Cancer Research AACR Legacy Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, E. J.
Right arrow Articles by Bowden, G. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, E. J.
Right arrow Articles by Bowden, G. T.
[Cancer Research 62, 3044-3047, June 1, 2002]
© 2002 American Association for Cancer Research

Carcinogenesis

A Dominant Negative c-jun Specifically Blocks Okadaic Acid-induced Skin Tumor Promotion1

Eric J. Thompson, Jacalyn MacGowan, Matthew R. Young, Nancy Colburn and G. Tim Bowden2

Department of Pharmacology and Toxicology, The University of Arizona, Tucson, Arizona 85724 [E. J. T., G. T. B.]; Department of Radiation Oncology, Arizona Cancer Center, The University of Arizona, Tucson, Arizona 85724 [J. M., G. T. B.]; and Basic Research Laboratory, National Cancer Institute, Frederick, Maryland 21702 [M. R. Y., N. C.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Okadaic acid (OA) is a prototypical non-phorbol ester skin tumor-promoting agent that works by inhibiting protein phosphatases, leading to an increase in protein phosphorylation. Increased protein phosphorylation can lead to stimulated signaling through various signal transduction pathways. One or more of the pathways affected by OA leads to increased signaling via the activator protein 1 (AP-1) transcription factor. Because AP-1 signaling has been shown to be required for skin tumor promotion by phorbol ester, studies were undertaken to determine whether AP-1 signaling is also required for 7,12-dimethylbenz(a)anthracene (DMBA)-initiated/OA-promoted skin tumorigenesis. Transgenic mice expressing a dominant negative c-jun (TAM-67) controlled by the keratin 14 promoter in ICR mice were used to determine the effects of OA on AP-1 signaling. By crossing the TAM-67 mice with mice expressing an AP-1-responsive luciferase, it was shown that TAM-67 decreases AP-1 activation in response to OA treatment by 95%. After 7,12-dimethylbenz(a)anthracene initiation, the TAM-67 mice and nontransgenic littermates were promoted with twice weekly applications of OA. These experiments showed that TAM-67 expression decreased tumor multiplicity by 90%. Additional experiments with TAM-67 mice showed that the hyperplastic response to OA is not impaired in these mice, nor were there differences in OA-induced transcription of various genes known to be AP-1 responsive under other conditions. This result suggests that only a subset of AP-1-regulated genes is targeted by TAM-67 when it prevents tumor promotion by OA. A determination of the mechanism by which TAM-67 can block tumor promotion without affecting hyperplasia will be important.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
OA3 is a non-phorbol ester tumor promoter. OA is a diarrheic shell fish toxin isolated from black sponges (1) . The OA family of toxins includes microcystin-LR, a hepatotoxin. Microcystin is a potent liver tumor-promoting agent in rats (2) . Microcystin in contaminated drinking water may be the cause of elevated rates of primary liver cancer in some areas of China (2) . Microcystin-LR has been shown to mediate tumor promotion via inhibition of protein phosphatase type 1 and type 2A (3) . Similarly, OA acts by inhibiting protein phosphatases 1, 2A, and 3, which leads to an increase of the phosphorylated forms of such proteins as Cdc25, histone H1, phosphorylase kinase, PKA, PKB, PKC, I{kappa}B kinases, and cyclin-dependent kinases (4 , 5) . The absence of the dephosphorylation control of these kinases can lead to an increase in proliferation, aberrant mitosis, or growth arrest, depending on the cell type. It has been suggested that the effects of the OA class of tumor promoters are mediated in part by the transcription factor AP-1 (6) .

The AP-1 transcription factor is a dimer consisting of 18 different combinations of Jun-Jun or Jun-Fos proteins. The Jun family of proteins includes c-Jun, JunB, and JunD. The Fos family of proteins includes c-Fos, FosB, Fra-1, and Fra-2 (7) . AP-1 activation can affect proliferation, cell cycle, growth arrest, and apoptosis (7) . In particular, AP-1 has been shown to regulate cyclin D1, p53, p21 (cip1/waf1), p19 (ARF), and p16 (7) . Thus, the effect of AP-1 activation in some cases closely parallels treatment with OA. In the mouse transformed keratinocyte 308 cell line, the major components of the OA-activated AP-1 complex are JunD and FosB (8) . OA has been shown to activate extracellular signal-regulated kinase 1/2, which in turn can phosphorylate and activate JunD and FosB in 308 cells (9) . OA also induces expression of urokinase-type plasminogen activator and stromelysin-1 in vivo, both of which are known to be regulated by AP-1 (10) . Thus, the transcription factor AP-1 plays a crucial role in the biological effects of OA.

