| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Intramural Research Support Program, SAIC-Frederick, Inc. [I. K., L. G., F-M. D.] and Laboratory of Immunobiology [K. D., M. I. L.], National Cancer Institute Frederick, Frederick, Maryland 21702; Laboratory of Pathology [J. W. G., M. R. E-B.] and Urologic Oncology Branch [Y. Y., C. D. V., W. M. L.], National Cancer Institute Bethesda, Bethesda, Maryland 20892; MTC and CGR, The Karolinska Institute, 171 77 Stockholm, Sweden [A. P., E. Z.]; Engelhardt Institute of Molecular Biology, Moscow 117984, Russia [E. Z.]; Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX 75390 [J. D. M.]; and Center for Prostate Disease Research, Uniformed Services University of Health Sciences, Bethesda, Maryland, 20814 [J. S. R.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines.
Cryopreserved normal human prostate stromal (PrSC passage 4) and epithelial (PrEC passage 2) cells were purchased from Clonetics-BioWhittaker, Inc. (Walkersville, MD). The cells were propagated for an additional two passages and used for DNA and RNA isolation. DU145, LNCaP, and PC3 prostate carcinoma cell lines were purchased from American Type Culture Collection (Manassas, VA). ND-1 prostate carcinoma cell line was obtained from SAIC-Frederick, Inc., Biopharmaceutical Manufacturing and Quality Operations (Frederick, MD). R. M. Sramkoski (Comprehensive Cancer Center, Cleveland, OH) provided the 22Rv1 prostate carcinoma line. HPV-immortalized human prostate cell lines 1512T, 1512N, 1542T, 1542N, 1550T, and 1550N (15)
; HPV18 C-l (normal prostate epithelial cells immortalized with HPV18 DNA); Ki-MuSV virus Ki-ras-transformed HPV18 C-l (16)
; and 129NU5002-1 (17)
were described elsewhere. HPV-immortalized prostate carcinoma line RC53T/E6E7 was developed by Johng S. Rhim.4
RC-58T/hTERT prostate carcinoma line adapted to cell culture by infection with a retroviral vector expressing the hTERT was described elsewhere (18)
.
Cell culture immortalization of the cell lines 1512T, 1512N, 1542T, 1542N, 1550T, 1550N, and RC53TE6E7 was accomplished by transduction of actively proliferating cells with a recombinant retrovirus encoding the E6- and E7-transforming proteins of HPV 16 and the selection marker neomycin phosphotransferase (15) . Immortalization of HPV18 C-l was performed by a plasmid containing a complete single copy of the HPV 18 genome inserted into the pSV2neo plasmid; E7 gene product was identified in HPV18 C-l cells using antibody (16) .
Analysis of Methylation of RASSF1 Promoters.
Bisulfite sequencing and methylation analyses for RASSF1A and RASSF1C promoters were described elsewhere (7)
. RASSF1A and RASSF1C PCR produced fragments of 377 and 224 bp, respectively. However, for methylation analysis of DNA samples obtained after microdissection, a shorter PCR fragment was amplified (190 bp). Primers used for the first PCR were B-RAS-E-5D (GGGTTTTATAGTTTTTGTATTTAGGT) and B-RAS-E-3R (CAACTCAATAAACTCAAACTCCCC) at 94°C, 30 s; 58°C, 30 s; 72°C, 30 s; 35 cycles in FailSafe buffer I purchased from Epicentre Technologies (Madison, WI), followed by nested PCR with primers B-RAS-E-4D: TTTAGTTTGGATTTTGGGGGAGG and B-RAS-E-7R: TCRCTAACTTTAAACRCTAACAAAC using the same PCR protocol in FailSafe buffer H. Each PCR fragment was digested with BstUI and MspI and run on 420% gradient polyacrylamide gel (Invitrogen, Carlsbad, CA).
RASSF1A Expression Analysis.
RASSF1A mRNA RT-PCR quantification was performed with PCR primers described previously (7)
. A portion (0.1 µg) of total RNA per reverse transcriptase reaction was used. For each sample, five reverse transcriptase reactions (5 µl each) were set up using RETROscript kit (Ambion, Inc., Austin, TX) in the presence of different amounts of competing artificial RASSF1A RNA (7)
carrying a 20-bp deletion (1, 0.1, 0.01, 0.001, 0.0001, and 0.00001% of total RNA). The competing artificial RASSF1A RNA produced a shorter PCR band. First and nested PCR reactions were carried out in FailSafe buffer H (Epicentre Technologies) at 95°C for 30 s and at 72°C for 40 s. Depending on the amount of PCR product, 2035 cycles were necessary for each PCR. The amount of RASSF1A mRNA in each sample was estimated by comparison of the relative intensity of the normal and truncated PCR bands after 420% gradient PAGE.
