Cancer Research Prevention Award  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carroll, J. S.
Right arrow Articles by Sutherland, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carroll, J. S.
Right arrow Articles by Sutherland, R. L.
[Cancer Research 62, 3126-3131, June 1, 2002]
© 2002 American Association for Cancer Research


Experimental Therapeutics

Mechanisms of Growth Arrest by c-myc Antisense Oligonucleotides in MCF-7 Breast Cancer Cells

Implications for the Antiproliferative Effects of Antiestrogens1

Jason S. Carroll, Alexander Swarbrick, Elizabeth A. Musgrove and Robert L. Sutherland2

Cancer Research Program, Garvan Institute of Medical Research, St. Vincent’s Hospital, Sydney, New South Wales 2010, Australia


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The proto-oncogene c-myc is up-regulated by estrogen stimulation of hormone-dependent breast cancer cells and is frequently overexpressed in breast and other cancers. Therapeutic interventions that inhibit c-Myc expression have been extensively investigated, including antisense oligonucleotides that have high specificity and potential clinical application. This investigation compared antiestrogen-mediated growth arrest with the molecular events after repression of c-Myc expression in MCF-7 breast cancer cells using an antisense oligonucleotide. We show that the decreased cellular proliferation of MCF-7 cells after direct inhibition of c-Myc is a consequence of inhibition of cyclin D1 expression, subsequent redistribution of p21WAF1/CIP1 from cyclin D1-Cdk4 to cyclin E-Cdk2 complexes, and a decline in cyclin E-Cdk2 enzymatic activity. Simultaneous repression of p21WAF1/CIP1 can attenuate the growth-inhibitory effects of reduced c-Myc expression emphasizing the importance of this cyclin-dependent kinase (CDK) inhibitor in growth arrest. These molecular events are similar to the initial changes in cyclin gene expression, CDK complex formation and CDK activity seen after antiestrogen (ICI 182780)-mediated growth inhibition of MCF-7 cells, which suggests that the down-regulation of c-Myc by ICI 182780 is a primary event that culminates in cell cycle arrest.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Antiestrogens have been successfully used in the treatment of breast cancer, with tamoxifen being the current endocrine therapy of choice in the treatment of ER3 -positive breast cancers (1) . The frequent development of resistance to tamoxifen (2) and its potential agonist activity (3) has led to the development of alternative, potentially more efficacious, endocrine therapies including "pure" steroidal antiestrogens that display no agonist activity (4) . One such antiestrogen is ICI 182780, which showed efficacy in early clinical trials (5) .

Recent work has identified the molecular mechanisms by which ICI 182780 and other antiestrogens induce cell cycle arrest in MCF-7 breast cancer cells (6 , 7) . A key initial event is the down-regulation of the G1-specific regulatory protein cyclin D1 (6 , 8) , which in association with its CDK partners, Cdk4 and Cdk6, phosphorylates and partially inactivates the pocket proteins (pRb, p107, and p130) during normal cellular proliferation (reviewed in Ref. 9 ). These pocket proteins are responsible for negative regulation of the E2F transcription factors, which are required for a cell to circumvent the G1-S-phase block imposed by underphosphorylated pocket proteins. A consequence of the antiestrogen-mediated decrease in cyclin D1 is the accumulation of free" p21WAF1/CIP1 (6) . The latter protein, a member of the Cip/Kip family of CDK inhibitors, facilitates the assembly of cyclin D1-Cdk4/6 complexes at low stoichiometry but inhibits cyclin D1-Cdk4/6 at higher concentrations (10) . The p21WAF1/CIP1 that is liberated from cyclin D1-Cdk4 complexes after the antiestrogen-induced decrease in cyclin D1 binds another G1-specific cyclin-CDK complex, namely, cyclin E-Cdk2, inhibiting its enzymatic activity (6) . As growth arrest continues, both p21WAF1/CIP1 and the related CDK inhibitor p27Kip1 contribute to the inhibition of CDK activity (7) . As a result, the pocket protein phosphorylation events catalyzed by the G1 cyclin-CDK complexes do not occur, and cells eventually arrest in a state of quiescence (6) . Studies on estrogen-induced mitogenesis have revealed multiple cell cycle-regulatory pathways activated by estrogen (11, 12, 13) . These include regulation of cyclin D1 protein levels and increased accumulation of the oncoprotein c-Myc, which converge on p21WAF1/CIP1 redistribution and modulation of cyclin E-Cdk2 activity (14) . This, therefore, suggested a role for c-Myc in antiestrogen action, but little is known of its role during antiestrogen-mediated growth arrest.

The c-Myc protein has been implicated in many physiological events including cellular proliferation, apoptosis, and differentiation (15) . We previously investigated the role of c-Myc in estrogen-induced cell cycle progression and demonstrated that induction of c-Myc alone is sufficient to induce cell cycle progression in antiestrogen-arrested cells (11 , 14) . Because of the importance of c-Myc in normal development and of its high level of expression in many cancers, it has been well studied as a potential therapeutic target. Dominant-negative forms of c-Myc (16) and both full-length antisense mRNA (17) and oligonucleotides to the c-myc mRNA (18 , 19) inhibit proliferation of cancer cell lines in vitro. Watson et al. (18) showed that both ER-positive and ER-negative breast cancer cells could be growth arrested with antisense oligonucleotides to the c-myc mRNA. However, the molecular mechanisms responsible for cell cycle arrest after the loss of c-Myc have not been clearly defined in these cells.

The role of c-Myc in the control of cell cycle progression has been difficult to elucidate (20) . Critical c-Myc transcriptional targets identified from c-Myc overexpression studies differ from those obtained by targeted disruption of c-Myc. For example, the expression of many of the putative downstream trans-activated or trans-repressed targets of c-Myc do not change in c-myc null cells (21) . This disparity between systems adds an extra degree of complexity in defining the role of c-Myc. This investigation aimed to clarify the molecular mechanisms of growth arrest after down-regulation of c-Myc in breast cancer cells, because this had not previously been studied in detail. Because antiestrogens elicit an acute decrease in c-Myc levels (22 , 23) , we also compared the specific down-regulation of c-Myc with antiestrogen action. We show that the specific regulation of c-Myc after antisense treatment of breast cancer cells is sufficient to elicit the downstream cell cycle events that have previously been implicated in antiestrogen-mediated cell cycle arrest (6) .