Nonmelanoma skin cancer is often studied using the two-stage model of mouse skin carcinogenesis. In this model, a single dose of an initiating agent is used, followed by multiple doses of a tumor-promoting agent. This results in formation of benign papillomas. The initiating agent for these studies is often DMBA. Chronic exposure to tumor-promoting agents such as phorbol esters results in the development of papillomas. The archetypical phorbol ester is TPA. TPA has been found to activate the AP-1 family of transcription factors. Thus, TPA induces gene transcription that eventually leads to the formation of benign tumors (11) .

There is evidence that AP-1 contributes to all of the stages of skin tumor promotion/progression. The role of AP-1 in skin tumor promotion/progression was first suggested by experiments in JB6 cells in which promotion-sensitive (P+) cells but not promotion-resistant (P-) cells were shown to have elevated AP-1 activity in response to agents known to cause transformation of P+ cells (12) . The importance of this activity has been demonstrated using AP-1 inhibitors, dominant negative c-jun, or all-trans-retinoic acid (13) to block transformation by TPA or epidermal growth factor. The evidence that AP-1 plays a role in maintenance of the malignant phenotype comes from studies of cell systems. In one model, Domann et al. studied the papilloma-forming cell line 308 and a malignant variant, 10Gy5 (14) . In this model, they found that the malignant cells had constitutive elevation of AP-1 binding and transactivation. This was associated with an increase in expression of c-jun and c-fos. The elevated AP-1 activity was also associated with increased expression of the MMPs stromelysin-1 and urokinase-type plasminogen activator. Further evidence for the role of AP-1 in tumor formation comes from studies of the mechanism of action of phenolic antioxidants. This work showed that the phenolic antioxidant BHQ induced expression of members of the fos family that have low transactivation potential. This work showed that AP-1 complexes induced by BHQ could block activation of AP-1 activity by TPA, thus providing a possible mechanism of BHQ activity by decreasing the transactivation potential of AP-1 complexes (15) .

One way to study the role of specific proteins in carcinogenesis is to create a dominant negative. Brown et al. (16) created an NH2-terminal deletion of c-jun, removing the transactivation domain. This protein, called TAM-67, inhibits AP-1-induced transcription when expressed in cells (16) . Whereas the wild-type c-Jun can transform normal rat embryo cells in cooperation with an activated c-Ha-ras, TAM-67 cannot (16) . Expression of TAM-67 significantly decreased the transformation of JB6 cells after treatment with tumor-promoting compounds such as TPA and epidermal growth factor (13) . In addition, stable expression of TAM-67 in 308 cells was shown to block TPA-induced Matrigel invasion (17) . TAM-67 expression in malignant cells blocked tumor formation upon s.c. injection into athymic nude mice (18) . These results demonstrate that TAM-67 can influence important events in tumorigenesis.

To directly test the importance of AP-1 in skin tumor promotion in vivo, Young et al. (19) created a transgenic mouse that expresses TAM-67 in the skin driven by the K14 promoter. Transgenic TAM-67 mice developed significantly fewer tumors when treated with a DMBA/TPA protocol for skin tumor promotion. It would therefore be of interest to determine whether the requirement for AP-1 activation extends to other tumorigenesis protocols. To address this issue, we have bred K14-TAM-67 mice onto an ICR background, a strain of mouse susceptible to OA-induced skin tumor promotion. We have treated these mice with a DMBA initiation, OA promotion protocol. We found that these mice developed fewer tumors than their wild-type littermates, demonstrating that TAM-67 specifically inhibits skin tumor promotion. These results support the notion that tumor promoter-induced AP-1 activity is important for skin tumor promotion by an environmentally relevant agent and can thus be considered as a relevant molecular target for cancer prevention.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Breeding of Transgenic Mouse Lines.
K14-TAM-67 (19) and AP-1-Luc (20) mice were obtained from Dr. Colburn (National Cancer Institute-Frederick) on a DBA/2 genetic background. Both of these transgenes were bred onto the ICR genetic background by crosses with ICR mice from Harlan Sprague Dawley (Indianapolis, IN). After generation N5, these mice were used in experiments. Offspring carrying the K14-TAM-67 transgene and/or AP-1 Luc transgene were identified by PCR analysis of tail DNA using the following primers: hK14 primers (GenBank accession number U11076; 1693–1717 and 2205–2181 bp) with H-Ras primers 7816 (cacccccactaagcctgttgttttgcaggac) and 7817 (gctagccataggtggctcacctgtactgatg) or Luc primers gcggaatacttcgaaatgtcc and ccttaggtaacccagtagatcc (19) .

