pattern could be found. APC mutation screening was not included, as we had no fresh material from these tumors, and sequencing of the complete APC gene or even the MCR from DNA isolated from paraffin-embedded tissue is tedious work. However, it has been described that mutations in the ß-catenin and APC genes are found to be mutually exclusive (10)
and that APC mutations occur in
60% of MSI colorectal tumors (3)
. If APC mutations are involved in the determination of growth patterns, then the amount of well-differentiated versus poorly differentiated tumors should be distributed in a 40:60 manner or vice versa. In our collection, the value was 21:25. Although both the theoretical and our observed values are quite similar, we do not believe that either TCF-4, ß-catenin, or APC mutations on their own, or in combination, contribute to the growth pattern of CRC. Instead, we have data showing that the subcellular distribution of ß-catenin is highly correlated with different growth patterns.5
Secondly, the overlapping mutation pattern of ß-catenin and TCF-4 mutations is inconsistent with the supposed mutual exclusivity of ß-catenin and APC mutations (10)
. This exclusive behavior of ß-catenin and APC mutations supports yet another view, namely that after mutating one element of the WNT signaling pathway, other elements are excluded from further mutation. Otherwise, double mutations of ß-catenin and APC should have been found, by chance alone. Moreover, the coincidence of ß-catenin or APC alterations on the one hand and TCF-4 mutations on the other is also found in cell lines. An additional challenge to the function of TCF-4 A8 mutation in colorectal carcinogenesis is the observation that the majority of TCF-4 mutations in our colorectal tumors are heterozygous. Of course, it can be argued that the analysis of mutation in our collection is misleading, as the microdissection still contained some nontumor cells, feigning heterozygosity. Therefore, thirdly, transient transfections were performed in a variety of MSI and MSS CRC cell lines (Fig. 3, AC)
, using the TOP-FLASH/FOP-FLASH readout for ß-catenin activity. Again, no marked differences between the cell lines differing in their TCF-4 status were observed. Moreover, all tested lines behaved similarly in that dnTCF-4 was able to suppress the ß-catenin built-up reaction in a comparable dose-dependent manner. Thus, the mutated TCF-4 A8 form found in the cell lines does not seem to differ with respect to DNA-binding affinity. It may be that cell type-specific alterations or features of the chosen MSI and MSS colorectal cell lines make results using the TOP-FLASH system not comparable. Thus, we finally devised an experimental system with which we could analyze the effect of A8 mutations on the same genetic background. An A8 repeat was generated by site-directed mutagenesis in the expression plasmid pTCF-4 (Fig. 4C)
. The TCF-4 isoform encoded by pTCF-4 consists of exons 12-35-67 (103 bp)-89 (126 bp)-10-11-1213-1417 (418 bp), numbering according to Duval et al. (8)
, with the A9 repeat at the beginning of exon 17, which encodes both of the CtBP-binding sites (8)
. Again, no marked difference was seen in the modulation of TOP-FLASH activity between TCF-4 and TCF-4 A8. In particular, this last experiment strongly supports the idea that TCF-4 mutations occurring with high frequency during carcinogenesis of CRC are only passenger mutations (14)
or are at least of only minor importance. Although we have analyzed just one of the many described TCF-4 isoforms (8)
, we suggest extending our results to all isoforms containing exon 17 as part of their reading frame. Because the only known interacting partner for the exon 17 corresponding COOH-terminal fragment of TCF-4 is CtBP, loss of this domain should contribute comparable effects. Besides, the interaction domain for proteins of the Grg family, which is encoded roughly by exons 39 of TCF-4 and lies just NH2-terminally adjacent to the HMG domain, seems to be very important for repression. Drosophila Grg has been shown to interact with Osa-containing brahma chromatin-remodeling complexes, which lead to repression of Wnt target genes. If armadillo (Drosophilas ß-catenin) joins pangolin (Drosophilas TCF), it replaces Grg and, thus, this repressive chromatin-remodeling complex (12)