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
Stock solutions of 7{alpha}-[9-(4,4,5,5,5-pentafluropentylsulfinyl)nonyl]estra-1,3,5,(10)-triene-3,17ß-diol (ICI 182780) and treatment of MCF-7 cells were as described previously (6) .

c-myc Antisense Oligonucleotides.
A 20mer c-myc antisense oligonucleotide (AACGTTGAGGGGCATCGTCG) was designed based on a previously published sequence (18) but with a five-nucleotide extension at the 3' terminus, and synthesized (Geneworks, Adelaide, SA, Australia) with phosphorothioate residues at the 5'-and 3'-terminal nucleotides to minimize exonucleolytic cleavage (24) . As controls, complementary (sense) and scrambled (GTACACATGGGGAGTTTCGA) oligonucleotides were manufactured. The scrambled oligonucleotide contained four contiguous guanosine residues, which have been implicated in nonspecific effects when the original 15-mer c-myc antisense oligonucleotide was used (25) . MCF-7 cells were harvested and gently syringed four times to minimize clumps, and 5 x 105 cells were grown in 50-cm2 dishes overnight. Ten µl of Cellfectin (Life Technologies, Inc., Grand Island, NY) and oligonucleotide (1 µM final concentration) were incubated in 1 ml of serum-free RPMI 1640 for 30 min and subsequently added to the monolayer with 1 ml of RPMI 1640 supplemented with 10% FCS. All of the control oligonucleotides were included at 1 µM final concentration. The dishes were placed in a 37°C incubator with 5% CO2 for 2–3 h with intermittent mixing. The oligonucleotide/Cellfectin solution was then decanted and the monolayer washed once with RPMI 1640 (5% FCS). Ten ml of RPMI 1640 (5% FCS) was then added to each dish. Cells were harvested for protein analysis as described previously (6) .

p21WAF1/CIP1 and p27Kip1 Antisense Oligonucleotides.
A 20-mer p21WAF1/CIP1 antisense oligonucleotide (TCCCCAGCCGGTTCTGACAT; Ref. 26 ) and a 15-mer p27Kip1 antisense oligonucleotide (27) were synthesized (Geneworks) with phosphorothioate residues at the 5' and 3' termini. Complementary (sense) oligonucleotides were also manufactured. For double antisense experiments, cells were set up and treated as described above, except 20 µl of Cellfectin were added to the 1 ml of serum-free medium containing 400 nM p21WAF1/CIP1 antisense oligonucleotide (or the appropriate sense control) or 800 nM p27Kip1 antisense oligonucleotide (or the appropriate sense control).

Cell Cycle Analysis.
Two methods of cell cycle analysis were performed. Initially, MCF-7 cells were seeded at 2 x 103 cells/well in a 96-well plate and grown overnight. BrdUrd (Sigma-Aldrich, Castle Hill, NSW, Australia) was added to a final concentration of 10 µM for 2 h. The incorporation of BrdUrd was measured using the cell proliferation ELISA, BrdUrd (colorimetric) kit (Roche Diagnostics, Castle Hill, NSW, Australia) according to the manufacturer’s instructions. The colorimetric result was measured at 370 nm using a Molecular Devices Spectra Max 250 microtiter plate reader.

In other experiments, a FITC-conjugated anti-BrdUrd monoclonal antibody was used. Briefly, MCF-7 cells were seeded into 10-cm2 dishes at 5 x 105 and pulsed with 10 µM BrdUrd for 2 h. Cells were trypsinized and fixed in three changes of methanol:acetic acid (3:1). The pelleted cells were resuspended in PBS/1% Tween followed by denaturation in 1.5 M HCl. Three washes with PBS/1% Tween followed, after which the cells were resuspended in PBS/1% Tween containing 1 µg of FITC-conjugated BrdUrd monoclonal antibody (Chemicon International, Termecula, CA) and incubated in the dark for 30 min at 37°C. Finally, the cells were pelleted, washed twice with PBS/1% Tween, and made up to 500 µl in 1 x PBS/1% Tween. Propidium iodide (PI) was added to a final concentration of 10 µg/ml and left at room temperature for 30 min, after which the cells were analyzed by flow cytometry on a FACSCalibur (Becton Dickinson Immunocytometry Systems, San Jose, CA) exciting at 488 nm, and measuring the BrdUrd-FITC on the green fluorescence (514 nm) and the DNA-linked red fluorescence (PI) through a 600-nm wavelength filter after compensation to reduce overlap between red and green fluorescence.

Immunoblot Analysis.
Immunoblotting was performed as described previously (6) . Primary antibodies used were: c-Myc (C-19) and cyclin E (C-19), from Santa Cruz Biotechnology Inc., Santa Cruz, CA; ß-actin (AC-15) from Sigma-Aldrich; pRb from PharMingen, San Diego, CA; cyclin D1 (DCS-6) from Novacastra Laboratories Ltd, Newcastle-upon-Tyne, United Kingdom; p21WAF1/CIP1 and p27Kip1 from Transduction Laboratories, Lexington, KY.

Kinase Assay and Detection of Cyclin E and Cyclin D1-associated Proteins.
Kinase assays and immunoprecipitations were performed as described previously (6) .

RNase Protection Assay.
MCF-7 cells were set up as described previously and treated with either the c-myc antisense or sense oligonucleotide, and RNA was collected at 6 and 16 h using the Ambion (Austin, TX) RNAqueous kit according to the manufacturer’s instructions. The RNA was subjected to an RNase protection assay using the Riboquant multiprobe system from PharMingen according to the manufacturer’s instruction, using the hCC-2 human cell cycle regulator multiprobe.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Pure Antiestrogen ICI 182780 Induces a Rapid Decrease in the c-Myc Protein.
Previously published work from this laboratory (22) demonstrated that the progestin ORG 2058 and the pure antiestrogen ICI 164384 decreased c-myc expression in T-47D cells and that these changes preceded changes in the other cell cycle components. To assess the effects of ICI 182780 on c-Myc in MCF-7 cells, we treated proliferating cells with 10 nM of ICI 182780, harvested protein over a 6-h time course and immunoblotted the lysate for c-Myc (Fig. 1A)Citation . As seen in Fig. 1BCitation , the level of c-Myc protein decreased by 50% within the 1st hour of treatment and declined to 10% of control levels between 2 and 4 h. These changes are consistent with previous data suggesting that repression of c-Myc is one of the first detectable changes in expression of known cell cycle regulatory genes after growth inhibition by antiestrogens (22) .