RNA Isolation.
Tissues for RNA expression were harvested from animals after CO2 asphyxiation. Full thickness dorsal skin was snap-frozen in liquid nitrogen. Epidermis was separated from the dermis as described previously (19 , 21) . For RT-PCR, 10–1.5-mm ear punches were harvested. All tissue was pulverized in liquid nitrogen with a mortar and pestle and immediately placed in extraction buffer, homogenized, and extracted with phenol-chloroform using a Totally RNA kit (Ambion, Austin, TX).

RT-PCR.
Two-tube RT-PCR was performed as described by the Qiagen protocol for Omniscript reverse transcriptase. Total RNA was primed using 200 ng of each antisense primer (5'-ggccctcctgttattatgg-3' for mouse GAPDH and 5'-tggataagggaatggttgg-3' for the human growth hormone incorporated with the TAM-67 transgene). The reverse transcription reaction was followed by 40 cycles of PCR. Sense primers were 5'-aagattgtcagcaatgcatcc-3' for GAPDH and 5'-aacatgctcagggaacagg-3' for TAM-67.

Assays of AP-1-Luc Activity.
AP-1-Luc activity was measured in AP-1-Luc+/K14-TAM-67- mice and in their AP-1-Luc+/K14-TAM-67+ siblings. Mice were treated with 100 µl of acetone on the left ear and 100 µl of OA (2 µg) on the right ear. After 24 h, six ear punches of 1.5 mm were collected. The Luc activity of these samples was determined. A BCA protein assay (Pierce, Rockford, IL) was then performed, and relative light units (RLU) was normalized to protein amount.

Two-stage Skin Carcinogenesis.
Dorsal skins of 8-week-old mice were shaved, and 2 days later, a single dose of 100 µg (390 nmol) of DMBA (Sigma, St. Louis, MO) in 200 µl of acetone was applied. One week after initiation, mice were treated with 2 µg of OA (Alexis, San Diego, CA) in 200 µl of acetone twice a week for 20 weeks.

OA Induction of Hyperproliferation and AP-1 Activation.
Four animals/group were shaved 2 days before treatment. A single dose of either acetone or OA (2 µg in 0.2 ml of acetone) was painted on dorsal skin. Samples were collected 48 h after the treatment. Five-µm sections were stained with H&E. OA-induced hyperproliferation was determined from H&E-stained slides. Hyperproliferation was determined by measuring the thickness of the epidermis. Three measurements were made at random from the surface of the epidermis, starting from the top of the basement membrane to the bottom of the strateum corneum.