. Moreover, it has been shown that ß-catenin interacts with a mammalian Brg-1 chromatin-remodeling complex (brahma homologue), which confers transcriptional activity (19)
. Thus, the role of ß-catenin/TCF-4 complexes may be the organization of chromatin, giving other gene-specific transcription factors the capability to transactivate gene expression. This would explain the low transcriptional activation mediated by ß-catenin/TCF-4 and the many ß-catenin target genes that have been described up to now. It would now be interesting to screen for TCF-4 mutations in human colorectal tumors in the range of exons 39 and check if mutations interfere with binding to Grg family proteins. Such mutations are expected to confer gain of function character, and in this sense, TCF-4 would be an oncogene. But the situation becomes more complex for several reasons: (a) all members of the Grg family bind to the members of the TCF/LEF family with different affinity, and Grg and TCF/LEF members are expressed in different cell lines in different combinations (20)
; (b) LEF-1 is expressed in colorectal tumors but not in normal colonic tissue (21)
; whether LEF-1- and TCF-4-induced transcriptomes are identical is not clear, especially in the light of data showing that different HMG proteins make specific DNA contacts besides the central WWCAAAG sequence via factor-specific flanking regions (22)
; and (c) TCF-4 is expressed in many isoforms in colorectal tumor cells (8)
. Altogether, this increase in combinatorial possibilities may make it difficult to elucidate the role of TCF/LEF factors for colorectal carcinogenesis.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Bert Vogelstein for the generous gift of expression clones pcDNA-myc-TCF-4 (pTCF-4), pcDNA-myc-dnTCF-4 (pdnTCF-4), and pcI-
45-ß-catenin (p
45-ß-catenin) and Hans Clevers for the luciferase reporter constructs TOP-FLASH and FOP-FLASH. We also thank Richard Hamelin for sharing invaluable sequence information of TCF-4 exon 17 before publishing. We thank Katja Bräutigam for expert technical assistance, Kerstin Amann for providing her digital photo-equipment, and Stephen Köver for critical reading and discussion.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by grants from Wilhelm-Sander Stiftung (Az.: 99.065.1; to A. J., T. B., and T. K.), DFG: DI 722/1-1 (to W. D.), Deutsche Krebshilfe: Verbundprojekt erbliches Dickdarmkarzinom (to J. R. and W. D.), and Krebshilfeprojekt: Erbliches Dickdarm-Karzinom (Fö-Nr. 70-2401-Rü1; to J. R.). 
2 S. R., E. H., and W. M. B. contributed equally to this manuscript. 
3 To whom requests for reprints should be addressed, at Pathologisches Institut, Krankenhausstr. 8-10, 91054 Erlangen, Germany. Phone: 49 (9131)-8522610; Fax: 49 (9131)-8524745; E-mail: andreas.jung{at}patho.imed.uni-erlangen.de 
The abbreviations used are: APC, adenomatous polyposis coli; HMG, high mobility group; CRC, colorectal cancer; CtBP, COOH-terminal-binding protein; Grg, groucho; TLE, transduction-like enhancer of split; LEF, lymphocyte enhancer-binding factor; WT, wild-type; MCR, mutation cluster region; MSI, microsatellite instability; MSI-H, microsatellite instability-high; MSS, microsatellite stability; TCF, T-cell factor; MLH, mutL homologue; MSH, mutS homologue.
4 Manuscript in preparation. 
Received 2/13/02.
Accepted 4/19/02.
 |
REFERENCES
|
|---|
-
Bienz M., Clevers H. Linking colorectal cancer to Wnt signaling. Cell, 103: 311-320, 2000.[Medline]
-
Jass J. R. Towards a molecular classification of colorectal cancer. Int. J. Colorectal Dis., 14: 194-200, 1999.[Medline]
-
Huang J., Papadopoulos N., McKinley A. J., Farrington S. M., Curtis L. J., Wyllie A. H., Zheng S., Willson J. K., Markowitz S. D., Morin P., Kinzler K. W., Vogelstein B., Dunlop M. G. APC mutations in colorectal tumors with mismatch repair deficiency. Proc. Natl. Acad. Sci. USA, 93: 9049-9054, 1996.[Abstract/Free Full Text]
-
Kuhl M., Sheldahl L. C., Park M., Miller J. R., Moon R. T. The Wnt/Ca2+ pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet., 16: 279-283, 2000.[Medline]
-
Kinzler K. W., Vogelstein B. Lessons from hereditary colorectal cancer. Cell, 87: 159-170, 1996.[Medline]
-
Polakis P. Wnt signaling and cancer. Genes Dev., 14: 1837-1851, 2000.[Free Full Text]