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. ICI 182780 rapidly down-regulates c-Myc protein. Exponentially proliferating MCF-7 cells were treated with ICI 182780 (10 nM) or ethanol vehicle, and whole cell lysates were prepared at the time points indicated. A, protein level of c-Myc during the first 6 h of ICI 182780 treatment. Total cell lysates were separated by SDS-PAGE and immunoblotted with an antibody to c-Myc. B, protein levels were determined using densitometry, as described in "Materials and Methods."

 
c-myc Antisense Oligonucleotides Inhibit Proliferation of MCF-7 Breast Cancer Cells.
To assess whether we could mimic changes in proliferation seen after antiestrogen treatment (6) by specifically decreasing c-Myc protein, we treated proliferating MCF-7 cells with an antisense c-myc oligonucleotide and measured both changes in c-Myc levels (Fig. 2A)Citation and BrdUrd incorporation into DNA. As seen in Fig. 2ACitation , c-Myc protein was inhibited to 30% of control by 6-h treatment with antisense c-myc oligonucleotide. The rate of proliferation was also decreased to 30% of that in exponentially proliferating cells when the antisense oligonucleotide was administered for 16 h (Fig. 2B)Citation . These changes in both the levels of c-Myc and the rate of proliferation were not seen when either the sense or the scrambled oligonucleotide was added (Fig. 2)Citation .



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Antisense oligonucleotides to c-myc decrease c-Myc protein and DNA synthesis in MCF-7 cells. MCF-7 cells were treated with 1 µM of either control [sense or scrambled (Scr)] or antisense (AS) oligonucleotides and Cellfectin lipid vector for 2 h, after which the medium was replaced with 5% FCS in RPMI for an additional 4 h. A, total cell lysates were collected, separated by SDS-PAGE, and immunoblotted for c-Myc. The nitrocellulose was reprobed for ß-actin as a loading control. B, DNA synthesis after 16 h of control or antisense oligonucleotide treatment was measured by BrdUrd (BrdU) incorporation, as described in "Materials and Methods." Data presented are the mean ± SE of three experiments.

 
Loss of c-Myc Is Accompanied by a Decrease in Cyclin D1 and Loss of Cyclin E-Cdk2 Activity.
We next measured changes in the G1-specific cyclins, cyclin D1 and cyclin E. The level of cyclin D1 decreased by 50% after antisense c-myc-oligonucleotide treatment, but there was little change in cyclin E protein levels (Fig. 3A)Citation , as was observed in antiestrogen-treated MCF-7 cells. There were no changes in either protein in the sense or the scrambled oligonucleotide controls. Our previous investigation showed that a reduction in cyclin D1 protein of this magnitude is sufficient to inhibit cyclin E-Cdk2 activity, which likely contributes to subsequent cell cycle arrest (6) . Therefore, we assessed whether a specific reduction in c-Myc alone could decrease the levels of cyclin E-Cdk2 activity. As seen in Fig. 3BCitation , cyclin E-Cdk2 activity decreased to less than 40% of the sense or scrambled controls after 8 h of antisense c-myc oligonucleotide treatment, which suggests that the presence of the c-Myc oncoprotein is required to maintain active cyclin E-Cdk2. An analysis of changes in the phosphorylation status of pRb (a major downstream target of both cyclin D1-Cdk4 and cyclin E-Cdk2) showed that the hyperphosphorylated, inactive forms of pRb decreased after the targeted repression of c-Myc (Fig. 3C)Citation .



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Reduction in c-Myc causes a decrease in cyclin D1 protein and a decline in cyclin E-Cdk2 activity. MCF-7 cells were treated with either control [sense or scrambled (Scr)] or antisense (AS) c-myc oligonucleotides and Cellfectin lipid vector for 2 h, after which the medium was replaced with 5% RPMI for an additional 6 h. A, total cell lysates were collected, separated by SDS-PAGE, and immunoblotted for cyclin D1 followed by cyclin E. The blot was reprobed with an antibody to ß-actin as a loading control. B, total protein was harvested, cyclin E-immunoprecipitated, and subjected to an in vitro kinase assay using histone H1 as substrate, as described in the "Materials and Methods." C, changes in pRb phosphorylation state were assessed by Western blotting.

 
Loss of c-Myc Does Not Induce Changes in p21WAF1/CIP1 and p27Kip1 Protein or mRNA Levels, but Causes a Shift of p21WAF1/CIP1 from Cyclin D1-Cdk4 to Cyclin E-Cdk2 Complexes.
We previously demonstrated that the cell cycle arrest of MCF-7 cells by ICI 182780 induced the accumulation of p21WAF1/CIP1 and p27Kip1 protein, but not until a majority of the cyclin E-Cdk2 activity was lost (6) . To assess whether the same situation occurred in cell cycle arrest after antisense c-myc treatment, we immunoblotted lysate from 8- h-antisense-c-myc-oligonucleotide-exposed MCF-7 cells for p21WAF1/CIP1 and p27Kip1. As seen in Fig. 4ACitation , the total levels of p27Kip1 and p21WAF1/CIP1 did not change. Recent work on the downstream targets of c-Myc suggest that c-Myc negatively regulates the transcription of the p21WAF1/CIP1 gene (28 , 29) . This being the case, it would be anticipated that the loss of c-Myc would result in a substantial increase in p21WAF1/CIP1 levels. However, RNase protection assays of antisense c-myc-targeted cells showed that the transcription of the p21WAF1/CIP1 gene did not change significantly after either 8 or 16 h of antisense-c-myc-oligonucleotide treatment (Fig. 4B)Citation , which is consistent with the protein data.



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Reduction in c-Myc does not change p21WAF1/CIP1 or p27Kip1 mRNA or protein levels but causes a shift of p21WAF1/CIP1 from cyclin D1-Cdk4 to cyclin E-Cdk2 complexes. The experimental design is as described in Fig. 3Citation . A, protein levels of p21WAF1/CIP1 and p27Kip1 in c-myc-antisense-treated MCF-7 cells after 8 h. Total cell lysates were prepared as described previously, separated by SDS-PAGE, and immunoblotted for p21WAF1/CIP1 and p27Kip1. B, RNA was collected from MCF-7 cells treated with either the sense or antisense c-myc oligonucleotide after 8 h or 16 h of treatment and subjected to RNase protection as described in the "Materials and Methods." The ‘housekeeping’ gene L32 was used as a loading control. C, cyclin D1 was immunoprecipitated from MCF-7 cell lysates that had been treated with either the sense or scrambled control or with the c-myc antisense oligonucleotide for 16 h, separated by SDS-PAGE, and immunoblotted for p21WAF1/CIP1. Cyclin E was also immunoprecipitated from a similar set of lysates and subsequently immunoblotted for p21WAF1/CIP1 and p27Kip1. Densitometry was performed as described in "Materials and Methods." AS, antisense; Scr, scrambled; IP, immunoprecipitated.