Northern Blot Analysis of Gene Expression.
Total epidermal RNA (15 µg) was size-fractionated on a formaldehyde-agarose gel and transferred to a nylon membrane. This was then sequentially probed for stromelysin-1, keratin 6 (K6), epidermal fatty acid-binding protein, and 7S as described previously (10) . A phosphorimaging screen was then exposed to the blot overnight, and the results were scanned on a MD Storm PhosphorImager (Molecular Dynamics, Sunnyvale, CA).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
To demonstrate that the K14-TAM-67 transgene was expressed in transgenic mice, RNA isolated from ear punches from mice identified as TAM-67- or TAM-67+ was used for RT-PCR. The primers were located in TAM-67 and an exon of the human growth hormone gene 3' to the TAM-67 coding sequence. Thus, the primers amplified only the transgene. Control reactions for GAPDH were also run. This analysis indicated that the TAM-67+ mice actively transcribed the TAM-67 transgene in the epidermis and that the TAM-67- littermates did not transcribe the transgene (Fig. 1A)Citation . It should be noted that in the absence of a cDNA template, the samples from TAM-67+ mice showed a band primed from contaminating DNA. In the presence of a cDNA template (in the TAM+, +RT lane), the DNA band disappeared due to the relative abundance of cDNA template versus DNA contamination.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. A, TAM+ mice actively transcribe TAM-67, and TAM- littermates do not. The 1.5-mm skin punches were snap-frozen and then pulverized in liquid nitrogen. Total cellular RNA was isolated by dissolving tissue in guanidinium salt and phenol/chloroform extraction. Transcription of TAM-67 was determined by RT-PCR analysis of this RNA. The sizes of the various amplification products are indicated. Amplification of GAPDH was included as a positive control. RT, ± reverse transcriptase. B, TAM-67 blocks AP-1-driven Luc activity in vivo. The ears from 10 ICR/AP-1 Luc+/K14-TAM-67+ and 10 ICR/AP-1 Luc+/K14-TAM-67- mice were treated with acetone (left ear) or with 2 µg of OA (right ear). Tissue was isolated 24 h later from 1.5-mm ear punches and lysed. Luciferase activity was determined on 25 µl of lysate. A BCA protein assay was then performed, and the Luc results were normalized to 30 µg of protein. {square}, acetone; {blacksquare}, OA.

 
To determine the effects of TAM-67 on OA-induced AP-1 activity, K14-TAM-67+ transgenic mice were crossed with AP-1-Luc+ mice. The offspring, which were either Luc+/TAM- or Luc+/TAM+, were treated on the ears with 2 µg of OA in acetone or with acetone alone. Ear punch biopsies were taken 24 h later and harvested for protein. The Luc assay based on these protein samples (Fig. 1B)Citation showed that the skin of these mice had a detectable basal AP-1 activity. There was a small, statistically insignificant difference in basal AP-1 activity between Luc+/K14-TAM-67- and Luc+/K14-TAM-67+ mice. Upon treatment with OA, there was an 80-fold increase in AP-1 activity in Luc+/K14-TAM-67- mice, whereas in Luc+/K14-TAM-67+ mice, AP-1 activity was only induced 8-fold. This is an inhibition of OA-induced AP-1 activity of >95%. Thus, TAM-67 expressed in the epidermis of ICR mice can block OA-induced AP-1 activity without affecting basal activity.

Having demonstrated that induction of AP-1 activity in the skin of K14-TAM-67+ mice was inhibited, a long-term initiation/promotion skin carcinogenesis protocol was performed to determine the effects of inhibition of OA-induced AP-1 activity on skin tumor promotion mediated by OA. The TAM-67+ mice and TAM-67- littermates were initiated with 100 µg (390 nmol) of DMBA in 0.2 ml of acetone. One week later, the mice were started on twice weekly treatments of 2 µg of OA in 0.2 ml of acetone applied to the dorsal skin. After 20 weeks of promotion, the experiment was stopped. Fig. 2Citation shows that the TAM-67+ mice developed fewer papillomas/mouse than the TAM-67- littermates, and in the few mice that developed tumors, the onset of papillomagenesis was delayed. There was an ~90% inhibition in OA-promoted papilloma response in the transgenic mice as compared with the nontransgenic littermates. Thus, expression of TAM-67 in the mouse skin protects these mice from OA-induced tumorigenesis.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. TAM-67 transgenic mice have decreased tumor multiplicity in response to OA promotion. Sixteen TAM-67+ mice and 16 TAM-67- littermates were shaved and initiated with a single dose of 390 nmol of DMBA 2 days later. These mice were then promoted, starting the following week, with twice weekly doses of 2 µg of OA in 200 µl of acetone. Papilloma development was monitored once a week. {blacktriangleup}, TAM+; {square}, TAM-.

 
Because TAM-67 inhibited tumor formation, other end points related to tumor development were examined. Most skin tumor-promoting agents induce hyperplasia of the skin. To determine whether TAM-67 had an effect on the hyperplastic response to OA, mice were treated on the dorsal skin with a single dose of OA (2 µg), and treated skin was harvested 48 h later (the time of maximal hyperplasia; data not shown). The results (Fig. 3)Citation indicated that TAM-67 did not significantly inhibit the hyperplastic response to OA at the time of maximal induction of hyperplasia by this dose of OA.