Mutation Screening.
For mutation screening, RASSF1A coding region was amplified using primers RASSF1A-1D: AGCGCCCAAAGCCAGCGAAGCACG and RASSF1A-1R: CCCCACTGGCCCTGTCACACTCACA for 35 cycles at 95°C for 30 s and 72°C for 2 min in FailSafe buffer E (Epicentre Technologies). For nested PCR, we used primers RASSF1A-2D: GAAGCACGGGCCCAACCGGGCC and RASSF1A-2R: ACGCACTTGGCGCTGCCTGCTGTC in FailSafe buffer D (Epicentre Technologies). The PCR reaction was carried out at 95°C for 30 s, 67°C for 30 s, and 72°C for 2 min. The final PCR products were cloned and sequenced.
Cell Growth Assay.
Retroviral vector pLNCtTA-EF1
, encoding a tTA, was used to engineer LNCaP prostate carcinoma cells to constitutively produce tTA (19)
. The cells were maintained in RPMI 1640 with the addition of 15% FCS, 20 µg/ml hydrocortisone, and 500 µg/ml G418. Wild-type and mutant RASSF1A (Val211Ala) reading frames were subcloned into an episomal tetracycline-regulated vector pETE (19)
. The constructs were transfected into LNCaP/tTA cells. Stably transfected clones expressing RASSF1A transcript were expanded, seeded into 24-well plates, and grown for
15 days. For each line, the cells were trypsinized and counted in triplicate every other day.
| RESULTS |
|---|
|
|
|---|
Using this approach, we found no methylation of the RASSF1A promoter in any of the DNA from normal microdissected tissues (Table 1
; Fig. 1
). Complete promoter methylation was evident in 7 of 11 tumor samples, as demonstrated by BstUI digest, whereas the remaining 4 DNAs were partially methylated. Therefore, all analyzed tumors exhibited some degree of aberrant RASSF1A promoter hypermethylation, 63% of them being completely methylated.
|
|
|
|
The RASSF1A gene was also silenced in another prostate carcinoma cell line, RC-58T/hTERT (18)
, immortalized by overexpression of hTERT (Table 2)
.
Absence of RASSF1A Methylation in HPV-immortalized Prostate Cell Lines.
Adaptation of prostate carcinoma cells for growth in culture always represents a significant challenge. To alleviate this problem, the primary tumor cells are often "immortalized" by transfection with SV40 virus or an HPV DNA. We tested the expression of the RASSF1A gene in four prostate carcinoma cell lines, adapted to grow in cell culture by transfection with the DNA, which expresses E6/E7-transforming proteins of HPV serotype 16 or 18 (11
, 16)
. Unexpectedly, all four tested HPV-transformed cell lines (1512T, 1542T, 1550T, and RC53T/E6E7) expressed normal levels of RASSF1A mRNA (Table 2)
. Similar amounts of RASSF1A mRNA (from 0.001 to 0.005% of total RNA) were present in matching HPV-immortalized cell lines derived from the normal epithelial cells of the same patients (1512N, 1542N, and 1550N).
Normal expression of the RASSF1A transcript was also detected in a set of prostate epithelial cell lines immortalized by transfection with HPV-18 DNA and expressing the HPV-18 E7 gene product. This panel includes the original immortalized human prostate epithelial cell line HPV18 C-l, Ki-ras-transformed HPV18 C-l cells, which acquired the ability to grow in nude mice (16)
, and a malignant subclone of HPV18 C-l (129NU5002-1) selected after multiple exposure to the chemical carcinogen N-nitroso-N-methylurea (17)
. No RASSF1A mutations were found in the 129NU5002-1 derivative of the HPV18 C-l (Table 2)
.
Re-expression of RASSF1A Gene in LNCaP Cells Suppresses their Growth in Vitro.
