Cancer Research Annual Meeting 2010  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuzmin, I.
Right arrow Articles by Lerman, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuzmin, I.
Right arrow Articles by Lerman, M. I.
[Cancer Research 62, 3498-3502, June 15, 2002]
© 2002 American Association for Cancer Research


Molecular Biology and Genetics

The RASSF1A Tumor Suppressor Gene Is Inactivated in Prostate Tumors and Suppresses Growth of Prostate Carcinoma Cells1

Igor Kuzmin2, John W. Gillespie, Alexei Protopopov, Laura Geil, Koen Dreijerink, Youfeng Yang, Cathy D. Vocke, Fuh-Mei Duh, Eugene Zabarovsky, John D. Minna, Johng S. Rhim, Michael R. Emmert-Buck, W. Marston Linehan and Michael I. Lerman

Intramural Research Support Program, SAIC-Frederick, Inc. [I. K., L. G., F-M. D.] and Laboratory of Immunobiology [K. D., M. I. L.], National Cancer Institute Frederick, Frederick, Maryland 21702; Laboratory of Pathology [J. W. G., M. R. E-B.] and Urologic Oncology Branch [Y. Y., C. D. V., W. M. L.], National Cancer Institute Bethesda, Bethesda, Maryland 20892; MTC and CGR, The Karolinska Institute, 171 77 Stockholm, Sweden [A. P., E. Z.]; Engelhardt Institute of Molecular Biology, Moscow 117984, Russia [E. Z.]; Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX 75390 [J. D. M.]; and Center for Prostate Disease Research, Uniformed Services University of Health Sciences, Bethesda, Maryland, 20814 [J. S. R.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We analyzed expression status of the recently identified tumor suppressor geneRASSF1A in primary prostate carcinomas and in prostate cell lines. We found complete methylation of the RASSF1A promoter in 63% of primary microdissected prostate carcinomas (7 of 11 samples). The remaining 4 samples (37%) were partially methylated, possibly because of contamination with normal cells. No promoter methylation was observed in matching normal prostate tissues. High levels of RASSF1A transcript and no methylation of RASSF1A promoter were found in explanted primary normal prostate epithelial and stromal cells. Complete silencing and methylation of RASSF1A promoter was observed in five widely used prostate carcinoma cell lines, which acquired the ability to grow in culture spontaneously, including LNCaP, PC-3, ND-1, DU-145, 22Rv1, and one primary prostate carcinoma immortalized by overexpression of the human telomerase catalytic subunit (RC-58T/hTERT). However, no silencing of RASSF1A was found in four other prostate carcinoma cell lines, which were adapted for cell culture after transformation with human papillomaviral DNA. Suppression of cell growth in vitro was demonstrated after the reintroduction of RASSF1A-expressing construct into LNCaP prostate carcinoma cells. Our data implicate the RASSF1A gene in human prostate tumorigenesis.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The RAS family of proto-oncogenes plays a fundamental role in signal transduction pathways involved in cellular proliferation and survival, interacting with other regulatory circuits of cell growth and death. In each cell type, the final outcome of the RAS-mediated signals depends on a particular intracellular environment, which includes a diverse array of effector proteins (1) . Many known RAS effectors are oncoproteins on their own and, when overexpressed, may cause reduction of growth factor dependency, promote loss of contact inhibition, resistance to apoptosis, or other features of the tumor phenotype. Less is known about RAS effectors possessing tumor suppressor properties. Recently, a new family of genes encoding RAS-binding proteins, RASSF1, has been identified within the critical lung and breast cancer deletion region at 3p21.3 (2 , 3) . Two GC-rich promoters were found, producing RASSF1A and RASSF1C transcripts. The RASSF1A gene is silenced by highly selective aberrant methylation of promoter A in a large fraction of lung (2 , 4 , 5) , breast (4 , 5) , ovarian (4) , nasopharyngeal (6) , kidney (7 , 8) , gastric (9) , bladder tumors (10 , 11) , and in neuroblastomas and pheochromocytomas (12) . RASSF1A gene was also shown to be mutated in 9.5% of primary nasopharyngeal carcinomas (6) . In bladder carcinomas, RASSF1A hypermethylation was correlated with poor prognosis (11) . Re-expression of the RASSF1A transcript in lung and clear renal carcinoma cells reduced colony formation and suppressed anchorage-independent growth (2 , 5 , 7) . Both RASSF1A and RASSF1C proteins possess the RAS-binding domain, which binds RAS in a GTP-dependent manner in vivo and in vitro (13) . This domain was shown to mediate apoptotic response within the ras-signaling pathway in the 293-T human fetal kidney cells (13) . In the present study, we investigated the expression of RASSF1A in primary prostate carcinomas in normal prostate stromal and epithelial cells using laser capture microdissection technique. RASSF1A expression was also analyzed in spontaneously, hTERT3 - and HPV-immortalized prostate tumor cell lines and in primary explanted normal and tumor prostate cells. Finally, the RASSF1A gene was re-expressed in LNCaP prostate carcinoma cells to assess its growth suppression activity.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Laser Capture Microdissection.
Prostatectomy specimens were fixed overnight in 70% ethanol and processed in increased concentrations of ethanol and xylene, then embedded in paraffin, cut into glass slides, dewaxed, and stained with eosin. Areas corresponding to cancer or normal tissues were dissected (14) , placed in proteinase K solution, and incubated overnight at 55°C. After that, the samples were incubated at 95°C for 8 min.