View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. TAM-67 expression does not change OA-induced hyperplasia. TAM-67+ mice and TAM-67- littermates were treated on the dorsal skin with 2 µg of OA in 200 µl of acetone. Forty-eight h later, skin was harvested, fixed in buffered formalin, and embedded paraffin, and sections were stained with H&E. Five-µm sections were then evaluated for epidermal thickness. {square}, acetone; {blacksquare}, OA.

 
Another important class of mediators of tumor development is the enzymes that degrade the extracellular matrix. Because OA has previously been shown to induce the MMP stromelysin-1 in vivo (10) , this was used as an example of these enzymes. In addition, it is known that the promoter region of the murine stromelysin-1 gene contains an AP-1 binding site. Epidermal RNA was harvested 18 h after four mice were treated with either OA or acetone. These samples were then subjected to Northern blot analysis with a probe for murine stromelysin-1. This analysis (Fig. 4)Citation indicated that OA induced stromelysin-1 mRNA in both TAM-67- and TAM-67+ mice and that there was no apparent difference in the extent of induction with this dose and time of harvest.



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Expression of TAM-67 does not change the expression of some OA-induced genes. TAM-67+ mice and TAM-67- littermates were treated on the dorsal skin with 2 µg of OA or acetone. Eighteen h later, full-thickness skin was snap-frozen, and epidermis was separated. Epidermis was then pulverized in liquid nitrogen. Total cellular RNA was isolated by dissolving tissue in guanidinium salt and phenol/chloroform extraction. After electrophoretic separation and capillary transfer to a GeneScreen nylon membrane, samples were probed for the indicated genes. The membrane was then exposed to a phosphorimaging screen, and the image was scanned by a MD-Storm PhosphorImager (Molecular Dynamics).

 
Other genes known to be induced by OA (10) were examined by Northern blot analysis. As shown in Fig. 4Citation , the transcription of hyperproliferative K6 was induced by OA at 18 h. K6 is also known to have an AP-1 binding cis element in the gene promoter region (22) . Additionally, the transcription of K6 was unaffected by expression of TAM-67 in the epidermis with this dose and time of harvest. The epidermal form of fatty acid-binding protein was also examined. These results (Fig. 4)Citation show that this differentiation-associated protein was induced at 18 h and that TAM-67 did not change the induced or steady-state basal levels of expression of this gene with this dose and time of harvest.


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The ICR strain of mice is especially sensitive to OA, a prototypical non-phorbol ester skin tumor-promoting agent that works by inhibiting protein phosphatases. Expression of dominant negative c-jun in the skin of these mice blocked OA-induced activation of AP-1 with little or no effect on induced hyperplasia. More importantly, expression of TAM-67 protected the mice from OA-induced tumorigenesis.

Interestingly, TAM-67 expression did not inhibit transcription of prospective AP-1-targeted genes activated by OA. Stromelysin-1, a MMP involved in degradation of the extracellular matrix, was similarly activated by OA in both TAM-67+ and TAM-67- mice. It was not surprising that OA induction of K6, a marker of hyperproliferation, was also unaffected by TAM-67 expression because TAM-67 expression does not block OA (Fig. 3)Citation - or TPA (19) -induced hyperproliferation. TAM-67 expression did not affect the expression of epidermal fatty acid-binding protein, an OA-induced gene thought to be associated with keratinocyte differentiation.

The transcriptional activity of AP-1 proteins is not limited to formation of the Jun-Jun or Jun-Fos complexes. Jun and Fos family members can interact with a variety of other proteins including members of the ATF family of cyclic AMP response element-binding proteins (23) and the p65 subunit of NF-{kappa}B (24) . One possible explanation for the antitumorigenic activity of TAM-67 is interaction with other families of transcription factors. TAM-67, like c-Jun, interacts with p65. Furthermore, TAM-67 expression blocks TPA activation of NF-{kappa}B in JB6 cells and 308 murine keratinocytes, TNF-{alpha} activation of NF-{kappa}B in JB6 cells, and elevated NF-{kappa}B levels in human keratinocytes (17 , 25 , 26) . Thus, it is possible that TAM-67 is inhibiting activation of NF-{kappa}B-regulated genes in the OA-treated skin. NF-{kappa}B is known to regulate several cytokines including TNF-{alpha}. Recently, it has been shown that TNF-{alpha} knockout mice have reduced papilloma formation in response to either DMBA/OA or DMBA/TPA (27) . Thus, TNF-{alpha} knockout mice may be deficient in the same signaling pathways as K14-TAM-67 transgenic mice.