-
Liu W., Dong X., Mai M., Seelan R. S., Taniguchi K., Krishnadath K. K., Halling K. C., Cunningham J. M., Qian C., Christensen E., Roche P. C., Smith D. I., Thibodeau S. N. Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating ß-catenin/TCF signaling. Nat. Genet., 26: 146-147, 2000.[Medline]
-
Duval A., Rolland S., Tubacher E., Bui H., Thomas G., Hamelin R. The human T-cell transcription factor-4 gene: structure, extensive characterization of alternative splicings, and mutational analysis in colorectal cancer cell lines. Cancer Res., 60: 3872-3879, 2000.[Abstract/Free Full Text]
-
Duval A., Gayet J., Zhou X. P., Iacopetta B., Thomas G., Hamelin R. Frequent frameshift mutations of the TCF-4 gene in colorectal cancers with microsatellite instability. Cancer Res., 59: 4213-4215, 1999.[Abstract/Free Full Text]
-
Sparks A. B., Morin P. J., Vogelstein B., Kinzler K. W. Mutational analysis of the APC/ß-catenin/Tcf pathway in colorectal cancer. Cancer Res., 58: 1130-1134, 1998.[Abstract/Free Full Text]
-
Roose J., Clevers H. TCF transcription factors: molecular switches in carcinogenesis. Biochim. Biophys. Acta, 1424: M23-M37, 1999.[Medline]
-
Collins R. T., Treisman J. E. Osa-containing Brahma chromatin remodeling complexes are required for the repression of wingless target genes. Genes Dev., 14: 3140-3152, 2000.[Abstract/Free Full Text]
-
Eastman Q., Grosschedl R. Regulation of LEF-1/TCF transcription factors by Wnt and other signals. Curr. Opin. Cell Biol., 11: 233-240, 1999.[Medline]
-
Zhang L., Yu J., Willson J. K., Markowitz S. D., Kinzler K. W., Vogelstein B. Short mononucleotide repeat sequence variability in mismatch repair-deficient cancers. Cancer Res., 61: 3801-3805, 2001.[Abstract/Free Full Text]
-
Korinek V., Barker N., Moerer P., van Donselaar E., Huls G., Peters P. J., Clevers H. Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4. Nat. Genet., 19: 379-383, 1998.[Medline]
-
Dietmaier W., Wallinger S., Bocker T., Kullmann F., Fishel R., Ruschoff J. Diagnostic microsatellite instability: definition and correlation with mismatch repair protein expression. Cancer Res., 57: 4749-4756, 1997.[Abstract/Free Full Text]
-
Brownstein M. J., Carpten J. D., Smith J. R. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques, 20: 1004-1006, 10081010, 1996.[Medline]
-
Ruschoff J., Dietmaier W., Luttges J., Seitz G., Bocker T., Zirngibl H., Schlegel J., Schackert H. K., Jauch K. W., Hofstaedter F. Poorly differentiated colonic adenocarcinoma, medullary type: clinical, phenotypic, and molecular characteristics. Am. J. Pathol., 150: 1815-1825, 1997.[Abstract]
-
Barker N., Hurlstone A., Musisi H., Miles A., Bienz M., Clevers H. The chromatin remodeling factor Brg-1 interacts with ß-catenin to promote target gene activation. EMBO J., 20: 4935-4943, 2001.[Medline]
-
Brantjes H., Roose J., van De Wetering M., Clevers H. All Tcf HMG box transcription factors interact with Groucho-related co-repressors. Nucleic Acids Res., 29: 1410-1419, 2001.[Abstract/Free Full Text]
-
Hovanes K., Li T. W., Munguia J. E., Truong T., Milovanovic T., Lawrence Marsh J., Holcombe R. F., Waterman M. L. ß-catenin-sensitive isoforms of lymphoid enhancer factor-1 are selectively expressed in colon cancer. Nat. Genet., 28: 53-57, 2001.[Medline]
-
van Beest M., Dooijes D., van De Wetering M., Kjaerulff S., Bonvin A., Nielsen O., Clevers H. Sequence-specific high mobility group box factors recognize 1012-base pair minor groove motifs. J. Biol. Chem., 275: 27266-27273, 2000.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
E. Hiendlmeyer, S. Regus, S. Wassermann, F. Hlubek, A. Haynl, A. Dimmler, C. Koch, C. Knoll, M. van Beest, U. Reuning, et al.
{beta}-Catenin Up-Regulates the Expression of the Urokinase Plasminogen Activator in Human Colorectal Tumors
Cancer Res.,
February 15, 2004;
64(4):
1209 - 1214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Daidone, A. Costa, M. Frattini, D. Balestra, L. Bertario, M. A. Pierotti, B. M. Boman, T. Zhang, and J. Z. Fields
Correspondence re: T. Zhang et al., Evidence That APC Regulates Survivin Expression: A Possible Mechanism Contributing to the Stem Cell Origin of Colon Cancer. Cancer Res., 61: 8664-8667, 2001.
Cancer Res.,
January 15, 2004;
64(2):
776 - 779.
[Full Text]
[PDF]
|
 |
|