Cell Lines.
Cryopreserved normal human prostate stromal (PrSC passage 4) and epithelial (PrEC passage 2) cells were purchased from Clonetics-BioWhittaker, Inc. (Walkersville, MD). The cells were propagated for an additional two passages and used for DNA and RNA isolation. DU145, LNCaP, and PC3 prostate carcinoma cell lines were purchased from American Type Culture Collection (Manassas, VA). ND-1 prostate carcinoma cell line was obtained from SAIC-Frederick, Inc., Biopharmaceutical Manufacturing and Quality Operations (Frederick, MD). R. M. Sramkoski (Comprehensive Cancer Center, Cleveland, OH) provided the 22Rv1 prostate carcinoma line. HPV-immortalized human prostate cell lines 1512T, 1512N, 1542T, 1542N, 1550T, and 1550N (15) ; HPV18 C-l (normal prostate epithelial cells immortalized with HPV18 DNA); Ki-MuSV virus Ki-ras-transformed HPV18 C-l (16) ; and 129NU5002-1 (17) were described elsewhere. HPV-immortalized prostate carcinoma line RC53T/E6E7 was developed by Johng S. Rhim.4 RC-58T/hTERT prostate carcinoma line adapted to cell culture by infection with a retroviral vector expressing the hTERT was described elsewhere (18) .

Cell culture immortalization of the cell lines 1512T, 1512N, 1542T, 1542N, 1550T, 1550N, and RC53TE6E7 was accomplished by transduction of actively proliferating cells with a recombinant retrovirus encoding the E6- and E7-transforming proteins of HPV 16 and the selection marker neomycin phosphotransferase (15) . Immortalization of HPV18 C-l was performed by a plasmid containing a complete single copy of the HPV 18 genome inserted into the pSV2neo plasmid; E7 gene product was identified in HPV18 C-l cells using antibody (16) .

Analysis of Methylation of RASSF1 Promoters.
Bisulfite sequencing and methylation analyses for RASSF1A and RASSF1C promoters were described elsewhere (7) . RASSF1A and RASSF1C PCR produced fragments of 377 and 224 bp, respectively. However, for methylation analysis of DNA samples obtained after microdissection, a shorter PCR fragment was amplified (190 bp). Primers used for the first PCR were B-RAS-E-5D (GGGTTTTATAGTTTTTGTATTTAGGT) and B-RAS-E-3R (CAACTCAATAAACTCAAACTCCCC) at 94°C, 30 s; 58°C, 30 s; 72°C, 30 s; 35 cycles in FailSafe buffer I purchased from Epicentre Technologies (Madison, WI), followed by nested PCR with primers B-RAS-E-4D: TTTAGTTTGGATTTTGGGGGAGG and B-RAS-E-7R: TCRCTAACTTTAAACRCTAACAAAC using the same PCR protocol in FailSafe buffer H. Each PCR fragment was digested with BstUI and MspI and run on 4–20% gradient polyacrylamide gel (Invitrogen, Carlsbad, CA).

RASSF1A Expression Analysis.
RASSF1A mRNA RT-PCR quantification was performed with PCR primers described previously (7) . A portion (0.1 µg) of total RNA per reverse transcriptase reaction was used. For each sample, five reverse transcriptase reactions (5 µl each) were set up using RETROscript kit (Ambion, Inc., Austin, TX) in the presence of different amounts of competing artificial RASSF1A RNA (7) carrying a 20-bp deletion (1, 0.1, 0.01, 0.001, 0.0001, and 0.00001% of total RNA). The competing artificial RASSF1A RNA produced a shorter PCR band. First and nested PCR reactions were carried out in FailSafe buffer H (Epicentre Technologies) at 95°C for 30 s and at 72°C for 40 s. Depending on the amount of PCR product, 20–35 cycles were necessary for each PCR. The amount of RASSF1A mRNA in each sample was estimated by comparison of the relative intensity of the normal and truncated PCR bands after 4–20% gradient PAGE.

Mutation Screening.
For mutation screening, RASSF1A coding region was amplified using primers RASSF1A-1D: AGCGCCCAAAGCCAGCGAAGCACG and RASSF1A-1R: CCCCACTGGCCCTGTCACACTCACA for 35 cycles at 95°C for 30 s and 72°C for 2 min in FailSafe buffer E (Epicentre Technologies). For nested PCR, we used primers RASSF1A-2D: GAAGCACGGGCCCAACCGGGCC and RASSF1A-2R: ACGCACTTGGCGCTGCCTGCTGTC in FailSafe buffer D (Epicentre Technologies). The PCR reaction was carried out at 95°C for 30 s, 67°C for 30 s, and 72°C for 2 min. The final PCR products were cloned and sequenced.