The signaling blocked by TAM-67 has been shown to be essential for chemical tumor promotion. This leads to the idea that a genetic reagent such as TAM-67 could be clinically efficacious in blocking tumor promotion. This idea is attractive because a rate-limiting step in tumor formation could be blocked in a population that had a known exposure to an initiating event by either chemical or physical carcinogens. Delivery of such an agent in an inducible form, such as the tetracycline induction system, could prove to be therapeutically useful in populations that are at high risk of developing various forms of cancer including skin cancer.


   ACKNOWLEDGMENTS
 
We thank the members of Dr. David S. Albert’s laboratory for help with the hyperplasia studies.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by National Cancer Institute Grants RO1 CA 40584 (to G. T. B.) and P30 CA 23074 and National Institute of Environmental Health Sciences Grants T32 ES07091 and P30 ES 06694. Back

2 To whom requests for reprints should be addressed, at Arizona Cancer Center, Room 4999, 1515 North Campbell Avenue, Tucson, AZ 85724. Phone: (520) 626-6006; Fax: (520) 626-4979; E-mail: tbowden{at}azcc.arizona.edu Back

3 The abbreviations used are: OA, okadaic acid; AP-1, activator protein 1; DMBA, 7,12-dimethylbenz(a)anthracene; K14, keratin-14; K6, keratin 6; RT, reverse transcription; Luc, luciferase; PK, protein kinase; TPA, 12-O-tetradecanoylphorbol-13-acetate; MMP, matrix metalloproteinase; BHQ, tert-butylhydroquinone; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NF-{kappa}B, nuclear factor {kappa}B; TNF-{alpha}, tumor necrosis factor {alpha}. Back