LNCaP cells constitutively producing tTA tetracycline trans-activator (19)
were transfected with the episomal pETE tetracycline-regulated vector, carrying a wild-type or mutated (Val211Ala) RASSF1A cDNA (7)
. These episomal vectors provide more reproducible and uniform expression of transgenes. Hygromycin-resistant cells expressing high levels of RASSF1A mRNA from the plasmid (>0.005% of total RNA) were assessed for growth on plastic surfaces in the absence of doxycycline. The original LNCaP cells and the clone encoding the mutant RASSF1A protein had virtually identical growth curves. In contrast, growth of the cells expressing wild-type RASSF1A protein was suppressed >10-fold (Fig. 3)
.
|
Renal cell carcinoma line KRC/Y was less sensitive to low levels of RASSF1A mRNA re-expression. Similar 10-fold growth suppression was achieved in these cells only when RASSF1A expression exceeded 0.005% of total RNA (7) .
| DISCUSSION |
|---|
|
|
|---|
As a consequence of frequent RASSF1A promoter methylation, the gene is often silenced in freshly explanted primary prostate tumors but not in normal prostate epithelial or stromal cells. Silencing and hypermethylation of the RASSF1A was also found in all five widely used permanent prostate carcinoma cell lines, which were adapted to cell culture spontaneously and in an hTERT-transformed line.
Unexpectedly, the gene was expressed in all studied HPV-immortalized lines. The extent of the prostate HPV infections and their role, if any, in prostate tumorigenesis remains highly controversial (21) . In one study, seropositivity against HPV-18 was associated with a 2.6-fold increase in the risk of developing prostate cancer. Our data point to a possible correlation between HPV infection and RASSF1A expression. This correlation could reflect a functional interaction between the cellular RASSF1A and the viral E6/E7 proteins, which may play important roles in both neoplastic transformation and immortalization of the prostate epithelial cells. In this case, the high rate of RASSF1A methylation in primary prostate cancer would imply that HPV is only involved in a limited number of the natural prostate tumors.
Evidence for causal association between HPV and a subset of head and neck cancers was recently reported (22) . Therefore, similar reverse correlation between HPV infections and RASSF1A methylation may exist for this type of cancer.
The HPV infections are recognized as a major contributor to the development of cervical neoplasia. HPV DNA was detected in 93% of the cervical tumors worldwide (23) . Interestingly, RASSF1Amethylation was not identified in primary cervical tumors. Currently, this tumor type remains the only reported one in which RASSF1A methylation has not been found (4) . However, HPV presence was not assessed in that particular study. Simultaneous assessment of RASSF1A inactivation and HPV presence in cervical carcinomas may reveal this putative correlation.
We assessed RASSF1A status in a panel of prostate cell lines of the same origin transformed either by the introduction of activated Ki-ras (16)
or by a chemical carcinogen, N-nitroso-N-methylurea (129NU5002-1 cells; Ref. 17
). Cells (129NU5002-1) acquired tumorigenic phenotype without the involvement of RAS proteins. In both tumorigenic cell lines, no RASSF1A dysregulation was found (Table 2)
.
In our final experiment, the RASSF1A expression construct was reintroduced into a prostate carcinoma cell line in which the endogenous RASSF1A gene was silenced. Re-expression of the wild-type, but not mutant, RASSF1A suppressed the growth of the prostate carcinoma cell line LNCaP in vitro. Prostate LNCaP cells were significantly more sensitive to low levels of RASSF1A expression compared with a KRC/Y renal carcinoma cell line (7) . A >10-fold growth suppression of LNCaP was observed after reintroduction of the RASSF1A transgene.
Our data implicate RASSF1A gene in human prostate tumorigenesis.