Cell Growth Assay.
Retroviral vector pLNCtTA-EF1{alpha}, encoding a tTA, was used to engineer LNCaP prostate carcinoma cells to constitutively produce tTA (19) . The cells were maintained in RPMI 1640 with the addition of 15% FCS, 20 µg/ml hydrocortisone, and 500 µg/ml G418. Wild-type and mutant RASSF1A (Val211Ala) reading frames were subcloned into an episomal tetracycline-regulated vector pETE (19) . The constructs were transfected into LNCaP/tTA cells. Stably transfected clones expressing RASSF1A transcript were expanded, seeded into 24-well plates, and grown for <=15 days. For each line, the cells were trypsinized and counted in triplicate every other day.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
RASSF1A Promoter Is Hypermethylated and Silenced in Primary Prostate Tumors.
Microdissected tumors and matching normal prostate tissues were obtained from resected tissues of 11 individuals. DNA was isolated and treated with sodium bisulfite as described in "Materials and Methods." The original target sequence contained one BstUI cutting site. The RASSF1A promoter region was amplified by PCR and digested with BstUI. Only those BstUI CGCG restriction sites that had both cytosines methylated in the original DNA remained preserved after sodium bisulfite treatment and PCR amplification. Therefore, BstUI cuts of the PCR products indicated methylation of the original DNA. To verify complete DNA sequence conversion after bisulfite treatment, the same PCR fragments were digested with MspI. This enzyme recognizes a CCGG sequence that is not preserved in bisulfite-converted DNA, regardless of its methylation status. As expected, MspI cut none of the PCR fragments.

Using this approach, we found no methylation of the RASSF1A promoter in any of the DNA from normal microdissected tissues (Table 1Citation ; Fig. 1Citation ). Complete promoter methylation was evident in 7 of 11 tumor samples, as demonstrated by BstUI digest, whereas the remaining 4 DNAs were partially methylated. Therefore, all analyzed tumors exhibited some degree of aberrant RASSF1A promoter hypermethylation, 63% of them being completely methylated.


View this table:
[in this window]
[in a new window]

 
Table 1 RASSF1A methylaton in primary prostate normal and tumor samples

 


View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Methylation status of the RASSF1A promoter in prostate tumors and matching normal prostate tissues. BstUI, indicates promoter methylation in tumors.

 
In a separate experiment, RASSF1A expression was analyzed during the first passage of two primary explanted prostate carcinoma tumors (Table 2)Citation . In one tumor (RC-123T), RASSF1A mRNA was not expressed, whereas the matching normal prostate epithelial cells (RC123N) had normal RASSF1A expression. In the second tumor sample (RC114T), we found normal expression of RASSF1A. No mutations were detected in this sample after the RASSF1A reading frame was reverse transcribed, cloned, and sequenced.


View this table:
[in this window]
[in a new window]

 
Table 2 RASSF1A inactivation in prostate cell lines

 
Silencing and Methylation of RASSF1A Gene in "Spontaneously" Immortalized Prostate Cell Lines.
To further establish a correlation between RASSF1A transcriptional silencing and hypermethylation of the respective promoter, we analyzed RASSF1A methylation and transcription in a number of primary and immortalized prostate cell lines. No RASSF1A promoter methylation was found in primary explanted normal human stromal prostate cells. In primary normal prostate epithelial cells obtained from the same donor, we found low level promoter methylation (Table 2Citation ; Fig. 2Citation ). Compared with stromal cells, RASSF1A expression in epithelial cells was slightly decreased. A complete absence of the transcript and heavy methylation of the RASSF1A promoter was found in all "spontaneously immortalized" prostate carcinoma cell lines, including DU 145, LNCaP, PC3, 22Rv1, and ND-1. According to quantitative RT-PCR analysis, the relative amount of the RASSF1A mRNA in each of these samples was well below 0.0001% of total RNA (Fig. 2)Citation . We were able to reverse RASSF1A silencing in PC3 cells after treatment with 5 µM 5-aza-2'-deoxycytidine for 3 days (data not shown). Other cell lines were not tested. The RASSF1C promoter remained unmethylated in all examined cell lines (data not shown); therefore, RASSF1A methylation was highly specific in all affected cell lines.



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Promoter methylation and RASSF1Aexpression in prostate normal and tumor cells. A, combined bisulfite-restriction analysis of the RASSF1Apromoter in normal and tumor prostate cells. Genomic DNA was treated with bisulfite, RASSF1Apromoter was amplified by PCR, and the product was digested with BstUI or MspI. B, bisulfite sequencing of the PCR-amplified products from A. For methylation analysis, PCR fragments were subcloned, and several plasmid clones were sequenced. Each horizontal row corresponds to one plasmid clone and contains 32 yellow and green squares representing unmethylated and methylated CpG dinucleotides, respectively. Gray squares delineate CpG dinucleotides within BstUI recognition sites. C, quantification of the RASSF1A transcript by RT-PCR. The amount of the competitor RASSF1A RNA added to each reverse transcriptase reaction is indicated.