Received 12/20/01. Accepted 4/ 5/02.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Suganuma M., Fujiki H., Suguri H., Yoshizawa S., Hirota M., Nakayasu M., Ojika M., Wakamatsu K., Yamada K., Sugimura T. Okadaic acid: an additional non-phorbol-12-tetradecanoate-13-acetate-type tumor promoter. Proc. Natl. Acad. Sci. USA, 85: 1768-1771, 1988.[Abstract/Free Full Text]
  2. Hitzfeld B. C., Hoger S. J., Dietrich D. R. Cyanobacterial toxins: removal during drinking water treatment, and human risk assessment. Environ. Health Perspect., 108: 113-122, 2000.
  3. Yoshizawa S., Matsushima R., Watanabe M. F., Harada K., Ichihara A., Carmichael W. W., Fujiki H. Inhibition of protein phosphatases by microcystins and nodularin associated with hepatotoxicity. J. Cancer Res. Clin. Oncol., 116: 609-614, 1990.[Medline]
  4. Janssens V., Goris J. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem. J., 353: 417-439, 2001.[Medline]
  5. Fujiki H., Suganuma M., Yoshizawa S., Nishiwaki S., Winyar B., Sugimura T. Mechanisms of action of okadaic acid class tumor promoters on mouse skin. Environ. Health Perspect., 93: 211-214, 1991.[Medline]
  6. Peng J., Bowden G. T., Domann F. E. Activation of AP-1 by okadaic acid in mouse keratinocytes associated with hyperphosphorylation of c-jun. Mol. Carcinog., 18: 37-43, 1997.[Medline]
  7. Shaulian E., Karin M. AP-1 in cell proliferation and survival. Oncogene, 20: 2390-2400, 2001.[Medline]
  8. Rosenberger S. F., Bowden G. T. Okadaic acid-stimulated TRE binding activity in a papilloma-producing mouse keratinocyte cell line involves increased AP-1 expression. Oncogene, 12: 2301-2308, 1996.[Medline]
  9. Rosenberger S. F., Finch J. S., Gupta A., Bowden G. T. Extracellular signal-regulated kinase 1/2-mediated phosphorylation of JunD and FosB is required for okadaic acid-induced activator protein 1 activation. J. Biol. Chem., 274: 1124-1130, 1999.[Abstract/Free Full Text]
  10. Holladay K., Fujiki H., Bowden G. T. Okadaic acid induces the expression of both early and secondary response genes in mouse keratinocytes. Mol. Carcinog., 5: 16-24, 1992.[Medline]
  11. Jochum W., Passegue E., Wagner E. F. AP-1 in mouse development and tumorigenesis. Oncogene, 20: 2401-2412, 2001.[Medline]
  12. Bernstein L. R., Colburn N. H. AP1/jun function is differentially induced in promotion-sensitive and resistant JB6 cells. Science (Wash. DC), 244: 566-569, 1989.[Abstract/Free Full Text]
  13. Dong Z., Birrer M. J., Watts R. G., Matrisian L. M., Colburn N. H. Blocking of tumor promoter-induced AP-1 activity inhibits induced transformation in JB6 mouse epidermal cells. Proc. Natl. Acad. Sci. USA, 91: 609-613, 1994.[Abstract/Free Full Text]
  14. Domann F. E., Jr., Levy J. P., Finch J. S., Bowden G. T. Constitutive AP-1 DNA binding and transactivating ability of malignant but not benign mouse epidermal cells. Mol. Carcinog., 9: 61-66, 1994.[Medline]
  15. Yoshioka K., Deng T., Cavigelli M., Karin M. Antitumor promotion by phenolic antioxidants: inhibition of AP-1 activity through induction of Fra expression. Proc. Natl. Acad. Sci. USA, 92: 4972-4976, 1995.[Abstract/Free Full Text]
  16. Brown P. H., Alani R., Preis L. H., Szabo E., Birrer M. J. Suppression of oncogene-induced transformation by a deletion mutant of c-jun. Oncogene, 8: 877-886, 1993.[Medline]
  17. Dong Z., Crawford H. C., Lavrovsky V., Taub D., Watts R., Matrisian L. M., Colburn N. H. A dominant negative mutant of jun blocking 12-O-tetradecanoylphorbol-13-acetate-induced invasion in mouse keratinocytes. Mol. Carcinog., 19: 204-212, 1997.[Medline]
  18. Domann F. E., Levy J. P., Birrer M. J., Bowden G. T. Stable expression of a c-JUN deletion mutant in two malignant mouse epidermal cell lines blocks tumor formation in nude mice. Cell Growth Differ., 5: 9-16, 1994.[Abstract]
  19. Young M. R., Li J. J., Rincon M., Flavell R. A., Sathyanarayana B. K., Hunziker R., Colburn N. Transgenic mice demonstrate AP-1 (activator protein-1) transactivation is required for tumor promotion. Proc. Natl. Acad. Sci. USA, 96: 9827-9832, 1999.[Abstract/Free Full Text]
  20. Rincon M., Flavell R. A. AP-1 transcriptional activity requires both T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. EMBO J., 13: 4370-4381, 1994.[Medline]
  21. Rho O., Bol D. K., You J., Beltran L., Rupp T., DiGiovanni J. Altered expression of insulin-like growth factor I and its receptor during multistage carcinogenesis in mouse skin. Mol. Carcinog., 17: 62-69, 1996.[Medline]