 
We and others concluded from previous investigations on ICI 182780 action that the elevated levels of p21WAF1/CIP1 and p27Kip1 at later time points were the primary factors that maintained long-term cell cycle arrest (6 , 7) . However, the initial inhibition of cyclin E-Cdk2 occurred, not because of an increase in inhibitor levels but rather as a result of p21WAF1/CIP1 redistribution between cyclin D1-Cdk4 and cyclin E-Cdk2. Thus, we analyzed changes in the relative number of cyclin D1-Cdk4- and cyclin E-Cdk2-bound p21WAF1/CIP1 complexes. The abundance of cyclin D1-Cdk4-p21WAF1/CIP1 complexes decreased by 35% after 16 h of treatment with antisense c-myc oligonucleotide (Fig. 4C)Citation , whereas cyclin E-Cdk2-p21WAF1/CIP1 complexes increased by 85%, which suggested that the loss of cyclin D1 resulted in a decrease in cyclin D1-Cdk4-associated p21WAF1/CIP1 and a subsequent increase in cyclin E-Cdk2-associated p21WAF1/CIP1, coincident with the loss of cyclin E-Cdk2 activity. There was no significant change in the abundance of cyclin E-Cdk2-p27Kip1 complexes after the decrease in c-Myc levels (Fig. 4C)Citation .

p21WAF1/CIP1 and p27Kip1 Are Essential for Inhibition by c-myc Antisense.
To assess whether the inhibitors p21WAF1/CIP1 and p27Kip1 played an essential role in the inhibition of cyclin E-Cdk2 complexes and subsequent cell cycle arrest after the loss of c-Myc, MCF-7 cells were treated with the antisense c-myc oligonucleotide or the sense control, and at the same time, p21WAF1/CIP1 or p27Kip1 antisense oligonucleotides (or the appropriate sense control). These antisense p21WAF1/CIP1 and p27Kip1 oligonucleotides are effective in reversing the growth-inhibitory effects of ICI 182780 at these concentrations (6 , 7) . As seen in Fig. 5ACitation , the levels of c-Myc, p21WAF1/CIP1, and p27Kip1 protein were differentially regulated by the addition of specific antisense oligonucleotides. The presence of any two antisense oligonucleotides in combination could inhibit the production of the specific proteins without any deleterious effects on cell proliferation or morphology (data not shown). The protein changes were not seen in any of the various controls. To assess whether the loss of p21WAF1/CIP1 or p27Kip1 could influence the inhibition in cyclin E-Cdk2 activity that was observed after the targeted repression of c-Myc, we used the same cell lysates and performed an in vitro kinase assay. As shown in Fig. 5BCitation , the decrease in cyclin E-Cdk2 activity observed after antisense c-Myc treatment could be reversed when p21WAF1/CIP1 was also down-regulated. However, the simultaneous down-regulation of p27Kip1 did not appear to attenuate the enzymatic inhibition of cyclin E-Cdk2. To investigate whether the loss of p21WAF1/CIP1 or p27Kip1 could influence the decrease in DNA synthesis and cellular proliferation after the loss of c-Myc, we used BrdUrd incorporation into DNA as a measure of cell proliferation. As shown in Fig. 5CCitation , when c-Myc levels were down-regulated in the presence of p21WAF1/CIP1 or p27Kip1 sense, control oligonucleotides, BrdUrd incorporation decreased to ~50% of control levels. However, when p21WAF1/CIP1 was simultaneously down-regulated, the S-phase fraction remained at c-Myc sense control levels. When p27Kip1 and c-Myc were simultaneously down-regulated, proliferation rates remained only marginally higher than without the p27Kip1 antisense oligonucleotide. This confirmed that p21WAF1/CIP1 plays a pivotal role in mediating growth arrest after the loss of c-Myc, whereas p27Kip1 may play a relatively minor role in the initial growth arrest.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. p21WAF1/CIP1 is essential for growth arrest after down-regulation of c-Myc. Exponentially growing cells were treated with 1 µM of antisense c-myc oligonucleotide or sense control and simultaneously treated with 400 nM p21WAF1/CIP1 antisense (AS) oligonucleotide, or 800 nM p27Kip1 antisense oligonucleotide, or the appropriate sense control. A, total protein levels of p21WAF1/CIP1, p27Kip1, and c-Myc after 16 h of antisense treatment. Total cell lysates were prepared as described previously, separated by SDS-PAGE, and immunoblotted for p21WAF1/CIP1, p27Kip1, and c-Myc. The nitrocellulose was subsequently blotted with an antibody to ß-actin as a loading control. B, cyclin E-Cdk2 activity was assessed from total protein by immunoprecipitating cyclin E and subjecting it to an in vitro kinase assay using histone H1 as a substrate, as described in the "Materials and Methods." Data presented are the mean ± SD of three experiments. C, BrdUrd (BrdU) incorporation into control or antisense-treated MCF-7 cells was conducted as described in "Materials and Methods." Data presented are the mean ± SD of three experiments.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
c-Myc is a potent oncogene, the regulation of which is directly correlated with cellular growth status (30) . Expression of c-Myc is rapidly lost after mitogenic starvation (31 , 32) and ectopic expression is capable of inducing expression of numerous proliferation-specific genes (33) . This direct link between c-Myc expression and cell cycle progression, together with the significant correlation between c-Myc amplification and disease progression or early relapse in several cancers (34) , has led to the development of strategies to target this molecule for therapeutic intervention. Specific regulation of the c-Myc oncogene has been the focus of several investigations, in which antisense c-myc oligonucleotides have been successfully used to inhibit the growth of small cell lung carcinoma (35) , hepatoma cells (36) , and breast cancer cells (18 , 19) . However, the molecular mechanisms through which antisense c-Myc strategies induce cell cycle arrest have not been fully defined.

Recent literature has emphasized discrepancies in the implied role of c-Myc in cell cycle progression drawn from studies that have used different experimental systems. Potential c-Myc transcription targets were originally identified based on in vitro assays using inducible c-Myc-ER constructs (37) . These investigations identified several potential c-Myc targets (15) . However, development and characterization of c-myc null fibroblasts in culture has shown that expression of many of the proposed c-Myc targets is not changed when c-myc is deleted. Several more recent investigations have highlighted a link between c-Myc overexpression and decreased p21WAF1/CIP1 transcription (28 , 38) , although work presented in the present study suggests that p21WAF1/CIP1 transcription and protein levels are not influenced by the down-regulation of c-Myc. Deletion of MYC from B cells resulted in a decrease in cyclin E-Cdk2 activity but not in an increase in p21WAF1/CIP1 levels (39) , a finding in agreement with the data presented here. The divergent conclusions drawn from studies of overexpression of c-Myc, and those studies in which c-Myc expression or function was inhibited, have complicated the definition of c-Myc targets with a pivotal role in cell cycle progression.

Our data suggest that the loss of cyclin D1 protein after the inhibition of c-Myc expression may be a central component of cell cycle arrest. This loss of cyclin D1 results in a redistribution of p21WAF1/CIP1 from cyclin D1-Cdk4 to cyclin E-Cdk2, and in a subsequent inhibition of cyclin E-Cdk2 activity. Despite stable levels of p21WAF1/CIP1 after the inhibition of c-Myc expression, p21WAF1/CIP1 is important in the growth arrest because a simultaneous loss of p21WAF1/CIP1 can reverse the growth arrest that typically follows the reduction of c-Myc. This is the first investigation to show that p21WAF1/CIP1 is essential for growth arrest after a reduction of c-Myc. At later time points, p27Kip1, also, partially contributes to the growth arrest that results from decreased c-Myc production, because a parallel loss of p27Kip1 could marginally attenuate the growth arrest.

The mechanistic link between decreased c-Myc expression and consequent decreases in cyclin D1, as presented here, is unclear. Cyclin D1 protein levels can be directly up-regulated by c-Myc (40) , not regulated at all (14) , and even negatively regulated (41) . One investigation suggested that c-Myc can associate with, and sequester, Miz-1, a transcriptional activator of cyclin D1 (42) , thereby negatively regulating cyclin D1 transcription. Although overexpression of c-Myc in MCF-7 cells does not influence cyclin D1 protein levels (14) , it is clear that studies of the reduction of c-Myc and of c-Myc overexpression do not necessarily identify the same targets. Further support for the data generated here comes from studies of c-myc null fibroblasts, in which a loss of c-Myc results in a decrease in cyclin D1 levels (21) . Gartel et al. suggest that the regulation of the p21WAF1/CIP1 gene by c-Myc is via the association with Sp1/Sp3 binding sites in the p21WAF1/CIP1 promoter (38) . The promoter of cyclin D1 possesses several Sp1 sites (43) and may provide opportunity for a direct physical link between the c-Myc protein and cyclin D1 regulation. Despite the controversy surrounding possible regulation of cyclin D1 by c-Myc, cyclin D1 antibodies can prevent c-Myc-induced S-phase entry (44) , and p16 (a specific inhibitor of cyclin D1-Cdk4/6) can block c-Myc-mediated transformation (45) , confirming a vital role for cyclin D1 in the oncogenic and proliferative effects of c-Myc.

Growth arrest by ICI 182780 and other antiestrogens involves a rapid decline in c-Myc levels, which, when emulated using antisense strategies, is sufficient to cause cell cycle arrest of MCF-7 breast cancer cells (Fig. 6)Citation . This implicates the loss of c-Myc as one of the crucial early events in antiestrogen-mediated growth arrest. c-Myc is commonly overexpressed in many hormone-insensitive breast cancer cells (46 , 47) , which suggests that, in hormone-independent cells, the constitutive expression of c-Myc may be sufficient to induce changes in the abundance and activity of cyclin/CDK complexes, modify levels of the inhibitors, and regulate pocket protein phosphorylation as documented in the estrogen-induced proliferation of ER-positive cells (11, 12, 13) . Interestingly, the hyperplastic effects of inducible c-Myc overexpression or c-Myc-ER activation in skin and hematopoietic cells can be reversed by the inactivation of the transgene or its product, which suggests that the continued presence of c-Myc is required for cancer development and not just for initiation (48 , 49) . As such, specific targeted regulation of c-Myc with antisense oligonucleotides or other therapeutic strategies may be a potential mechanism of regulating established breast cancers. Of particular interest will be determining whether this strategy may be effective in circumventing antiestrogen resistance in breast cancers in which c-Myc down-regulation does not follow antiestrogen treatment.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Model of ICI 182780-mediated growth arrest. ICI 182780 causes a rapid decrease in c-Myc and cyclin D1 protein levels, cyclin E-Cdk2 inhibition, and cell cycle arrest. Antisense c-myc oligonucleotides are sufficient to decrease cyclin D1 levels, inhibit cyclin E-Cdk2, and induce cell cycle arrest. Similarly, the direct inhibition of cyclin D1 is sufficient to inhibit cyclin E-Cdk2 activity and induce cell cycle arrest, all of which is dependent on p21WAF1/CIP1. Therefore, the current model of ICI 182780 action is an initial decline in c-Myc levels, a consequent decrease in cyclin D1 protein, a redistribution of p21WAF1/CIP1 to cyclin E-Cdk2, an inhibition of cyclin E-Cdk2, and cell cycle arrest.

 


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the National Health and Medical Research Council (NHMRC) of Australia, The Cancer Council New South Wales, and the Freedman Foundation. J. S. C. and A. S. are recipients of Australian Postgraduate Awards. Back

2 To whom requests for reprints should be addressed, at Cancer Research Program, Garvan Institute of Medical Research, 384 Victoria Street, Darlinghurst, Sydney, New South Wales 2010, Australia. Phone: 61-2-9295-8322; Fax: 61-2-9295-8321; E-mail: r.sutherland{at}garvan.org.au Back

3 The abbreviations used are: ER, estrogen receptor; BrdUrd, 5-bromodeoxyuridine; CDK, cyclin-dependent kinase. Back

Received 10/16/01. Accepted 3/28/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Early Breast Cancer Trialists’ Collaborative Group Tamoxifen for early breast cancer: an overview of the randomised trials. Lancet, 351: 1451-1467, 1998.[Medline]
  2. Osborne C. K., Coronado E. B., Hilsenbeck S. G., McCue B. L., Wakeling A. E., McClelland R. A., Manning D. L., Nicholson R. I. Comparison of the effects of a pure steroidal antiestrogen with those of tamoxifen in the model of human breast cancer. J. Natl. Cancer Inst. (Bethesda), 87: 746-750, 1995.[Abstract/Free Full Text]
  3. MacGregor J. I., Jordan V. C. Basic guide to the mechanisms of antiestrogen action. Pharmacol. Rev., 50: 151-196, 1998.[Abstract/Free Full Text]
  4. Wakeling A. E., Dukes M., Bowler J. A potent specific pure antiestrogen with clinical potential. Cancer Res., 51: 3867-3873, 1991.[Abstract/Free Full Text]
  5. Howell A., DeFriend D., Robertson J., Blamey R., Walton P. Response to a specific antioestrogen (ICI182780) in tamoxifen-resistant breast cancer. Lancet, 345: 29-30, 1995.[Medline]
  6. Carroll J. S., Prall O. W. J., Musgrove E. A., Sutherland R. L. A pure estrogen antagonist inhibits cyclin E-Cdk2 activity in MCF-7 breast cancer cells and induces accumulation of p130–E2F4 complexes characteristic of quiescence. J. Biol. Chem., 275: 38221-38229, 2000.[Abstract/Free Full Text]
  7. Cariou S., Donovan J. C. H., Flanagan W. M., Milic A., Bhattacharya N., Slingerland J. M. Down-regulation of p21WAF1/CIP1 or p27Kip1 abrogates antiestrogen-mediated cell cycle arrest in human breast cancer cells. Proc. Natl. Acad. Sci. USA, 97: 9042-9046, 2000.[Abstract/Free Full Text]
  8. Watts C. K. W., Brady A., Sarcevic B., deFazio A., Musgrove E. A., Sutherland R. L. Antiestrogen inhibition of cell cycle progression in breast cancer cells is associated with inhibition of cyclin-dependent kinase activity and decreased retinoblastoma protein phosphorylation. Mol. Endocrinol., 9: 1804-1813, 1995.[Abstract/Free Full Text]
  9. Sherr C. J., Roberts J. M. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev., 13: 1501-1512, 1999.[Free Full Text]
  10. LaBaer J., Garrett M. D., Stevenson L. F., Slingerland J. M., Sandhu C., Chou H. S., Fattaey A., Harlow E. New functional activities for the p21 family of CDK inhibitors. Genes Dev., 11: 847-862, 1997.[Abstract/Free Full Text]
  11. Prall O. W. J., Sarcevic B., Musgrove E. A., Watts C. K. W., Sutherland R. L. Estrogen-induced activation of Cdk4 and Cdk2 during G1-S phase progression is accompanied by increased cyclin D1 expression and decreased cyclin-dependent kinase inhibitor association with cyclin E-Cdk2. J. Biol. Chem., 272: 10882-10894, 1997.[Abstract/Free Full Text]
  12. Foster J. S., Wimalasena J. Estrogen regulates activity of cyclin-dependent kinases and retinoblastoma protein phosphorylation in breast cancer cells. Mol. Endocrinol., 10: 488-498, 1996.[Abstract/Free Full Text]
  13. Planas-Silva M. D., Weinberg R. A. Estrogen-dependent cyclin E-cdk2 activation through p21 redistribution. Mol. Cell. Biol., 17: 4059-4069, 1997.[Abstract]
  14. Prall O. W. J., Rogan E. M., Musgrove E. A., Watts C. K. W., Sutherland R. L. c-Myc or cyclin D1 mimics estrogen effects on cyclin E-Cdk2 activation and cell cycle reentry. Mol. Cell. Biol., 18: 4499-4508, 1998.[Abstract/Free Full Text]
  15. Dang C. V. c-Myc target genes involved in cell growth, apoptosis and metabolism. Mol. Cell. Biol., 19: 1-11, 1999.[Free Full Text]
  16. Gagandeep S., Ott M., Nisen P. D., DePinho R. A., Gupta S. Overexpression of Mad transcription factor inhibits proliferation of cultured human hepatocellular carcinoma cells along with tumor formation in immunodeficient animals. J. Gene Med., 2: 117-127, 2000.[Medline]
  17. Steiner M. S., Anthony C. T., Lu Y., Holt J. T. Antisense c-myc retroviral vector suppresses established human prostate cancer. Hum. Gene Ther., 20: 747-755, 1998.
  18. Watson P. H., Pon R. T., Shiu R. P. C. Inhibition of c-myc expression by phosphorothioate antisense oligonucleotide identifies a critical role for c-myc in the growth of human breast cancer. Cancer Res., 51: 3996-4000, 1991.[Abstract/Free Full Text]
  19. Kang Y., Cortina R., Perry R. R. Role of c-myc in tamoxifen-induced apoptosis estrogen-independent breast cancer cells. J. Natl. Cancer Inst. (Bethesda), 88: 279-284, 1996.[Abstract/Free Full Text]
  20. Bishop J. M. Retroviruses and cancer genes. Adv. Cancer Res., 37: 1-32, 1982.[Medline]
  21. Mateyak M. K., Obaya A. J., Adachi S., Sedivy J. M. Phenotypes of c-Myc-deficient rat fibroblasts isolated by targeted homologous recombination. Cell Growth Differ., 8: 1039-1048, 1997.[Abstract]
  22. Musgrove E. A., Hamilton J. A., Lee C. S. L., Sweeney K. J. E., Watts C. K. W., Sutherland R. L. Growth factor, steroid and steroid antagonist regulation of cyclin gene expression associated with changes in T-47D human breast cancer cell cycle progression. Mol. Cell. Biol., 13: 3577-3587, 1993.[Abstract/Free Full Text]
  23. Wilcken N. R. C., Sarcevic B., Musgrove E. A., Sutherland R. L. Differential effects of retinoids and antiestrogens on cell cycle progression and cell cycle regulatory genes in human breast cancer cells. Cell Growth Differ., 7: 65-74, 1996.[Abstract]
  24. Stein C. A., Subasinghe C., Shinokusa K., Cohen J. S. Physicochemical properties of phosphorothioate oligodeoxynucleotides. Nucleic Acids Res., 16: 3209-3221, 1988.[Abstract/Free Full Text]