 
According to recent publications, most of the prostate carcinoma cell lines used in this experiment are authentic and unique. Only the DU 145 cells were shown to share common origin with the ND-1 cell line (20) .

The RASSF1A gene was also silenced in another prostate carcinoma cell line, RC-58T/hTERT (18) , immortalized by overexpression of hTERT (Table 2)Citation .

Absence of RASSF1A Methylation in HPV-immortalized Prostate Cell Lines.
Adaptation of prostate carcinoma cells for growth in culture always represents a significant challenge. To alleviate this problem, the primary tumor cells are often "immortalized" by transfection with SV40 virus or an HPV DNA. We tested the expression of the RASSF1A gene in four prostate carcinoma cell lines, adapted to grow in cell culture by transfection with the DNA, which expresses E6/E7-transforming proteins of HPV serotype 16 or 18 (11 , 16) . Unexpectedly, all four tested HPV-transformed cell lines (1512T, 1542T, 1550T, and RC53T/E6E7) expressed normal levels of RASSF1A mRNA (Table 2)Citation . Similar amounts of RASSF1A mRNA (from 0.001 to 0.005% of total RNA) were present in matching HPV-immortalized cell lines derived from the normal epithelial cells of the same patients (1512N, 1542N, and 1550N).

Normal expression of the RASSF1A transcript was also detected in a set of prostate epithelial cell lines immortalized by transfection with HPV-18 DNA and expressing the HPV-18 E7 gene product. This panel includes the original immortalized human prostate epithelial cell line HPV18 C-l, Ki-ras-transformed HPV18 C-l cells, which acquired the ability to grow in nude mice (16) , and a malignant subclone of HPV18 C-l (129NU5002-1) selected after multiple exposure to the chemical carcinogen N-nitroso-N-methylurea (17) . No RASSF1A mutations were found in the 129NU5002-1 derivative of the HPV18 C-l (Table 2)Citation .

Re-expression of RASSF1A Gene in LNCaP Cells Suppresses their Growth in Vitro.
LNCaP cells constitutively producing tTA tetracycline trans-activator (19) were transfected with the episomal pETE tetracycline-regulated vector, carrying a wild-type or mutated (Val211Ala) RASSF1A cDNA (7) . These episomal vectors provide more reproducible and uniform expression of transgenes. Hygromycin-resistant cells expressing high levels of RASSF1A mRNA from the plasmid (>0.005% of total RNA) were assessed for growth on plastic surfaces in the absence of doxycycline. The original LNCaP cells and the clone encoding the mutant RASSF1A protein had virtually identical growth curves. In contrast, growth of the cells expressing wild-type RASSF1A protein was suppressed >10-fold (Fig. 3)Citation .



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Growth inhibition of LNCaP cells by RASSF1A gene. 1, original LNCaP cells; 2, LNCaP transfected with mutant RASSF1A; 3, LNCaP cells transfected with wild-type RASSF1A.

 
When 5 µg/ml doxycycline were added to the growth medium, the level of RASSF1A mRNA decreased but remained detectable in all transgenic clones. Under these conditions, it was compatible to the amount of RASSF1A mRNA, which was found in normal prostate epithelial cells (0.001% of total RNA; Fig. 2Citation ). Therefore, for every clone maintained in the presence of doxycycline, we observed growth curves identical to those obtained in the media without doxycycline (data not shown).

Renal cell carcinoma line KRC/Y was less sensitive to low levels of RASSF1A mRNA re-expression. Similar 10-fold growth suppression was achieved in these cells only when RASSF1A expression exceeded 0.005% of total RNA (7) .


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We found aberrant hypermethylation of RASSF1A promoter in microdissected primary prostate carcinomas but not in matching normal prostate tissues. In 7 of 11 primary prostate tumors, the RASSF1A promoter was completely methylated. We estimate, in the remaining 4 tumors with partial RASSF1A methylation, contamination of the microdissected tissue with normal cells may reach as high as 20%. These cells may produce the PCR bands corresponding to unmethylated RASSF1A, making the percentage of methylated samples even higher.

As a consequence of frequent RASSF1A promoter methylation, the gene is often silenced in freshly explanted primary prostate tumors but not in normal prostate epithelial or stromal cells. Silencing and hypermethylation of the RASSF1A was also found in all five widely used permanent prostate carcinoma cell lines, which were adapted to cell culture spontaneously and in an hTERT-transformed line.

Unexpectedly, the gene was expressed in all studied HPV-immortalized lines. The extent of the prostate HPV infections and their role, if any, in prostate tumorigenesis remains highly controversial (21) . In one study, seropositivity against HPV-18 was associated with a 2.6-fold increase in the risk of developing prostate cancer. Our data point to a possible correlation between HPV infection and RASSF1A expression. This correlation could reflect a functional interaction between the cellular RASSF1A and the viral E6/E7 proteins, which may play important roles in both neoplastic transformation and immortalization of the prostate epithelial cells. In this case, the high rate of RASSF1A methylation in primary prostate cancer would imply that HPV is only involved in a limited number of the natural prostate tumors.

Evidence for causal association between HPV and a subset of head and neck cancers was recently reported (22) . Therefore, similar reverse correlation between HPV infections and RASSF1A methylation may exist for this type of cancer.

The HPV infections are recognized as a major contributor to the development of cervical neoplasia. HPV DNA was detected in 93% of the cervical tumors worldwide (23) . Interestingly, RASSF1Amethylation was not identified in primary cervical tumors. Currently, this tumor type remains the only reported one in which RASSF1A methylation has not been found (4) . However, HPV presence was not assessed in that particular study. Simultaneous assessment of RASSF1A inactivation and HPV presence in cervical carcinomas may reveal this putative correlation.

We assessed RASSF1A status in a panel of prostate cell lines of the same origin transformed either by the introduction of activated Ki-ras (16) or by a chemical carcinogen, N-nitroso-N-methylurea (129NU5002-1 cells; Ref. 17 ). Cells (129NU5002-1) acquired tumorigenic phenotype without the involvement of RAS proteins. In both tumorigenic cell lines, no RASSF1A dysregulation was found (Table 2)Citation .

In our final experiment, the RASSF1A expression construct was reintroduced into a prostate carcinoma cell line in which the endogenous RASSF1A gene was silenced. Re-expression of the wild-type, but not mutant, RASSF1A suppressed the growth of the prostate carcinoma cell line LNCaP in vitro. Prostate LNCaP cells were significantly more sensitive to low levels of RASSF1A expression compared with a KRC/Y renal carcinoma cell line (7) . A >10-fold growth suppression of LNCaP was observed after reintroduction of the RASSF1A transgene.

Our data implicate RASSF1A gene in human prostate tumorigenesis.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part with Federal funds from the National Cancer Institute, NIH, under Contract No. NO1-CO-12400. A. P. and E. Z. were supported by research grants from the Swedish Cancer Society, Pharmacia Corp., Karolinska Institute and Swedish Research Council. J. D. M. was supported by National Cancer Institute Grants CA71618 and SPORE P50 CA70907 and by the G. Harold and Leila Y. Mathers Charitable Foundation. Back

2 To whom requests for reprints should be addressed, at Intramural Research Support Program, Building 560, Room 12-34, SAIC-Frederick, Inc., National Cancer Institute Frederick, Frederick, MD 21702. Phone: (301) 846-7320; Fax: (301) 846-6145; E-mail: kuzmin{at}mail.ncifcrf.gov Back

3 The abbreviations used are: hTERT, human telomerase catalytic subunit; RT-PCR, reverse transcription-PCR; HPV, human papillomavirus; tTA, tetracycline-controlled transcriptional activator. Back

4 Johng S. Rhim, unpublished observations. Back

Received 2/15/02. Accepted 4/15/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Campbell S. L., Khosravi-Far R., Rossmann K. L., Clark G. J., Der C. J. Increasing complexity of Ras signaling. Oncogene, 17: 1395-1413, 1998.[Medline]
  2. Dammann R., Li C., Yoon J-H., Chin P. L., Bates S., Pfeifer G. P. Epigenetic inactivation of RAS association domain family protein from the lung tumor suppressor locus 3p21.3. Nat. Genet., 25: 315-319, 2000.[Medline]
  3. Lerman M. I., Minna J. D. The 630-kb lung cancer homozygous deletion region on human chromosome 3p21.3: identification and evaluation of the resident candidate tumor suppressor genes. The International Lung Cancer Chromosome 3p21.3 tumor suppressor gene consortium. Cancer Res., 60: 6116-6133, 2000.[Abstract/Free Full Text]
  4. Agathanggelou A., Honorio S., Macartney D. P., Martinez A., Dallol A., Rader J., Fullwood P., Chauhan A., Walker R., Shaw J. A., Hosoe S., Lerman M. I., Minna J. D., Maher E. R., Latif F. Methylation associated inactivation of RASSF1A from region 3p21.3 in lung, breast and ovarian tumors. Oncogene, 20: 1509-1518, 2001.[Medline]
  5. Burbee D. G., Forgacs E., Zochbauer-Muller S., Shivakumar L., Fong K., Gao B., Randle D., Kondo M., Virmani A., Bader S., Sekido Y., Latif F., Milchgrub S., Toyooka S., Gazdar A. F., Lerman M. I., Zabarovsky E., White M., Minna J. D. Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J. Natl. Cancer Inst. (Bethesda), 93: 691-699, 2001.[Abstract/Free Full Text]
  6. Lo K-W., Kwong J., Hui A. B-Y., Chan S. Y-Y., To K-F., Chan A. S-C., Chow L. S-N., Teo P. M. L., Johnson P. J., Huang D. P. High frequency of promoter hypermethylation of RASSF1A in nasopharyngeal carcinoma. Cancer Res., 61: 3877-3881, 2001.[Abstract/Free Full Text]
  7. Dreijerink K., Braga E., Kuzmin I., Geil L., Duh F-M., Angeloni D., Zbar B., Lerman M. I., Stanbridge E. J., Minna J. D., Protopopov A., Li J., Kashuba V., Klein G., Zabarovsky E. R. The candidate tumor suppressor gene, RASSF1A, from human chromosome 3p21.3 is involved in kidney tumorigenesis. Proc. Natl. Acad. Sci. USA, 98: 7504-7509, 2001.[Abstract/Free Full Text]
  8. Morrissey C., Martinez A., Zatyka M., Agathanggelou A., Honorio S., Astuti D., Morgan N. V., Moch H., Richards F. M., Kishida T., Yao M., Schraml P., Latif F., Maher E. R. Epigenetic inactivation of the RASSF1A 3p21.3 tumor suppressor gene in both clear cell and papillary renal cell carcinoma. Cancer Res., 61: 7277-7281, 2001.[Abstract/Free Full Text]
  9. Byun D-S., Lee M-G., Chae K-S., Ryu B-G., Chi S-G. Frequent epigenetic inactivation of RASSF1A by aberrant promoter hypermethylation in human gastric adenocarcinoma. Cancer Res., 61: 7034-7038, 2001.[Abstract/Free Full Text]
  10. Lee M. G., Kim H. Y., Byun D. S., Lee S. J., Lee C. H., Kim J. I., Chang S. G., Chi S. G. Frequent epigenetic inactivation of RASSF1A in human bladder carcinoma. Cancer Res., 61: 6688-6692, 2001.[Abstract/Free Full Text]
  11. Maruyama R., Toyooka S., Toyooka K. O., Harada K., Virmani A. K., Zöchbauer-Müller S., Farinas A. J., Vakar-Lopez F., Minna J. D., Sagalowsky A., Czerniak B., Gazdar A. F. Aberrant promoter methylation profile of bladder cancer and its relationship to clinicopathological features. Cancer Res., 61: 8659-8663, 2001.[Abstract/Free Full Text]
  12. Astuti D., Agathanggelou A., Honorio S., Dallol A., Martinsson T., Kogner P., Cummins C., Neumann H. P., Voutilainen R., Dahia P., Eng C., Maher E. R., Latif F. RASSF1A promoter region CpG island hypermethylation in pheochromocytomas and neuroblastoma tumors. Oncogene, 20: 7573-7577, 2001.[Medline]
  13. Vos M. D., Ellis C. A., Bell A., Birrer M. J., Clark G. J. Ras uses the novel tumor suppressor RASSF1 as an effector to mediate apoptosis. J. Biol. Chem., 275: 35669-35672, 2000.[Abstract/Free Full Text]
  14. Emmert-Buck M. R., Bonner R. F., Smith P. D., Chuaqui R. F., Zhuang Z., Goldstein S. R., Weiss R. A., Liotta L. A. Laser capture microdissection. Science (Wash. DC), 274: 998-1001, 1996.[Abstract/Free Full Text]
  15. Bright R. K., Vocke C. D., Emmert-Buck M. R., Durray P. H., Solomon D., Fetsch P., Rhim J. S., Linehan M. W., Topalian S. L. Generation and genetic characterization of immortal human prostate epithelial cell lines derived from primary cancer specimens. Cancer Res., 57: 995-1002, 1997.[Abstract/Free Full Text]
  16. Rhim J. S., Webber M. M., Bellow D., Lee M. S., Arnstein P., Chen L. S., Jay G. Stepwise immortalization and transformation of adult human prostate epithelial cells by a combination of HPV-18 and v-Ki-ras. Proc. Natl. Acad. Sci. USA, 91: 11874-11878, 1994.[Abstract/Free Full Text]
  17. Rhim J. S., Jin S., Jung M., Thraves P., Kuettel M. R., Webber M. M., Hukku B. Malignant transformation of human prostate epithelial cells by N-nitroso-N-methylurea. Cancer Res., 57: 576-580, 1997.[Abstract/Free Full Text]
  18. Yasunaga Y., Nakamura K., Ko D., Srivastava S., Moul J. W., Sesterhenn I. A., McLeod D. G., Rhim J. S. A novel human cancer culture model for the study of prostate cancer. Oncogene, 20: 8036-8041, 2001.[Medline]
  19. Protopopov A. I., Li J., Winberg G., Gizatullin R. Z., Kashuba V. I., Klein G., Zabarovsky E. R. Human cell lines engineered for tetracycline-regulated expression of tumor suppressor candidate genes from frequently affected chromosomal region, 3p21. J. Gene Med., 4: 1-10, 2002.
  20. Van Bokhoven A., Varella-Garcia M., Korch C., Hessels D., Miller G. J. Widely used prostate carcinoma cell lines share common origins. Prostate, 47: 36-51, 2001.[Medline]
  21. Griffiths T. R. L., Mellon J. K. Human papillomavirus and urological tumors: II. Role in bladder, prostate, renal and testicular cancer. BJU International, 85: 211-217, 2000.[Medline]
  22. Gillison M. L., Koch W. M., Capone R. B., Spafford M., Westra W. H., Wu L., Zahurak M. L., Daniel R. W., Viglione M., Symer D. E., Sheh K. V., Sidransky D. Evidence for causal association between human papillomavirus and a subset of head and neck cancers. J. Natl. Cancer Inst. (Bethesda), 92: 709-720, 2000.[Abstract/Free Full Text]
  23. Bosch F. X., Manos M. M., Muñoz N., Sherman M., Jansen A. M., Peto J., Schiffman M. H., Moreno V., Kurman R., Shah K. V. International Biological Study on Cervical Cancer (IBSCC) study group. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. J. Natl. Cancer Inst. (Bethesda), 87: 796-802, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
H. Donninger, M. D. Vos, and G. J. Clark
The RASSF1A tumor suppressor
J. Cell Sci., September 15, 2007; 120(18): 3163 - 3172.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Kwabi-Addo, W. Chung, L. Shen, M. Ittmann, T. Wheeler, J. Jelinek, and J.-P. J. Issa
Age-Related DNA Methylation Changes in Normal Human Prostate Tissues
Clin. Cancer Res., July 1, 2007; 13(13): 3796 - 3802.
[Abstract] [Full Text] [PDF]


Home page
Brief Funct Genomic ProteomicHome page
D. Angeloni
Molecular analysis of deletions in human chromosome 3p21 and the role of resident cancer genes in disease
Brief Funct Genomic Proteomic, May 24, 2007; (2007) elm007v1.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Roupret, V. Hupertan, D. R. Yates, J. W.F. Catto, I. Rehman, M. Meuth, S. Ricci, R. Lacave, G. Cancel-Tassin, A. de la Taille, et al.
Molecular Detection of Localized Prostate Cancer Using Quantitative Methylation-Specific PCR on Urinary Cells Obtained Following Prostate Massage
Clin. Cancer Res., March 15, 2007; 13(6): 1720 - 1725.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
J. Geli, N. Kiss, F. Lanner, T. Foukakis, N. Natalishvili, O. Larsson, P. Kogner, A. Hoog, G. J Clark, T. J Ekstrom, et al.
The Ras effectors NORE1A and RASSF1A are frequently inactivated in pheochromocytoma and abdominal paraganglioma
Endocr. Relat. Cancer, March 1, 2007; 14(1): 125 - 134.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. G. Amaar, M. G. Minera, L. K. Hatran, D. D. Strong, S. Mohan, and M. E. Reeves
Ras association domain family 1C protein stimulates human lung cancer cell proliferation
Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1185 - L1190.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A. S Perry, R. Foley, K. Woodson, and M. Lawler
The emerging roles of DNA methylation in the clinical management of prostate cancer.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 357 - 377.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Vos, A. Dallol, K. Eckfeld, N. P. C. Allen, H. Donninger, L. B. Hesson, D. Calvisi, F. Latif, and G. J. Clark
The RASSF1A Tumor Suppressor Activates Bax via MOAP-1
J. Biol. Chem., February 24, 2006; 281(8): 4557 - 4563.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. T. McCabe, J. A. Low, S. Daignault, M. J. Imperiale, K. J. Wojno, and M. L. Day
Inhibition of DNA Methyltransferase Activity Prevents Tumorigenesis in a Mouse Model of Prostate Cancer
Cancer Res., January 1, 2006; 66(1): 385 - 392.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Ni, X. Wen, J. Yao, H.-C. Chang, Y. Yin, M. Zhang, S. Xie, M. Chen, B. Simons, P. Chang, et al.
Tocopherol-Associated Protein Suppresses Prostate Cancer Cell Growth by Inhibition of the Phosphoinositide 3-Kinase Pathway
Cancer Res., November 1, 2005; 65(21): 9807 - 9816.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. O. Hoque, O. Topaloglu, S. Begum, R. Henrique, E. Rosenbaum, W. Van Criekinge, W. H. Westra, and D. Sidransky
Quantitative Methylation-Specific Polymerase Chain Reaction Gene Patterns in Urine Sediment Distinguish Prostate Cancer Patients From Control Subjects
J. Clin. Oncol., September 20, 2005; 23(27): 6569 - 6575.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Dote, D. Cerna, W. E. Burgan, D. J. Carter, M. A. Cerra, M. G. Hollingshead, K. Camphausen, and P. J. Tofilon
Enhancement of In vitro and In vivo Tumor Cell Radiosensitivity by the DNA Methylation Inhibitor Zebularine
Clin. Cancer Res., June 15, 2005; 11(12): 4571 - 4579.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Lodygin, A. Epanchintsev, A. Menssen, J. Diebold, and H. Hermeking
Functional Epigenomics Identifies Genes Frequently Silenced in Prostate Cancer
Cancer Res., May 15, 2005; 65(10): 4218 - 4227.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Agathanggelou, W. N. Cooper, and F. Latif
Role of the Ras-Association Domain Family 1 Tumor Suppressor Gene in Human Cancers
Cancer Res., May 1, 2005; 65(9): 3497 - 3508.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. S. Song, J. S. Chang, S. J. Song, T. H. Yang, H. Lee, and D.-S. Lim
The Centrosomal Protein RAS Association Domain Family Protein 1A (RASSF1A)-binding Protein 1 Regulates Mitotic Progression by Recruiting RASSF1A to Spindle Poles
J. Biol. Chem., February 4, 2005; 280(5): 3920 - 3927.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
L.-C. Li, P. R. Carroll, and R. Dahiya
Epigenetic Changes in Prostate Cancer: Implication for Diagnosis and Treatment
J Natl Cancer Inst, January 19, 2005; 97(2): 103 - 115.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Tommasi, R. Dammann, Z. Zhang, Y. Wang, L. Liu, W. M. Tsark, S. P. Wilczynski, J. Li, M. You, and G. P. Pfeifer
Tumor Susceptibility of Rassf1a Knockout Mice
Cancer Res., January 1, 2005; 65(1): 92 - 98.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Jeronimo, R. Henrique, M. O. Hoque, E. Mambo, F. R. Ribeiro, G. Varzim, J. Oliveira, M. R. Teixeira, C. Lopes, and D. Sidransky
A Quantitative Promoter Methylation Profile of Prostate Cancer
Clin. Cancer Res., December 15, 2004; 10(24): 8472 - 8478.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Dallol, A. Agathanggelou, S. L. Fenton, J. Ahmed-Choudhury, L. Hesson, M. D. Vos, G. J. Clark, J. Downward, E. R. Maher, and F. Latif
RASSF1A Interacts with Microtubule-Associated Proteins and Modulates Microtubule Dynamics
Cancer Res., June 15, 2004; 64(12): 4112 - 4116.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. D Vos, A. Martinez, C. Elam, A. Dallol, B. J Taylor, F. Latif, and G. J Clark
A Role for the RASSF1A Tumor Suppressor in the Regulation of Tubulin Polymerization and Genomic Stability
Cancer Res., June 15, 2004; 64(12): 4244 - 4250.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. H. N. Wong, J. Chan, J. Wong, and P. K. H. Tam
Ubiquitous Aberrant RASSF1A Promoter Methylation in Childhood Neoplasia1
Clin. Cancer Res., February 1, 2004; 10(3): 994 - 1002.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. L. Fenton, A. Dallol, A. Agathanggelou, L. Hesson, J. Ahmed-Choudhury, S. Baksh, C. Sardet, R. Dammann, J. D. Minna, J. Downward, et al.
Identification of the E1A-Regulated Transcription Factor p120E4F as an Interacting Partner of the RASSF1A Candidate Tumor Suppressor Gene
Cancer Res., January 1, 2004; 64(1): 102 - 107.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D.-H. Kim, J. S. Kim, J.-H. Park, S. K. Lee, Y.-I. Ji, Y. M. Kwon, Y. M. Shim, J. Han, and J. Park
Relationship of Ras Association Domain Family 1 Methylation and K-Ras Mutation in Primary Non-Small Cell Lung Cancer
Cancer Res., October 1, 2003; 63(19): 6206 - 6211.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Agathanggelou, I. Bieche, J. Ahmed-Choudhury, B. Nicke, R. Dammann, S. Baksh, B. Gao, J. D. Minna, J. Downward, E. R. Maher, et al.
Identification of Novel Gene Expression Targets for the Ras Association Domain Family 1 (RASSF1A) Tumor Suppressor Gene in Non-Small Cell Lung Cancer and Neuroblastoma
Cancer Res., September 1, 2003; 63(17): 5344 - 5351.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
W.A. Schulz, M. Burchardt, and M.V. Cronauer
Molecular biology of prostate cancer
Mol. Hum. Reprod., August 1, 2003; 9(8): 437 - 448.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Cohen, G. Singer, O. Lavie, S. M. Dong, U. Beller, and D. Sidransky
The RASSF1A Tumor Suppressor Gene Is Commonly Inactivated in Adenocarcinoma of the Uterine Cervix
Clin. Cancer Res., August 1, 2003; 9(8): 2981 - 2984.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Kuzmin, L. Liu, R. Dammann, L. Geil, E. J. Stanbridge, S. P. Wilczynski, M. I. Lerman, and G. P. Pfeifer
Inactivation of RAS Association Domain Family 1A Gene in Cervical Carcinomas and the Role of Human Papillomavirus Infection
Cancer Res., April 15, 2003; 63(8): 1888 - 1893.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Spugnardi, S. Tommasi, R. Dammann, G. P. Pfeifer, and D. S. B. Hoon
Epigenetic Inactivation of RAS Association Domain Family Protein 1 (RASSF1A) in Malignant Cutaneous Melanoma
Cancer Res., April 1, 2003; 63(7): 1639 - 1643.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuzmin, I.
Right arrow Articles by Lerman, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuzmin, I.
Right arrow Articles by Lerman, M. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online