  22. Komine M., Rao L. S., Kaneko T., Tomic-Canic M., Tamaki K., Freedberg I. M., Blumenberg M. Inflammatory versus proliferative processes in epidermis. Tumor necrosis factor {alpha} induces K6b keratin synthesis through a transcriptional complex containing NF{kappa}B and C/EBPß. J. Biol. Chem., 275: 32077-32088, 2000.[Abstract/Free Full Text]
  23. Hai T., Curran T. Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proc. Natl. Acad. Sci. USA, 88: 3720-3724, 1991.[Abstract/Free Full Text]
  24. Stein B., Baldwin A. S., Jr., Ballard D. W., Greene W. C., Angel P., Herrlich P. Cross-coupling of the NF-{kappa}B p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J., 12: 3879-3891, 1993.[Medline]
  25. Hsu T. C., Nair R., Tulsian P., Camalier C. E., Hegamyer G. A., Young M. R., Colburn N. H. Transformation nonresponsive cells owe their resistance to lack of p65/nuclear factor-{kappa}B activation. Cancer Res., 61: 4160-4168, 2001.[Abstract/Free Full Text]
  26. Li J. J., Cao Y., Young M. R., Colburn N. H. Induced expression of dominant-negative c-jun down-regulates NF{kappa}B and AP-1 target genes and suppresses tumor phenotype in human keratinocytes. Mol. Carcinog., 29: 159-169, 2000.[Medline]
  27. Suganuma M., Okabe S., Marino M. W., Sakai A., Sueoka E., Fujiki H. Essential role of tumor necrosis factor {alpha} (TNF-{alpha}) in tumor promotion as revealed by TNF-{alpha}-deficient mice. Cancer Res., 59: 4516-4518, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol Cancer ResHome page
J. Rozenberg, V. Rishi, A. Orosz, J. Moitra, A. Glick, and C. Vinson
Inhibition of CREB Function in Mouse Epidermis Reduces Papilloma Formation
Mol. Cancer Res., May 1, 2009; 7(5): 654 - 664.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
M.-I. Kang, C. J. Henrich, H. R. Bokesch, K. R. Gustafson, J. B. McMahon, A. R. Baker, M. R. Young, and N. H. Colburn
A selective small-molecule nuclear factor-{kappa}B inhibitor from a high-throughput cell-based assay for "activator protein-1 hits"
Mol. Cancer Ther., March 1, 2009; 8(3): 571 - 581.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. Ma, J. Wang, Y. Gao, T.-W. Gao, G. Chen, K. A. Bower, M. Odetallah, M. Ding, Z. Ke, and J. Luo
The Role of Glycogen Synthase Kinase 3{beta} in the Transformation of Epidermal Cells
Cancer Res., August 15, 2007; 67(16): 7756 - 7764.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. Y. Zhang, A. E. Adams, T. W. Ridky, S. Tao, and P. A. Khavari
Tumor Necrosis Factor Receptor 1/c-Jun-NH2-Kinase Signaling Promotes Human Neoplasia
Cancer Res., April 15, 2007; 67(8): 3827 - 3834.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
D. Ikebe, B. Wang, H. Suzuki, and M. Kato
Suppression of keratinocyte stratification by a dominant negative JunB mutant without blocking cell proliferation.
Genes Cells, February 1, 2007; 12(2): 197 - 207.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. J. Gerdes, M. Myakishev, N. A. Frost, V. Rishi, J. Moitra, A. Acharya, M. R. Levy, S.-w. Park, A. Glick, S. H. Yuspa, et al.
Activator protein-1 activity regulates epithelial tumor cell identity.
Cancer Res., August 1, 2006; 66(15): 7578 - 7588.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. P. Jansen, C. E. Camalier, and N. H. Colburn
Epidermal Expression of the Translation Inhibitor Programmed Cell Death 4 Suppresses Tumorigenesis
Cancer Res., July 15, 2005; 65(14): 6034 - 6041.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
J. Y. Zhang, S. Tao, R. Kimmel, and P. A. Khavari
CDK4 regulation by TNFR1 and JNK is required for NF-{kappa}B-mediated epidermal growth control
J. Cell Biol., February 14, 2005; 168(4): 561 - 566.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
M. A. Bachelor, S. J. Cooper, E. T. Sikorski, and G. T. Bowden
Inhibition of p38 Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase Decreases UVB-Induced Activator Protein-1 and Cyclooxygenase-2 in a SKH-1 Hairless Mouse Model
Mol. Cancer Res., February 1, 2005; 3(2): 90 - 99.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
S. J. Cooper, J. MacGowan, J. Ranger-Moore, M. R. Young, N. H. Colburn, and G. T. Bowden
Expression of Dominant Negative c-jun Inhibits Ultraviolet B-Induced Squamous Cell Carcinoma Number and Size in an SKH-1 Hairless Mouse Model
Mol. Cancer Res., September 1, 2003; 1(11): 848 - 854.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, E. J.
Right arrow Articles by Bowden, G. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, E. J.
Right arrow Articles by Bowden, G. T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online