  25. Burgess T. L., Fisher E. F., Ross S. L., Bready J. V., Qian Y-X., Bayewitch L. A., Cohen A. M., Herrera C. J., Hu S. S-F., Kramer T. B., Lott F. D., Martin F. H., Pierce G. F., Simonet L., Farrell C. L. The antiproliferative activity of c-myb and c-myc antisense oligonucleotides in smooth muscle cells is caused by a nonantisense mechanism. Proc. Natl. Acad. Sci. USA, 92: 4051-4055, 1995.[Abstract/Free Full Text]
  26. Barboule N., Chadebech P., Baldin V., Vidal S., Valette A. Involvement of p21 in mitotic exit after paclitaxel treatment in MCF-7 breast adenocarcinoma cell line. Oncogene, 15: 2867-2875, 1997.[Medline]
  27. Coats S., Flanagan W. M., Nourse J., Roberts J. M. Requirement of p27Kip1 for restriction point control of the fibroblast cell cycle. Science (Wash. DC), 272: 877-880, 1996.[Abstract]
  28. Coller H. A., Grandori C., Tamayo P., Colbert T., Lander E. S., Eisenman R. N., Golub T. R. Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proc. Natl. Acad. Sci. USA, 97: 3260-3265, 2000.[Abstract/Free Full Text]
  29. Claassen G. F., Hann S. R. A role for transcriptional repression of p21CIP1 by c-Myc in overcoming transforming growth factor ß-induced cell-cycle arrest. Proc. Natl. Acad. Sci. USA, 97: 9498-9503, 2000.[Abstract/Free Full Text]
  30. Kelly K., Cochran B. H., Stiles C. D., Leder P. Cell-specific regulation of the c-myc gene by lymphocyte mitogens and platelet-derived growth factor. Cell, 35: 603-610, 1983.[Medline]
  31. Dean M., Levine R. A., Ran W., Kindy M. S., Sonenshein G. E., Campisi J. Regulation of c-myc transcription and mRNA abundance by serum growth factors and cell contact. J. Biol. Chem., 261: 9161-9166, 1986.[Abstract/Free Full Text]
  32. Waters C. M., Littlewood T. D., Hancock D. C., Moore J. P., Evan G. I. c-myc protein expression in untransformed fibroblasts. Oncogene, 6: 797-805, 1991.[Medline]
  33. Schweinfest C. W., Fujiwara S., Lau L. F., Papas T. S. c-myc can induce expression of G0/G1 transition genes. Mol. Cell. Biol., 8: 3080-3087, 1988.[Abstract/Free Full Text]
  34. Nesbit C. E., Tersak J. M., Prochownik E. V. Myc oncogenes and human neoplastic disease. Oncogene, 18: 3004-3016, 1999.[Medline]
  35. Akie K., Dosaka-Akita H., Murakima A., Kawakami Y. A combination treatment of c-myc antisense DNA with all-trans-retinoic acid inhibits cell proliferation by downregulating c-myc expression in small cell lung cancer. Antisense Nucleic Acid Drug Dev., 10: 243-249, 2000.[Medline]
  36. Ebinuma H., Saito H., Saito Y., Wakabayashi K., Nakamura M., Kurose I., Ishii H. Antisense oligodeoxynucleotide against c-myc mRNA induces differentiation of human hepatocellular carcinoma cells. Int. J. Oncol., 15: 991-999, 1999.[Medline]
  37. Eilers M., Schirm S., Bishop J. M. The MYC protein activates transcription of the {alpha}-prothymosin gene. EMBO J., 10: 133-141, 1991.[Medline]
  38. Gartel A. L., Ye X., Goufman E., Shianov P., Hay N., Najmabadi F., Tyner A. L. Myc represses the p21(WAF1/CIP1) promoter and interacts with Sp1/Sp3. Proc. Natl. Acad. Sci. USA, 98: 4510-4515, 2001.[Abstract/Free Full Text]
  39. de Alboran I. M., O’Hagan R. C., Gartner F., Malynn B., Davidson L., Rickert R., Rajewsky K., DePinho R. A., Alt F. W. Analysis of C-MYC function in normal cells via conditional gene-targeted mutation. Immunity, 14: 45-55, 2001.[Medline]
  40. Daksis J. I., Lu R. Y., Facchini L. M., Marhin W. W., Penn L. J. Myc induces cyclin D1 expression in the absence of de novo protein synthesis and links mitogen-stimulated signal transduction to the cell cycle. Oncogene, 9: 3635-3645, 1994.[Medline]
  41. Philipp A., Schneider A., Vasrik I., Finke K., Xiong Y., Beach D., Alitalo K., Eilers M. Repression of cyclin D1: a novel function of MYC. Mol. Cell. Biol., 14: 4032-4043, 1994.[Abstract/Free Full Text]
  42. Peukert K., Staller P., Schneider A., Carmichael G., Hanel F., Eilers M. An alternative pathway for gene regulation by Myc. EMBO J., 16: 5672-5686, 1997.[Medline]
  43. Herber B., Truss M., Beato M., Muller R. Inducible regulatory elements in the human cyclin D1 promoter. Oncogene, 9: 1295-1304, 1994.[Medline]
  44. Steiner P., Philipp A., Lukas J., Godden-Kent D., Pagano M., Mittnacht S., Bartek J., Eilers M. Identification of a Myc-dependent step during the formation of active G1 cyclin-cdk complexes. EMBO J., 14: 4814-4826, 1995.[Medline]
  45. Haas K., Staller P., Geisen C., Bartek J., Eilers M., Moroy T. Mutual requirement of Cdk4 and Myc in malignant transformation: evidence for cyclin D1/Cdk4 and p16INK4A as upstream regulators of Myc. Oncogene, 15: 179-192, 1997.[Medline]
  46. Dubik D., Dembinski T. C., Shiu R. P. C. Stimulation of c-myc oncogene expression associated with estrogen-induced proliferation of human breast cancer cells. Cancer Res., 47: 6517-6521, 1987.[Abstract/Free Full Text]
  47. Bieche I., Laurendeau I., Tozlu S., Olivi M., Vidaud D., Lidereau R., Vidaud M. Quantitation of MYC gene expression in sporadic breast tumors with a real-time reverse transcription-PCR assay. Cancer Res., 59: 2759-2765, 1999.[Abstract/Free Full Text]
  48. Felsher D. W., Bishop J. M. Reversible tumorigenesis by MYC in hematopoietic lineages. Mol. Cell, 4: 199-207, 1999.[Medline]
  49. Pelengaris S., Littlewood T., Khan M., Elia G., Evan G. Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol. Cell, 3: 565-577, 1999.[Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Jung, A. Menssen, D. Mayr, and H. Hermeking
AP4 encodes a c-MYC-inducible repressor of p21
PNAS, September 30, 2008; 105(39): 15046 - 15051.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Levy, D. Tatomer, C. B. Herber, X. Zhao, H. Tang, T. Sargeant, L. J. Ball, J. Summers, T. P. Speed, and D. C. Leitman
Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene
Mol. Endocrinol., February 1, 2008; 22(2): 287 - 303.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Verykokakis, C. Papadaki, E. Vorgia, L. Le Gallic, and G. Mavrothalassitis
The RAS-dependent ERF Control of Cell Proliferation and Differentiation Is Mediated by c-Myc Repression
J. Biol. Chem., October 12, 2007; 282(41): 30285 - 30294.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
W-D Han, Y-L Zhao, Y-G Meng, L Zang, Z-Q Wu, Q Li, Y-L Si, K Huang, J-M Ba, H Morinaga, et al.
Estrogenically regulated LRP16 interacts with estrogen receptor {alpha} and enhances the receptor's transcriptional activity
Endocr. Relat. Cancer, September 1, 2007; 14(3): 741 - 753.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Drabsch, H. Hugo, R. Zhang, D. H. Dowhan, Y. R. Miao, A. M. Gewirtz, S. C. Barry, R. G. Ramsay, and T. J. Gonda
Mechanism of and requirement for estrogen-regulated MYB expression in estrogen-receptor-positive breast cancer cells
PNAS, August 21, 2007; 104(34): 13762 - 13767.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A M Lorincz and S Sukumar
Molecular links between obesity and breast cancer.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 279 - 292.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A. J Butt, C. M McNeil, E. A Musgrove, and R. L Sutherland
Downstream targets of growth factor and oestrogen signalling and endocrine resistance: the potential roles of c-Myc, cyclin D1 and cyclin E
Endocr. Relat. Cancer, July 1, 2005; 12(Supplement_1): S47 - S59.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
V. Martineti, L. Picariello, I. Tognarini, S. C. Sala, A. Gozzini, C. Azzari, C. Mavilia, A. Tanini, A. Falchetti, G. Fiorelli, et al.
ER{beta} is a potent inhibitor of cell proliferation in the HCT8 human colon cancer cell line through regulation of cell cycle components
Endocr. Relat. Cancer, June 1, 2005; 12(2): 455 - 469.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. R. Devi, T. M. Beer, C. L. Corless, V. Arora, D. L. Weller, and P. L. Iversen
In vivo Bioavailability and Pharmacokinetics of a c-MYC Antisense Phosphorodiamidate Morpholino Oligomer, AVI-4126, in Solid Tumors
Clin. Cancer Res., May 15, 2005; 11(10): 3930 - 3938.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mukherjee and S. E. Conrad
c-Myc Suppresses p21WAF1/CIP1 Expression during Estrogen Signaling and Antiestrogen Resistance in Human Breast Cancer Cells
J. Biol. Chem., May 6, 2005; 280(18): 17617 - 17625.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Gauduchon, F. Gouilleux, S. Maillard, V. Marsaud, J.-M. Renoir, and B. Sola
4-Hydroxytamoxifen Inhibits Proliferation of Multiple Myeloma Cells In vitro through Down-Regulation of c-Myc, Up-Regulation of p27Kip1, and Modulation of Bcl-2 Family Members
Clin. Cancer Res., March 15, 2005; 11(6): 2345 - 2354.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. M. Trost, E. U. Lausch, S. A. Fees, S. Schmitt, T. Enklaar, D. Reutzel, L. R. Brixel, P. Schmidtke, M. Maringer, I. B. Schiffer, et al.
Premature Senescence Is a Primary Fail-safe Mechanism of ERBB2-Driven Tumorigenesis in Breast Carcinoma Cells
Cancer Res., February 1, 2005; 65(3): 840 - 849.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
C. Osborne, P. Wilson, and D. Tripathy
Oncogenes and Tumor Suppressor Genes in Breast Cancer: Potential Diagnostic and Therapeutic Applications
Oncologist, July 1, 2004; 9(4): 361 - 377.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Strom, J. Hartman, J. S. Foster, S. Kietz, J. Wimalasena, and J.-A. Gustafsson
Estrogen receptor {beta} inhibits 17{beta}-estradiol-stimulated proliferation of the breast cancer cell line T47D
PNAS, February 10, 2004; 101(6): 1566 - 1571.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Paruthiyil, H. Parmar, V. Kerekatte, G. R. Cunha, G. L. Firestone, and D. C. Leitman
Estrogen Receptor {beta} Inhibits Human Breast Cancer Cell Proliferation and Tumor Formation by Causing a G2 Cell Cycle Arrest
Cancer Res., January 1, 2004; 64(1): 423 - 428.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. S. Carroll, D. K. Lynch, A. Swarbrick, J.-M. Renoir, B. Sarcevic, R. J. Daly, E. A. Musgrove, and R. L. Sutherland
p27Kip1 Induces Quiescence and Growth Factor Insensitivity in Tamoxifen-treated Breast Cancer Cells
Cancer Res., August 1, 2003; 63(15): 4322 - 4326.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. H. Wang, X. Y. Yang, X. Zhang, K. Mihalic, W. Xiao, and W. L. Farrar
The cis Decoy against the Estrogen Response Element Suppresses Breast Cancer Cells via Target Disrupting c-fos not Mitogen-activated Protein Kinase Activity
Cancer Res., May 1, 2003; 63(9): 2046 - 2051.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Saito-Ohara, I. Imoto, J. Inoue, H. Hosoi, A. Nakagawara, T. Sugimoto, and J. Inazawa
PPM1D Is a Potential Target for 17q Gain in Neuroblastoma
Cancer Res., April 15, 2003; 63(8): 1876 - 1883.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. F. Doisneau-Sixou, P. Cestac, S. Chouini, J. S. Carroll, A. D. Hamilton, S. M. Sebti, M. Poirot, P. Balaguer, J.-C. Faye, R. L. Sutherland, et al.
Contrasting Effects of Prenyltransferase Inhibitors on Estrogen-Dependent Cell Cycle Progression and Estrogen Receptor-Mediated Transcriptional Activity in MCF-7 Cells
Endocrinology, March 1, 2003; 144(3): 989 - 998.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carroll, J. S.
Right arrow Articles by Sutherland, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carroll, J. S.
Right arrow Articles by Sutherland, R. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online