| FOOTNOTES |
|---|
1 Supported in part with Federal funds from the National Cancer Institute, NIH, under Contract No. NO1-CO-12400. A. P. and E. Z. were supported by research grants from the Swedish Cancer Society, Pharmacia Corp., Karolinska Institute and Swedish Research Council. J. D. M. was supported by National Cancer Institute Grants CA71618 and SPORE P50 CA70907 and by the G. Harold and Leila Y. Mathers Charitable Foundation. ![]()
2 To whom requests for reprints should be addressed, at Intramural Research Support Program, Building 560, Room 12-34, SAIC-Frederick, Inc., National Cancer Institute Frederick, Frederick, MD 21702. Phone: (301) 846-7320; Fax: (301) 846-6145; E-mail: kuzmin{at}mail.ncifcrf.gov ![]()
3 The abbreviations used are: hTERT, human telomerase catalytic subunit; RT-PCR, reverse transcription-PCR; HPV, human papillomavirus; tTA, tetracycline-controlled transcriptional activator. ![]()
4 Johng S. Rhim, unpublished observations. ![]()
Received 2/15/02. Accepted 4/15/02.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Donninger, M. D. Vos, and G. J. Clark The RASSF1A tumor suppressor J. Cell Sci., September 15, 2007; 120(18): 3163 - 3172. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kwabi-Addo, W. Chung, L. Shen, M. Ittmann, T. Wheeler, J. Jelinek, and J.-P. J. Issa Age-Related DNA Methylation Changes in Normal Human Prostate Tissues Clin. Cancer Res., July 1, 2007; 13(13): 3796 - 3802. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Angeloni Molecular analysis of deletions in human chromosome 3p21 and the role of resident cancer genes in disease Brief Funct Genomic Proteomic, May 24, 2007; (2007) elm007v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Roupret, V. Hupertan, D. R. Yates, J. W.F. Catto, I. Rehman, M. Meuth, S. Ricci, R. Lacave, G. Cancel-Tassin, A. de la Taille, et al. Molecular Detection of Localized Prostate Cancer Using Quantitative Methylation-Specific PCR on Urinary Cells Obtained Following Prostate Massage Clin. Cancer Res., March 15, 2007; 13(6): 1720 - 1725. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Geli, N. Kiss, F. Lanner, T. Foukakis, N. Natalishvili, O. Larsson, P. Kogner, A. Hoog, G. J Clark, T. J Ekstrom, et al. The Ras effectors NORE1A and RASSF1A are frequently inactivated in pheochromocytoma and abdominal paraganglioma Endocr. Relat. Cancer, March 1, 2007; 14(1): 125 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. G. Amaar, M. G. Minera, L. K. Hatran, D. D. Strong, S. Mohan, and M. E. Reeves Ras association domain family 1C protein stimulates human lung cancer cell proliferation Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1185 - L1190. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S Perry, R. Foley, K. Woodson, and M. Lawler The emerging roles of DNA methylation in the clinical management of prostate cancer. Endocr. Relat. Cancer, June 1, 2006; 13(2): 357 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Vos, A. Dallol, K. Eckfeld, N. P. C. Allen, H. Donninger, L. B. Hesson, D. Calvisi, F. Latif, and G. J. Clark The RASSF1A Tumor Suppressor Activates Bax via MOAP-1 J. Biol. Chem., February 24, 2006; 281(8): 4557 - 4563. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. McCabe, J. A. Low, S. Daignault, M. J. Imperiale, K. J. Wojno, and M. L. Day Inhibition of DNA Methyltransferase Activity Prevents Tumorigenesis in a Mouse Model of Prostate Cancer Cancer Res., January 1, 2006; 66(1): 385 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ni, X. Wen, J. Yao, H.-C. Chang, Y. Yin, M. Zhang, S. Xie, M. Chen, B. Simons, P. Chang, et al. Tocopherol-Associated Protein Suppresses Prostate Cancer Cell Growth by Inhibition of the Phosphoinositide 3-Kinase Pathway Cancer Res., November 1, 2005; 65(21): 9807 - 9816. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O. Hoque, O. Topaloglu, S. Begum, R. Henrique, E. Rosenbaum, W. Van Criekinge, W. H. Westra, and D. Sidransky Quantitative Methylation-Specific Polymerase Chain Reaction Gene Patterns in Urine Sediment Distinguish Prostate Cancer Patients From Control Subjects J. Clin. Oncol., September 20, 2005; 23(27): 6569 - 6575. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Dote, D. Cerna, W. E. Burgan, D. J. Carter, M. A. Cerra, M. G. Hollingshead, K. Camphausen, and P. J. Tofilon Enhancement of In vitro and In vivo Tumor Cell Radiosensitivity by the DNA Methylation Inhibitor Zebularine Clin. Cancer Res., June 15, 2005; 11(12): 4571 - 4579. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lodygin, A. Epanchintsev, A. Menssen, J. Diebold, and H. Hermeking Functional Epigenomics Identifies Genes Frequently Silenced in Prostate Cancer Cancer Res., May 15, 2005; 65(10): 4218 - 4227. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Agathanggelou, W. N. Cooper, and F. Latif Role of the Ras-Association Domain Family 1 Tumor Suppressor Gene in Human Cancers Cancer Res., May 1, 2005; 65(9): 3497 - 3508. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Song, J. S. Chang, S. J. Song, T. H. Yang, H. Lee, and D.-S. Lim The Centrosomal Protein RAS Association Domain Family Protein 1A (RASSF1A)-binding Protein 1 Regulates Mitotic Progression by Recruiting RASSF1A to Spindle Poles J. Biol. Chem., February 4, 2005; 280(5): 3920 - 3927. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-C. Li, P. R. Carroll, and R. Dahiya Epigenetic Changes in Prostate Cancer: Implication for Diagnosis and Treatment J Natl Cancer Inst, January 19, 2005; 97(2): 103 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tommasi, R. Dammann, Z. Zhang, Y. Wang, L. Liu, W. M. Tsark, S. P. Wilczynski, J. Li, M. You, and G. P. Pfeifer Tumor Susceptibility of Rassf1a Knockout Mice Cancer Res., January 1, 2005; 65(1): 92 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jeronimo, R. Henrique, M. O. Hoque, E. Mambo, F. R. Ribeiro, G. Varzim, J. Oliveira, M. R. Teixeira, C. Lopes, and D. Sidransky A Quantitative Promoter Methylation Profile of Prostate Cancer Clin. Cancer Res., December 15, 2004; 10(24): 8472 - 8478. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dallol, A. Agathanggelou, S. L. Fenton, J. Ahmed-Choudhury, L. Hesson, M. D. Vos, G. J. Clark, J. Downward, E. R. Maher, and F. Latif RASSF1A Interacts with Microtubule-Associated Proteins and Modulates Microtubule Dynamics Cancer Res., June 15, 2004; 64(12): 4112 - 4116. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D Vos, A. Martinez, C. Elam, A. Dallol, B. J Taylor, F. Latif, and G. J Clark A Role for the RASSF1A Tumor Suppressor in the Regulation of Tubulin Polymerization and Genomic Stability Cancer Res., June 15, 2004; 64(12): 4244 - 4250. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. H. N. Wong, J. Chan, J. Wong, and P. K. H. Tam Ubiquitous Aberrant RASSF1A Promoter Methylation in Childhood Neoplasia1 Clin. Cancer Res., February 1, 2004; 10(3): 994 - 1002. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Fenton, A. Dallol, A. Agathanggelou, L. Hesson, J. Ahmed-Choudhury, S. Baksh, C. Sardet, R. Dammann, J. D. Minna, J. Downward, et al. Identification of the E1A-Regulated Transcription Factor p120E4F as an Interacting Partner of the RASSF1A Candidate Tumor Suppressor Gene Cancer Res., January 1, 2004; 64(1): 102 - 107. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-H. Kim, J. S. Kim, J.-H. Park, S. K. Lee, Y.-I. Ji, Y. M. Kwon, Y. M. Shim, J. Han, and J. Park Relationship of Ras Association Domain Family 1 Methylation and K-Ras Mutation in Primary Non-Small Cell Lung Cancer Cancer Res., October 1, 2003; 63(19): 6206 - 6211. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Agathanggelou, I. Bieche, J. Ahmed-Choudhury, B. Nicke, R. Dammann, S. Baksh, B. Gao, J. D. Minna, J. Downward, E. R. Maher, et al. Identification of Novel Gene Expression Targets for the Ras Association Domain Family 1 (RASSF1A) Tumor Suppressor Gene in Non-Small Cell Lung Cancer and Neuroblastoma Cancer Res., September 1, 2003; 63(17): 5344 - 5351. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.A. Schulz, M. Burchardt, and M.V. Cronauer Molecular biology of prostate cancer Mol. Hum. Reprod., August 1, 2003; 9(8): 437 - 448. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cohen, G. Singer, O. Lavie, S. M. Dong, U. Beller, and D. Sidransky The RASSF1A Tumor Suppressor Gene Is Commonly Inactivated in Adenocarcinoma of the Uterine Cervix Clin. Cancer Res., August 1, 2003; 9(8): 2981 - 2984. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kuzmin, L. Liu, R. Dammann, L. Geil, E. J. Stanbridge, S. P. Wilczynski, M. I. Lerman, and G. P. Pfeifer Inactivation of RAS Association Domain Family 1A Gene in Cervical Carcinomas and the Role of Human Papillomavirus Infection Cancer Res., April 15, 2003; 63(8): 1888 - 1893. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Spugnardi, S. Tommasi, R. Dammann, G. P. Pfeifer, and D. S. B. Hoon Epigenetic Inactivation of RAS Association Domain Family Protein 1 (RASSF1A) in Malignant Cutaneous Melanoma Cancer Res., April 1, 2003; 63(7): 1639 - 1643. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |