
[Cancer Research 62, 3521-3529, June 15, 2002]
© 2002 American Association for Cancer Research
Frequencies of Tetramer+ T Cells Specific for the Wild-Type Sequence p53264272 Peptide in the Circulation of Patients with Head and Neck Cancer1
Thomas K. Hoffmann,
Albert D. Donnenberg,
Sydney D. Finkelstein,
Vera S. Donnenberg,
Ulrike Friebe-Hoffmann,
Eugene N. Myers,
Ettore Appella,
Albert B. DeLeo and
Theresa L. Whiteside2
University of Pittsburgh Cancer Institute [T. K. H., A. D. D., V. S. D., A. B. D., T. L. W.], Department of Medicine [A. D. D., V. S. D.], Department of Immunology and Infectious Disease, Graduate School of Public Health [A. D. D.], Magee Research Institute [U. F-H.], Department of Pathology [S. D. F., A. B. D., T. L. W.], and Department of Otolaryngology [E. N. M., T. L. W.], University of Pittsburgh, Pittsburgh, Pennsylvania 15213, and National Cancer Institute, Bethesda, Maryland 20892 [E. A.]
 |
ABSTRACT
|
|---|
Immunization with wild-type sequence (wt) p53 epitopes represents a novel therapeutic strategyfor cancer patients with tumors accumulating mutant p53. To evaluate usefulness of p53-derived peptides as future cancer vaccines, frequencies of wt p53264272 peptide-specific CD8+ T cells were determined in the peripheral circulation of patients with squamous cell carcinoma of the head and neck (SCCHN). T cells of 30 HLA-A2.1+ patients and 31 HLA-A2.1+ healthy individuals were evaluated by multicolor flow cytometry analysis using peptide-HLA-A2.1 complexes (tetramers). T cells specific for an influenza matrix peptide (a model recall antigen) or an HIV reverse transcriptase peptide (a model novel antigen) were studied in parallel. Patients with SCCHN had a significantly higher mean frequency of CD8+ T cells specific for wt p53264272 than normal donors (P = 0.0041). Surprisingly, the frequency of epitope-specific T cells in the circulation of patients did not correlate with p53 accumulation in the tumor. In patients whose tumors had normal p53 expression or had p53 gene mutations preventing presentation of this epitope, high frequencies of wt p53264272-specific CD8+ T cells were found, of which many were memory T cells. In contrast, patients whose tumors accumulated p53 had low frequencies of wt p53264272-specific CD8+ T cells, which predominantly had a naive phenotype and were unable to proliferate ex vivo in response to the epitope, as reported by us previously (T. K. Hoffmann, J. Immunol., 165: 59385944, 2000). This seemingly contradictory relationship between the high frequency of epitope-specific T cells and wt p53 expression in the tumor suggests that other factors may contribute to the observed anti-p53 responses. Human papillomavirus-16 E6/E7 expression is common in SCCHN, and E6 is known to promote presentation of wt p53 epitopes. Although human papillomavirus-16 E6/E7 expression was detected in 46% of the tumors, it did not correlate with the frequency of wt p53264272-specific CD8+ T cells or with p53 expression in the tumor. These findings emphasize the complexity of interactions between the tumor and the host immune system, and, thus, have particularly important implications for future p53-based immunization strategies.
 |
INTRODUCTION
|
|---|
The gene encoding p53 protein is frequently mutated in many human cancers, including SCCHN,3
which generally results in accumulation (overexpression) of p53 molecules in these tumors (1, 2, 3, 4)
. As most of these mutations involve an alteration of a single amino acid in p53 molecules, the majority of the accumulating mutant protein resembles the wt p53 (4)
. Therefore, enhanced presentation of wt epitopes derived from p53 accumulating in tumors is possible, and might lead to their recognition by the immune system and the development of antitumor CTLs (5, 6, 7, 8, 9)
. For this reason, wt p53 epitopes are considered attractive targets for immunotherapy of cancer.
We reported previously on the generation of CTLs recognizing the HLA-A2.1-restricted wt p53264272 epitope from PBMCs obtained from SCCHN patients using autologous peptide-pulsed dendritic cells as antigen-presenting cells (9)
. Surprisingly, we observed that CTLs reactive against this wt p53 epitope could only be generated from T-cell precursors in PBMCs of patients whose tumors either did not accumulate p53 or accumulated mutant p53 molecules that could not present this epitope (9)
. We hypothesized that in vivo, the presence of expandable CTL precursors specific for the wt p53264272 epitope led to immunoselection, resulting in the elimination of tumors expressing the epitope and favored the outgrowth of "epitope-loss" tumor cells able to evade the host immune system. On the other hand, it was also possible that HPV infection, known to occur in a substantial proportion of SCCHN, could lead to inactivation of wt p53 and enhanced processing of p53 epitopes (10)
. The consequence of either phenomenon would be the presence in patients with wt p53 tumors of relatively high frequencies of T cells specific for the wt p53264272 epitope. To test these hypotheses, we investigated the frequency of p53264272-specific precursor T cells in the peripheral circulation of 30 HLA-A2.1+ patients with SCCHN and 31 HLA-A2.1+ healthy controls, using multimeric peptide-MHC complexes. We also performed PCR analyses of genomic DNA isolated from the patient tumors for p53 and HPV E6/E7.
The availability of multimeric peptide-MHC complexes, which are generically referred to as tetramers, allows for direct identification and phenotyping of antigen-specific T cells in the peripheral circulation. Tetramers bind to more than one TCR on a specific T cell and, therefore, have a relatively slow dissociation rate (11
, 12)
. However, the specificity of tetramer binding to the TCR has to be carefully controlled, particularly when the frequency of peptide-specific precursor T cells in the peripheral circulation is expected to be very low. Anticipating that discrimination between nonspecific and specific tetramer binding to p53264272-specific T cells might be difficult, we used a novel four-color flow cytometry assay that simultaneously measures tetramer, CD3, CD8, and CD14 binding (13)
. Furthermore, binding of the p53 tetramer was compared with that of the influenza virus matrix peptide GILGFVFTL (FLU, a model for recall responses) and the HIV reverse transcriptase peptide ILKEPVHGV (HIV, a model for responses to a new antigen).
In this study, the frequency of wt p53264272 peptide-specific CD8+ T cells in the circulation of patients with SCCHN was correlated with the p53 expression in each patient tumor, its HPV status, and the presence of p53 antibodies in the serum. Our results provide significant insights into the in vivo interactions that might occur between the developing tumor and immune system in these patients.
 |
MATERIALS AND METHODS
|
|---|
PBMCs.
Peripheral blood samples or leukapheresis products were obtained from 30 HLA-A2.1+ SCCHN patients, 31 HLA-A2.1+ healthy donors, and 10 HLA-A2.1- healthy donors. PBMCs were isolated by centrifugation over Ficoll-Hypaque gradients (Amersham Pharmacia Biotech, Piscataway, NJ). Leukapheresis products were obtained from the Institute of Transfusion Medicine, Pittsburgh, PA. The study was approved by the Institutional Review Board at the University of Pittsburgh, and written informed consent was obtained from each participating individual. All of the products were tested and found to be negative for HIV-I antigens and antibodies to HIV. PBMCs were phenotyped for expression of HLA-A2 molecules by flow cytometry using the anti-HLA-A2 mAb BB7.2 (American Type Culture Collection, Manassas, VA) and an IgG isotype as a control. The verification of the A2.1 subtype was performed using polymerase chain reaction with sequence-specific primers as described previously (9
, 14) . PBMCs were either used fresh or were frozen at a concentration of 50 x 106 cells/ml in the freezing medium consisting of human AB serum (Pel-Freeze, Brown Deer, WI) plus 10% DMSO (Fisher Scientific, Pittsburgh, PA).
In 30 patients, histologically verified squamous cell carcinomas originated in one of the following sites: the nose (n = 1), oral cavity (n = 7), oropharynx (n = 4), larynx (n = 16), and hypopharynx (n = 2). Tumors were classified for tumor stage (T1 = 10; T2 = 9; T3 = 3; T4 = 8; and Tx = 1), nodal stage (N0 = 22; N1 = 2; N2 = 5; and N3 = 1), and the presence of distant metastases (n = 0 of 30).
Tetrameric Peptide-MHC Class I Complex (Tetramer) Assay.
Tetramers were obtained through the National Institute of Allergy and Infectious Diseases Tetramer Facility and the NIH AIDS Research and Reference Reagent Program. Stock solutions contained 0.5 µg monomer/ml. Peptides provided to the National Institute of Allergy and Infectious Diseases Tetramer Facility were either GILGFVFTL, an influenza matrix immunodominant peptide (residues 5866), the HIV-1 reverse transcriptase peptide (pol 476484) ILKEPVHGV, or the HLA-A2.1-binding peptide LLGRNSFEV (15
, 16)
, corresponding to wt p53264272 peptide. The specificity of the LLGRNSFEV tetramer was confirmed by staining against the anti-p53-specific CTL line as described previously (9)
and by the lack of staining with irrelevant CTLs, as well as HLA-A2-negative PBMCs of healthy donors.
To minimize background staining each tetramer was titered and used at the lowest concentration that still gave a clearly discernible positive population in a donor vaccinated for influenza (for FLU5866 tetramer) as well as in an HIV-infected individual (for pol476484). The final dilution of both preparations during staining, relative to the stock reagent supplied by the NIH, was 1/300. Within a 2-fold range of tetramer concentrations bracketing the concentrations used here, the frequency of tetramer-positive events and competition of CD3 binding (13)
were stable, and tetramer fluorescence intensity was within 80% of that obtained at saturating concentrations. At saturating concentrations, CD3 competition decreased, fluorescence intensity of tetramer positive cells increased, and tetramer frequency increased, the latter attributable chiefly to a greater number of tetramer-dim events.
Antibodies.
The default panel of antibodies used for these studies was CD14-FITC (RMO52; Immunotech, Miami, FL), Tetramer-PE, CD3 ECD (HIT3a; Beckman Coulter, Miami, FL), and CD8-PC5 [SFCI21Thy2D3(T8); Beckman Coulter]. Additionally, antihuman CD45RA FITC (Immunotech) and anti-CD45RO ECD (Beckman Coulter) were used for the characterization of the CD45 phenotype.
Flow Cytometry Analysis.
Immediately before staining, cells were washed twice with the staining medium, consisting of PBS +0.1% (w/v) BSA +0.1% (w/v) sodium-azide, and resuspended at a concentration of 5 x 106/ml in a volume of 150 µl. Tetramer (5 µl of 1:10 dilution of stock solution) was added at room temperature for 30 min, followed by a 30 min incubation with antibodies (7.5 µL of each) at 4°C. After two additional washes, the cells were resuspended in
1 ml of 0.5% methanol-free formaldehyde in PBS. At least 1 x 106 events were collected using a four-color Coulter Epics XL cytometer set on low or medium flow rate at a maximum of 1000 events/sec. Flow cytometry data were analyzed in real time using Beckman-Coulter System II software. In initial experiments, the region defining tetramer-positive events was determined by evaluating PBMCs stained with the Ab panel but without tetramer. This region was held constant throughout the analysis. Data were saved as FCS 2.0 Listmode files for subsequent reanalysis in System II or WinList (Verity Software House, Topsham, ME).
Confocal Microscopy.
A wt p53264272-specific CTL line (9)
was used as a positive control for the flow cytometric evaluation and additionally to visualize tetramer binding to the specific T cells by confocal microscopy. The CTL line was incubated with the p53264272 peptide containing tetramer in azide-free PBS followed by incubation with FITC-conjugated anti-CD8 Ab. The cells were then fixed with 1% (w/v) paraformaldehyde, placed on a slide, and analyzed by confocal laser scanning microscopy at x600 original magnification (Leica TCS NT confocal LSM; Leica Lasertechnik, Heidelberg, Germany). Images were edited using the Adobe PhotoShop software program (Adobe Systems, Mountain View, CA).
p53 Mutation Analysis, Immunohistochemistry, and Detection of p53 Antibodies.
Tumors of 30 SCCHN patients included in this study were available as paraffin blocks archived at the University of Pittsburgh Medical Center. The histology of each case was reviewed by a pathologist (S. D. F.), and representative tissue sections containing areas of invasive SCCHN were selected for microdissection. Normal-appearing salivary gland tissue or skeletal muscle was microdissected separately to serve as an internal nontumor control. Using 4-µm thick recut, unstained histological sections, normal and malignant tissue samples were removed under stereomicroscopic observation. Sufficient material was collected from a single histological section to afford replicate analysis. Samples were treated with proteinase K at a final concentration of 100 µg/ml for 2 h and then boiled for 5 min to remove protease activity. PCR used sets of amplification primers flanking exons 58 of the p53 gene in four separate PCRs (17)
. Amplified DNA from microdissected tissues also included splice sites. PCR products were electrophoresed in 4% agarose, and the ethidium bromide-stained bands were excised and then isolated with glassmilk. DNA sequencing used antisense PCR primers for each exon with [33P]dATP as the reporter molecule, and sequence analysis was read from overnight exposed autoradiograms of 6% polyacrylamide gels.
For p53 immunohistochemistry, formalin-fixed, paraffin-embedded tumor tissues were sectioned (35 µm), air-dried overnight at 37°C, deparaffinized, and dehydrated and stained with a mAb against p53, D07 (Dako, Carpinteria, CA), which recognizes an epitope in the NH2 terminus between amino acids 3545, and reacts with wild-type and most mutant forms of the p53 protein. The avidin-biotin-peroxidase method was used to visualize the p53, according to the instructions supplied by the manufacturer (Dako). The immunostained slides were evaluated by light microscopy for p53 accumulation. The tumor was considered p53-positive when >25% of the tumor cells showed staining intensity of 2+ and higher on the scale of 04+. IgG isotype mAb used at the same concentration as the primary mAb served as a negative control.
Ab to p53 in the patient and control sera were detected by an Enzyme ELISA purchased from PharmaCell Immunotech Coulter, Miami, FL, using microtiter plates coated with recombinant human wt p53 protein. Peroxidase-conjugated goat antihuman IgG was used for detection of human anti-p53 Ab by a colorimetric reaction. Staining intensity was compared with a standard curve, and anti-p53 levels
1.1 units/ml were considered to be positive. Assays were performed twice in triplicates and included sera obtained from seropositive as well as seronegative individuals as internal positive/negative controls.
PCR Analysis for HPV-16.
PCR analysis was performed using amplification primers for HPV-16 E6/E7 (ATGCACCAAAAGAGAACTGC and TGCCCATTAACAGGTCTTCC) and ß-actin (GCGAGAAGATGACCCAG and GCCTGGATAGCAACGTA) as control, using tumor DNA isolated as described above. DNA aliquots obtained from 25 of 30 specimens were screened in four separate PCR reactions. A solution (50 µl) consisting of 25 mM MgCl2, 1.5 µM of each primer, 1.25U of Taq DNA-polymerase (Promega), 2 mM of deoxynucleotide triphosphate, and double-distilled H2O was added to each amplification tube. Amplification was performed with denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 2 min. The process was repeated for the total of 40 cycles. In all of the PCR reactions, DNA obtained from HPV-16 E6/E7+ Caski and C33 cell lines were included as positive controls. PCR products (700-bp for HPV-16 E6/E7 and 500-bp for ß-actin) were electrophoresed in 4% agarose and the bands visualized in the presence of ethidium bromide. Twelve of 25 tumors tested were positive for HPV-16 E6/E7.
Statistical Analysis.
Tetramer-positive cells were quantified by flow cytometry and expressed as frequencies (e.g., 1/1000) or reciprocal frequencies (e.g., 1000). We examined raw reciprocal frequency data and log-transformed reciprocal frequency data using normal probability plots (13)
. For all three tetramers, the log-transformed data were better modeled by the normal distribution. Accordingly, descriptive statistics (means, SDs, and confidence intervals) and statistical analyses (Students t test, two-tailed), were performed on log-transformed reciprocal frequencies. For the comparison of multiple parameters, ANOVA (Tukey-Kramer multiple comparison test) was applied. The specificity of tetramer binding to the TCR was measured by competition of CD3 binding (13)
. Competition of CD3 binding was expressed according to the formula:
where CD3Mnl is the log MFI of CD3 staining of the population designated by the subscript. For tetramer frequencies as well as competition of Ab binding, lower limits of detection were established by estimating the 99th percentile (geometric mean plus 2.6 SDs) of responses measured in PBMCs from HLA-A2- subjects. Linear regression was performed by the method of least squares. In regression plots the line of best fit and the 95% confidence intervals about the line of best fit are shown. The coefficient of correlation (r2), the slope of the regression line, and the P associated with the slope are reported as regression summary statistics. Multivariate analysis was performed to determine the relationship between the frequency of p53-specific CTL, accumulation of p53 in the tumor, and the HPV status of the tumor. Statistical analysis and statistical graphics were performed using Systat Version 9 (SPSS Inc, Chicago, IL).
 |
RESULTS
|
|---|
Binding of the Tetramer to wt p53264272-specific T Cells.
A wt p53264272-specific CTL line established earlier (9)
was stained with the FITC-conjugated anti-CD8 (green) and PE-conjugated tetramer (red). Its confocal microscopy mid-plane image is shown in Fig. 1
. On binding to the TCR, tetrameric p53264272-MHC class I complexes were internalized in the absence of sodium azide. This p53264272-specific T-cell line served as positive control in subsequent flow cytometry analyses of precursor T cells in the peripheral circulation of human subjects.

View larger version (133K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Confocal microscopy demonstrating internalization of the tetrameric p53264272-MHC-class I complexes by Ag-specific CD8 T cells. A T-cell bulk line specific for the HLA-A2.1- restricted p53 epitope LLGRNSFEV was stained with PE-labeled tetrameric p53264272-MHC-class I complexes at room temperature for 30 min, washed, and incubated with anti-CD8 (FITC) for 30 min on ice. After fixation, the cells were examined in a confocal microscope (midplane image).
|
|
Gating Strategy for Tetramer Analysis.
For the detection of unstimulated precursor T cells specific for the wt p53264272 peptide, PBMCs of SCCHN patients and healthy donors were directly stained with the tetramer and analyzed by flow cytometry. To assure the specificity of tetramer binding, we developed previously a gating strategy to eliminate CD14+ monocytes as well as apoptotic and necrotic cells, all of which could bind tetramer and/or Ab nonspecifically (13)
. Furthermore, CD3-negative cells were eliminated by compound gating, which finally resulted in discriminative dot plots showing CD8+ tetramer+ T cells. Fig. 2
shows the representative dot plots of stained PBMCs obtained from a healthy individual and from 2 patients with SCCHN. The cases shown are representative of relatively low (Fig. 2
, left; 1 of 5757), intermediate (Fig. 2
, middle; 1 of 3063) and high (Fig. 2
, right; 1 of 1140) p53264272 tetramer binding frequencies, respectively.

View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Dot plots showing the frequency of wt p53264272-specific CD8+ T cells in a normal control (left) and two SCCHN patients (middle and right). Compound gating strategy was used to identify tetramer+ CD8+ T cells. PBMC from an HLA-A2.1+ individuals were stained with p53264272 tetramer followed by anti-CD14, anti-CD3, and anti-CD8 mAbs, using four-color flow cytometry. Tetramer-positive cells were evaluated within a Boolean gate, excluding CD14+ events and including cells within an extended lymphoid light scatter gate and a generous CD3+ gate. In the example shown, CD3+ CD8+ tetramer+ events were present at a frequency of 1/5757 CD3+ CD8+ T cells for the healthy individual, and 1/3063 and 1/1140 for 2 patients with SCCHN.
|
|
Definition of the Lower Limit of Detection of Tetramer-positive T Cells.
To establish the lower detection limit for tetramer binding in HLA-A2.1+ individuals, we stained PBMCs obtained from 10 HLA-A2- individuals. Despite the application of the gating strategy described above, low levels of p53264272 tetramer+ CD3+ CD8+ T cells were detected in PBMCs of HLA-A2- donors (geometric mean = 1/23,397). Because these events were nonspecific by definition, we established a cutoff for the lower detection limit of this assay at the upper 99th percentile of tetramer+ CD8+ T cells in HLA-A2- individuals. This cutoff frequency of 1 of 7,805 was applied to all of the data obtained from testing of the 10 HLA-A2- subjects, 30 HLA-A2.1+ SCCHN patients, and 31 HLA-A2.1+ healthy controls. As shown in Fig. 3
, none of the HLA-A2- individuals had frequencies of p53264272 tetramer+ CD8+ T cells exceeding the established cutoff. On the other hand, 23 of 30 HLA-A2.1+ SCCHN patients and 25 of 31 healthy controls had frequencies of p53264272 tetramer+ CD8+ T cells above the cutoff point (geometric means = 1/3,533 and 1/5,207, respectively).

View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Reciprocal frequencies of p53264272 tetramer+ CD8+ CD3+ T cells. show individual data points. Superimposed notched box plots display nonparametric descriptive statistics. The waist indicates the group median, the hinges (upper and lower boundaries of the box) indicate interquartile distances. The notches show simultaneous 95% confidence intervals about the median. The whiskers (bars) give the ranges, exclusive of outliers. Outliers (>1.5 times the hingespread from the median) are shown by * and far outliers (more than three times the hingespread from the median) are shown by double circles. Reciprocal frequencies of p53264272 tetramer+ CD8+ T cells in 10 HLA-A2.1- and 30 HLA-A2.1+ healthy donors, 30 HLA-A2.1+ patients with SCCHN, and the HLA-A2.1+ p53264272-specific T cell line. The dashed line represents the cutoff for the lower detection limit as determined in HLA-A2.1- donors (geometric mean +2.6); bars, ± SD.
|
|
Confirmation of the Specificity of Tetramer Binding to TCR.
We have reported previously that tetramer-positive T cells stained dimmer for CD3 than did tetramer-negative T cells in PBMCs obtained from HLA-A2.1+ subjects. However, this is not the case for the spurious tetramer-positive events seen in PBMCs obtained from HLA-A2- subjects (13)
. We demonstrated that this phenomenon results from a competition between tetramer and anti-CD3 Abs binding to TCR. This competition was subsequently quantified and introduced as a marker for the specificity of tetramer binding to the TCR complex (13)
. Because there was no detectable competition between tetramer and anti-CD3 Ab binding for CD8+ T cells in 9 of 10 HLA-A2.1- individuals, we were able to define a cutoff based on the 99th percentile of CD3 competition in these HLA-A2- subjects (3.2%). Competition by anti-CD3 Ab in excess of this cutoff was considered to be significant. The mean of competition for the wt p53264272 tetramer was 10.0 ± 1.4% (mean ± SE) in T cells obtained from patients and 5.3 ± 1.5% in normal controls. PBMCs of 23 of 30 SCCHN patients but only 10 of 31 normal controls exceeded both the cutoff for competition as well as the cutoff for frequency (see above), and, thus, were considered to exhibit specific binding of the p53264272 tetramer (Fig. 4)
.

View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Competition of anti-CD3 Ab binding by the p53264272 tetramer on CD8+ CD3+ T cells. Notched box plots show individual data points and nonparametric statistics, as described in Fig. 3
. Competition in percentage is shown for p53264272 tetramer+ CD8+ T cells obtained from 10 HLA-A2.1- and 30 HLA-A2.1+ healthy donors, 30 HLA-A2.1+ patients with SCCHN, and the HLA-A2.1+ p53264272-specific T cell line. The dashed line represents the cutoff for the lower limit of competition as determined in HLA-A2.1- normal controls; bars, ± SD.
|
|
Comparison of Frequencies of wt p53264272-specific versus HIV- or FLU-specific T Cells.
Next, frequencies of wt p53264272-specific CD8+ T cells were compared with those obtained with the HIV tetramer or the FLU tetramer. These comparisons were performed to evaluate p53-specific responses in the context of those to known novel and recall antigenic peptides. The frequencies of FLU- and HIV-specific T cells are displayed in Fig. 5
as normal distribution curves. The frequencies of wt p53264272-specific T cells are shown as individual circles. For healthy individuals (Fig. 5
, left), the majority of p53 frequencies fall within the HIV normal distribution curve. In contrast to PBMCs from the healthy control group, PBMCs from SCCHN patients seem to have a bimodal distribution, with a majority of the frequencies located within the normal HIV distribution curve, and six frequencies shifted to the right (Fig. 5
, note the log scale) toward FLU frequencies.

View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Reciprocal frequency of p53264272 tetramer+ CD8+ CD3+ T cells in the peripheral circulation of patients with SCCHN. show individual data points. Superimposed normal distribution curves were calculated from sample means, and SDs of HIV and FLU tetramer data obtained in the normal control group. The dashed line represents the cutoff for the lower detection limit of tetramer frequency.
|
|
Frequencies of wt p53264272-specific T Cells in Patients and Controls.
On more careful examination, when the frequencies of wt p53264272 peptide-specific CD8+ T cells in the circulation of patients (see Table 1
) were compared with those obtained in normal controls, it appeared that the patients could be divided into two different groups. The first subset consists of patients with wt p53 tumors that do not accumulate p53 or those with tumors unlikely to present the wt p53264272 epitope because of the type of mutation they harbor. These patients have significantly higher frequencies (P
0.0005) of wt p53264272-specific CD8+ T cells in the peripheral circulation than the patients in the second subset, whose tumors accumulate p53 and, in theory, could have a higher potential for presentation of this epitope (Fig. 6)
. The SCCHN patients in the second subset, those with tumors accumulating p53, have lower frequencies of CD8+ T cells specific for this p53 epitope, which do not significantly differ from those obtained for normal controls (Fig. 6)
. Confirming our initial observations, this result suggests that accumulation of p53 in the tumor does not positively correlate with the frequency of the epitope-specific CD8+ T cells detectable in the circulation of patients with SCCHN.
View this table:
[in this window]
[in a new window]
|
Table 1 Summary of wt p53264272-specific T-cell frequencies in patients with SCCHN and the p53 status in their tumors, as well as the presence of p53 autoantibodiesa
|
|

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. Reciprocal frequency of p53264272-specific CD8+ T cells in patients with SCCHN and normal controls. The mean frequencies for normal controls and for patients with SCCHN with tumors found to accumulate p53 or not to accumulate p53 (see Table 1
) were determined. Paired tumors and PBMC samples of 30 HLA-A2.1+ patients with SCCHN were evaluated. Tumors showed either normal p53 protein expression, accumulated p53 protein, or had a mutation within or next to the p53264272 epitope, most likely preventing presentation of the epitope (18)
. Such tumors were considered to have normal p53 expression; bars, ± SD.
|
|
Analysis of wt p53264272-specific Memory versus Naive T Cells.
Expression of CD45 isoforms on the surface of T cells is routinely used to discriminate between naive (CD45RA+) and memory (CD45RO+) T-cell subsets (18)
. To determine whether tetramer+ CD8+ T cells detected in the circulation of patients with SCCHN belong to the memory or naive T-cell subsets, multicolor flow analysis including anti-CD45 Abs was performed. The gates for CD45RO and CD45RA expression were set on CD8+ tetramer- T cells, as shown in the left panel of Fig. 7
. We have shown previously that the majority of CD8+ tetramer+ cells for the recall antigen, FLU, were CD45RO+/CD45RA- memory T cells, whereas those recognizing the novel HIV antigen were predominantly CD45RO-/CD45RA+ naive T cells (13)
. This analysis was performed on samples obtained from two groups of representative patients: one with relatively high frequencies (average
1/2700), the other with low frequencies (average
1/5500) of wt p53264272-specific CD8+ T cells as well as from normal donors (see Table 2
). Normal donors (Fig. 7
, middle panel) and patients with low frequencies of p53264272 tetramer+ T cells had similar percentages of memory (
10%) and naive (
70%) T cells in the peripheral circulation. In contrast, a significantly higher percentage of memory cells (36.5%) was found in patients with high frequencies of wt p53264272-specific T cells (Fig. 7
, right panel).

View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 7. Representative data (patient #1 in Table 1
) for CD45 isoform expression on p53264272-specific CD8+ T cells. Cells were stained with the tetramer followed by CD45RO-FITC, CD8-ECD, and CD45RA-PC5. Monocytes and high side scatter natural killer cells were eliminated from the analysis by using a tight lymphocyte light scatter gate. In normal controls as well as patients with low frequencies of p53264272-specific T cells (not shown), these cells were predominantly CD45RO-/CD45RA+. In SCCHN patients with high frequencies of p53264272-specific T cells (right panel), a significant number of CD8+ tetramer+ cells were CD45RO+/CD45RA-.
|
|
View this table:
[in this window]
[in a new window]
|
Table 2 Frequencies of wt p53264272-specific memory and naive T cells in healthy controls and patients with SCCHN
|
|
Immunohistochemistry and Genomic PCR Analysis of p53 in Patient Tumors.
Immunohistochemistry of p53 protein and sequencing of genomic PCR products of p53 exons 58 in patient tumors were done to evaluate the potential of these tumors to present the wt p53264272 epitope, and ultimately relate this information to the frequencies of tetramer+ CD8+ T cells detected in the peripheral circulation of these patients (Table 1)
. Although exceptions have been noted in the literature, most tumor cells lines sensitive to CTL recognizing this epitope have been shown to accumulate p53. Of the 30 primary tumors analyzed, more then half (17 of 30) showed accumulation of p53. The primary tumor of one patient, #28, scored negative, but a lymph node metastasis was positive. From this total of 31 tumors (18 of 31 with p53 accumulation), 28 underwent sequencing of genomic PCR products of exons 58 (3 cases were not available). Of the 16 available tumors (2 of 18 not available) showing p53 accumulation, 13 were found to express missense mutations within p53 exons 58. In two tumors (patients #7 and #10), p53 missense mutations were located within or directly next to the wt p53264272 peptide sequence. Such a mutation (R273H) was shown previously to prevent presentation of the epitope (19)
. For subsequent analysis, these tumors were considered as unlikely to be presenting the wt p53264272 epitope, and they are designated by brackets for p53 accumulation in Table 1
.
A lack of agreement between the mutated p53 exon 58 genotype and p53 accumulation was reported for patients with SCCHN (20)
. In general, the results of our study indicated a good correlation between p53 missense mutations and accumulation of the altered protein in tumors (Table 1)
. In 3 cases (patients #19, #20, and #27) a discrepancy between the p53 genotype and p53 expression was observed (Table 1)
. All three represented tumors with a wt p53 genotype and with p53 accumulation, which could possibly be because of a mutation outside the exons 58 or in genes impacting on the stability of p53, such as mdm2 (21)
.
Association between p53 in Tumors and Frequency of wt p53264272-specific T Cells.
Stratification of the frequencies of wt p53264272-specific T cells detected in the circulation of patients with SCCHN identified three groups of patients, those displaying high, intermediate, or low frequencies of these cells (Table 1)
. The cutoff for the high frequency designation was based on the upper 95th percentile (>1/2128) frequency of tetramer+CD8+ T cells established in HLA-A2+ healthy controls. The tumors obtained from the 6 patients with the highest frequencies of these T cells were wt p53 and did not accumulate p53 (Table 1
; Fig. 8
).

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 8. The summary of associations between the frequency of p53264272-specific CD8+ T cells in patients with SCCHN and p53 accumulation in the patient tumors. Paired PBMCs and primary tumors from 30 HLA-A2.1+ patients with SCCHN were evaluated. The bottom dashed line represents the cutoff for the lower detection limit of tetramer frequency, the intermediate line shows the geometric mean of the patient group as a whole, and the top dashed line indicates the upper 95th percentile (>1/2128) of tetramer+CD8+ T cells in 30 HLA-A2.1+ normal controls. According to the T-cell frequency and p53 tumor status, 3 groups of patients were identified. The evaluated tumors either showed normal p53 protein expression, had mutations within or next to the p53264272 epitope, shown previously to prevent epitope presentations (18)
, or displayed p53 protein accumulation.
|
|
In the second patient group, the intermediate reciprocal frequencies of wt p53264272-specific CD8+ T cells were lower than 1/2128, yet they exceeded the geometric mean of the patient group as a whole (1/4767). This group of 7 patients was heterogeneous in respect to p53 expression in the tumor: 3 tumors were p53 wt, 2 had p53 mutations and accumulation, and 2 tumors (#7 and #10) expressed missense mutations within or next to the p53264272 epitope (positions 273 and 271, respectively) and were probably unable to present this epitope to T cells (Fig. 8)
.
The third and largest group of the patients (n = 17) had the lowest frequencies of wt p53264272-specific T cells. In this group, 14 of 17 primary tumors (>80%) accumulated p53 and had the potential to present this epitope. The frequencies of wt p53264272-specific T cells exceeded the lower limit of detection (1/7805) in 7 patients. The mean frequency for the group was significantly lower than that for the other two groups of patients. As indicated in Table 2
, wt p53264272-specific CD8+ T cells present in low frequencies in the peripheral circulation of these patients predominantly expressed a naive phenotype (CD45RA+/CD45RO-). On the other hand, in patients with high frequencies of wt p53264272 epitope-specific T cells, memory T cells (CD45RA-/CD45RO+) significantly increased in proportion (Fig. 7)
. Therefore, it would appear that in the peripheral circulation of patients whose tumors have a low potential for presenting the epitope, the frequency of wt p53264272-specific T cells with a memory phenotype is high. Therefore, it is likely that these T cells had a previous interaction with targets capable of presenting the p53264272 epitope.
HPV-16 Positivity and Frequency of wt p53264272-specific T Cells.
PCR analysis indicated that 12 of 26 (46%) tumors we examined contained HPV-16 E6/E7 DNA (Table 1)
. Among 12 tumors with p53 mutations, 4 (33%) were E6/E7+, whereas 8 of 12 (66%) wt p53 tumors were E6/E7+. One tumor (#28) was heterogeneous, with cells expressing either wt or mutated p53, and it was also E6/E7+. The p53 genotype was not available for 3 tumors analyzed for HPV. We found that 3 of 5 patients with the highest frequencies of wt p53264272-specific T cells and wt p53 in the tumor were HPV-16+. The patient group with the intermediate frequencies (Fig. 8)
, contained 7 patients of whom 2 could not be tested for HPV and 1 was not genotyped for p53. Of the remaining 4, 2 were wt p53 and HPV+, whereas the other 2 had mutated p53 and were HPV negative. The cohort of 17 patients with low CTL frequencies contained 13 informative cases (tumor #28 was excluded from analysis), with 4 of 9 mutated p53 tumors and 2 of 4 wt p53 tumors positive for HPV-16. By fitting loglinear models to the frequencies of each variable in the 3 x 2 x 2 contingency table, we determined that the frequency of p53264272-specific CTL was significantly correlated with the p53 status of the tumor (P = 0.016). In contrast, both the frequency of CTL and p53 status of the tumor were found to be independent of HPV E6/E7 positivity (P = 0.9260 and P = 0.2924, respectively).
Association of p53 Antibodies and Frequency of wt p53264272-specific T Cells.
An analysis of IgG antibodies to p53 in the sera of SCCHN patients by Bourhis et al. (22)
identified nearly 20% as seropositive. Because the presence of IgG antibodies to p53 implies a T-cell mediated response, it was of interest to determine whether the frequencies of wt p53264272-specific T cells present in the peripheral circulation of our seropositive patients were higher than the mean for all of the SCCHN patients. As indicated in Table 1
, 3 of the 30 patients (#9, #10, and #24) scored p53 seropositive. The mean frequency (1/4538) of wt p53264272-specific T cells in these 3 patients was not significantly higher than the geometric mean frequency for all of the SCCHN patients (1/4767). In 2 of these patients the tumor accumulated mutant p53, whereas in the third (#9), it did not. Interestingly, the tumor of this patient contained
2% of cells positive for p53 (Fig. 9)
, and it was HPV-16 E6/E7 positive. The presence of p53 autoantibodies in the serum, which is usually associated with p53 accumulation (22)
, and the relatively high frequency of wt p53264272-specific T cells detected in this patients circulation (1/2746), suggest that the virus-related enhanced processing of p53 might contribute to effective CTL generation in vivo.

View larger version (134K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 9. Immunostaining for p53 on a section of SCCHN in patient #9 (see Table 1
). The tumor was HPV-positive. The arrow indicates a tumor cell nucleus stained for p53. Original magnification, x250. Note that <2% of tumor cells were p53-positive. The features characterizing the immune response of this patient to the tumor are as follows: Antibodies to p53 present in serum. Frequency of the wtp53264272 epitope-specific CD8+ T cells in the peripheral circulation = 1/2746. HPV-16 E6/E7+
|
|
 |
DISCUSSION
|
|---|
SCCHN, which arise at or in close proximity to mucosal surfaces, interact closely with the host immune cells during tumor initiation, promotion, and progression. As a result of this interaction, tumor cells, which are recognized by immune effector cells, can be eliminated, whereas tumor cells able to evade immune recognition can grow and become resistant to the host immune cells. Tumors can evade immunodetection by a general down-regulation or loss of antigen-presenting molecules, or, more specifically, the loss of immunogenic epitopes (23, 24, 25)
. An outgrowth of epitope-loss tumor variants, which are resistant to immune effector cells, gives the tumor a "competitive edge" for growth in a hostile environment. Another general mechanism of tumor evasion may involve tumor-associated factors, which can cause dysfunction or even death of immune effector cells (26)
.
It has been generally assumed that p53 accumulation provides an opportunity for presentation to T cells of immunogenic wt p53 epitopes (7
, 27)
and generation of wt p53 epitope-specific T cells in tumor-bearing hosts. The expected result would be the presence of relatively high frequencies of wt p53 epitope-specific T cells in the circulation of patients with tumors accumulating p53. However, contrary to expectations, the results of our earlier study indicated that CTL could be generated only from PBMCs of the patients whose tumors either did not accumulate p53 or accumulated, but could not present, the p53264272 epitope (9)
. To confirm these unexpected results, we recruited a larger group of HLA-A2.1+ patients with SCCHN and using tetramer technology, determined frequencies and phenotypic characteristics of T cells specific for the wt p53264272 peptide in the peripheral circulation of these patients and a group of healthy controls.
We found the highest frequencies of wt p53264272-specific CD8+ T cells in a subset of patients with SCCHN whose tumors did not accumulate p53 protein and had a wt p53 genotype. Furthermore, in a subset of patients with tumors accumulating mutant p53, the mean frequency of p53264272-specific T cells did not differ significantly from that in healthy controls. In principle, p53 accumulating in the tumor has an increased opportunity to be presented to immune cells (28)
. However, it is known that some tumors with mutated p53 are unable to process the wt p53264272 epitope. The precedent for blocking of the epitope processing by tumor with a missense mutation at the hotspot codon 273, flanking wt p53264272 epitope, has been described by Theobald et al. (19)
. It is possible that additional instances of blocked, altered, or incomplete processing of this as well as other p53 epitopes exist. Another plausible explanation for the observed low frequency of the epitope-specific T cells in patients with mutated p53 could be that recognition of tumors by CTL depends not on p53 accumulation alone but on its turnover and processing by malignant cells, as recently reported by Vierboom et al. (29)
. Thus, it is possible that processing of mutated p53 by the tumor cell proteasome may not lead to optimal presentation of the wt p53264272 epitope and effective generation of specific CTL. On the other hand, it has been shown that even when no accumulation of p53 is evident, wt p53 epitope presentation can occur, rendering the tumor susceptible to wt p53-specific CTL (8
, 29, 30, 31)
. Thus, accumulation of mutated p53 is not the only criterion associated with the presentation of wt p53 epitope by the tumor and generation of CTL with p53 specificity.
The presence of HPV E6 in tumor cells could also influence p53 processing and CTL generation (29)
. HPV-16 E6/E7 expression has been reported in a substantial proportion of oral SCCHN (32)
. Expression of wt p53 in HPV E6-transformed cells is compatible with p53 inactivation, its proteolytic degradation, and enhanced processing, as well as presentation of its epitopes to T cells (29)
. For this reason, we examined the tumors studied for HPV-16 E6/E7 expression, and sought to correlate it with p53 expression and the frequency of CTL specific for wt p53264272 epitope. Multivariate analysis indicated that the frequency of wt p53-specific CTL depended on the p53 status of the tumor and not on its positivity for HPV. Nevertheless, it is interesting to note that in 5 of 7 patients with a relatively high frequency of wt p53-specific CTL, who did not accumulate p53, HPV-16 DNA was detected.
Another explanation for the observed low frequency of wt p53264272-specific T cells in patients with tumors accumulating p53 is that wt p53 epitopes are "self" determinants, and, thus, tolerance to them has to be overcome to induce an immune response. Studies by Theobald et al. (33)
and Hernández et al. (34)
demonstrated that tolerance to "self" p53 epitopes in mice is associated with deletion of high avidity T cells and retention of low to intermediate affinity T cells. We have consistently generated comparable anti-wt p53 CTL in humans following in vitro sensitization in the presence of epitope-pulsed dendritic cells (8
, 9)
. Others have also reported generation of such CTL (35
, 36)
. Furthermore, the current study shows that precursors of tetramer-positive anti-p53264272 T cells exist, albeit with low frequencies, in PBMCs of patients with tumors accumulating p53. Therefore, it is unlikely that CTL precursors of wt p53264272-specific T cells are deleted in cancer patients, as suggested previously. The mechanisms responsible for the failure of these precursor cells to expand ex vivo are presently unknown. It is possible that a certain threshold frequency of these precursor cells is needed to overcome anergy to self or immunosuppressive effects of the tumor microenvironment.
This study emphasizes the complexity of tumor-host interactions relevant to anti-wt p53 responses and to the development of wt p53-based vaccines. Our findings suggest that immune precursor cells of the wt p53264272 epitope are present in the circulation of HLA-A2+ patients with SCCHN and that in a subset of these patients, this epitope is immunogenic, results in CTL development, and contributes to shaping immunological memory. In this subset of SCCHN patients, CTL specific for wt p53264272 epitope might well have been responsible for elimination of tumors presenting the epitope and the outgrowth of epitope-loss tumor cells able to avoid these effector cells. On the other hand, it is also possible that tumors accumulating mutant p53, which are associated with poor prognosis (37)
, actively participate in elimination of tumor-specific effector cells, as suggested by studies reported from our laboratories.4
Tumor-associated apoptosis of such epitope-specific T cells might account for low frequencies of tetramer-positive CD8+ T cells in patients with tumors accumulating p53.
A complex interplay of factors, which might determine tumor survival or regression, is best illustrated in patient #9 (Table 1
; Fig. 9
). A relatively high frequency of the epitope-specific T cells in the circulation, the presence of anti-p53 Abs, accumulation of p53 in a small proportion (
2%) of tumor cells, and tumor positivity for HPV in this patient, suggest that the patients immune system is actively modulating tumor growth. Delivery of wt p53-based vaccines to patients such as this one could result in a rapid expansion of CTL, which might drive the selection of epitope-loss tumor variants. On the other hand, patients with tumors harboring p53 mutations and a low frequency of wt p53-specific CTL are unlikely to benefit from wt p53-based vaccines, because the expected postvaccine expansion of CTL is unlikely. Strategies that might help to overcome these difficulties include the use of an altered peptide ligand of the p53264272 epitope (38)
, identification of other wt p53 epitopes, which might be more immunogenic than p53264272, as well as MHC-class II restricted p53 epitopes to provide help for generation of antitumor effector cells. We and others are in the process of evaluating several other known HLA-A2.1-restricted wt p53 epitopes in hope of identifying those that may be able to support generation of high-affinity CTL (39)
. In planning for future p53 vaccines, the use of individualized or personalized vaccines targeting mutant p53 also needs to be revisited, particularly in light of newer evidence that a considerable number of p53 mutations occur within known CTL-defined epitopes in HLA-A2+ SCCHN patients. However, the efficiency of such vaccines depends on the demonstration that a given mutated p53 epitope can be processed and is immunogenic. Therefore, the selection of an optimal wt p53 peptide for vaccination must await additional studies to define characteristics of other available p53 epitopes.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Saleem Khan, University of Pittsburgh School of Medicine, for performing HPV-16 E6/E7 analysis and William Gooding, Biostatistics Center, University of Pittsburgh Cancer Institute, for providing statistical support.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by the NIH Grant PO-1 DE-12321 (to T. L. W. and A. B. D.), RO1 AI41408, RO1 AI14870, 1PO1 A143664 (to A. D. D.), and by Grant D/99/08916 of the Dr. Mildred Scheel Stiftung für Krebsforschung (to T. K. H.). 
2 To whom requests for reprints should be addressed, at University of Pittsburgh Cancer Institute, W1041 Biomedical Science Tower, 211 Lothrop Street, Pittsburgh, PA 15213. Phone: (412) 624-0080; Fax: (412) 624-0262; E-mail: whitesidetl{at}msx.upmc.edu 
3 The abbreviations used are: SCCHN, squamous cell carcinoma of the head and neck; Ab, antibody; CTL, cytotoxic T lymphocyte; HPV, human papillomavirus; HLA, human leukocyte antigen; IL, interleukin; mAb, monoclonal antibody; PBMC, peripheral blood mononuclear cell; PE, phycoerythrin; ECD, electron capture detection; TCR, T-cell receptor; wt, wild-type sequence; FLU, influenza. 
4 T. K. Hoffmann, G. Dworacki, T. Tsukihiro, N. Meidenbauer, W. Gooding, J. T. Johnson, and T. L. Whiteside. Spontaneous apoptosis of circulating T lymphocytes in patients with head and neck cancer and its clinical importance, submitted for publication. 
Received 3/ 6/01.
Accepted 4/16/02.
 |
REFERENCES
|
|---|
-
Hollstein M., Sidransky D., Vogelstein B., Harris C. C. p53 mutations in human cancers. Science (Wash. DC), 253: 49-53, 1991.[Abstract/Free Full Text]
-
Hollstein M., Shomer B., Greenblatt M., Soussi T., Hovig E., Montesano R., Harris C. C. Somatic point mutations in the p53 gene of human tumors and cell lines: updated compilation. Nucleic Acids Res., 24: 141-146, 1996.[Abstract/Free Full Text]
-
Raybaud-Diogene H., Tetu B., Morency R., Fortin A., Monteil R. A. p53 overexpression in head and neck squamous cell carcinoma: review of the literature. Eur. J. Cancer B Oral Oncol., 32b: 143-149, 1996.
-
Harris C. C. Structure and function of the p53 tumor suppressor gene: clues and rational cancer therapeutic strategies. J. Natl. Cancer Inst., 88: 1442-1455, 1996.[Abstract/Free Full Text]
-
Ropke M., Regner M., Claesson M. H. T cell-mediated cytotoxicity against p53-protein derived peptides in bulk and limiting dilution cultures of healthy donors. Scand. J. Immunol., 42: 98-103, 1998.
-
Soussi T. The humoral response to the tumor-suppressor gene-product p53 in human cancer: implications for the diagnosis and therapy. Immunol. Today, 17: 354-356, 1996.[Medline]
-
DeLeo A. B. p53-based immunotherapy of cancer. Crit. Rev. Immunol., 18: 29-35, 1998.[Medline]
-
Chikamatsu K., Nakano K., Storkus W. J., Appella E., Lotze M. T., Whiteside T. L., DeLeo A. B. Generation of anti-p53 cytotoxic T lymphocytes from human peripheral blood using autologous dendritic cells. Clin. Cancer Res., 5: 1281-1288, 1999.[Abstract/Free Full Text]
-
Hoffmann T. K., Nakano K., Elder E., Dworacki G., Finkelstein S. D., Apella E., Whiteside T. L., DeLeo A. B. Generation of T cells specific for the wild-type sequence p53264272 peptide in cancer patientsimplications for immunoselection of epitope-loss variants. J. Immunol., 165: 5938-5944, 2000.[Abstract/Free Full Text]
-
McKaig R. G., Baric R. S., Olshan A. F. Human papilloma virus and head and neck cancer: epidemiology and molecular biology. Head Neck, 20: 250-265, 1998.[Medline]
-
Altman J. D., Moss P. A. H., Goulder P. R., Barouch D. H., McHeyzer-Willians M. G., Bell J. I., McMichael A. J., Davis M. M. Phenotypic analysis of antigen-specific T lymphocytes. Science (Wash. DC), 274: 94-96, 1996.[Abstract/Free Full Text]
-
Davis M. M., Boniface J. J., Reich Z., Lyons D. S., Hampl J., Arden B., Chien Y. H. Ligand recognition by
ß T cell receptors. Annu. Rev. Immunol., 16: 523-544, 1998.[Medline]
-
Hoffmann T. K., Donnenberg V., Friebe U., Meyer M., Rinaldo C. R., DeLeo A. B., Whiteside T. L., Donnenberg A. D. Competition of peptide-MHC class I tetrameric complexes with anti-CD3 provides evidence for specificity of peptide binding to the TCR complex. Cytometry, 41: 321-328, 2000.[Medline]
-
Olerup O., Setterquist H. HLA-DR typing by PCR amplification with sequence specific primers (PCR-SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantations. Tissue Antigens, 39: 225-235, 1992.[Medline]
-
Houbiers J. G. A., Nijman H. W., Drijfhout J. W., Kenemans P., van der Velde C. J. H., Brand A., Momburg F., Kast W. M., Melief C. J. M. In vitro induction of human cytotoxic T lymphocyte responses against peptides of mutant and wild-type p53. Eur. J. Immunol., 23: 2072-2077, 1993.[Medline]
-
Zeh H. J., Leder G. H., Lotze M. T., Salter R. D., Tector M., Stuber G., Modrow S., Storkus W. J. Flow-cytometric determination of peptide-class-I complex formation. Identification of p53 peptides that bind to HLA-A2. Hum. Immunol., 39: 79-86, 1994.[Medline]
-
Finkelstein S. D., Przygodzki R., Pricolo V., Sakallah S. A., Swalsky P. A., Bakker A., Lanning R., Bland K. I., Cooper D. L. Prediction of biologic aggressiveness in colorectal cancer by p53/K-ras-2 topographic genotyping. Mol. Diagn., 1: 5-28, 1996.[Medline]
-
Picker L. J., Treer J. R., Ferguson-Darnell B., Collins P. A., Buck D., Terstappen W. M. M. Control of lymphocyte recirculation in man. J. Immunol., 150: 1105-1121, 1993.[Abstract]
-
Theobald M., Ruppert T., Kuckelkorn U., Hernandez J., Häussler A., Antunes Ferreira E., Liewer U., Biggs J., Levine A. J., Huber C., Koszinowski U. H., Kloetzel P. M., Sherman L. A. The sequence alteration associated with a mutational hotspot in p53 protects cells from lysis by cytotoxic T lymphocytes specific for a flanking peptide epitope. J. Exp. Med., 188: 1017-1028, 1998.[Abstract/Free Full Text]
-
Bradford C. R., Zhu S., Poore J., Fisher S. G., Beals T. F., Thoraval D., Hanash S. M., Carey T. E., Wolf G. T. p53 mutation as a prognostic marker in advanced laryngeal carcinoma. Arch. Otolaryngol. Head Neck Surg., 123: 605-609, 1997.[Abstract/Free Full Text]
-
Lane D. P., Hall P. A. MDM2arbiter of p53s destruction. Trends Biochem. Sci., 22: 372-374, 1997.[Medline]
-
Bourhis C., Lubin R., Roche B., Koscielny S., Bosq J., Dubois I., Talbot M., Marandas P., Schwaab G., Wibault P., Luboisnski B., Eschwege F., Soussi T. Analysis of p53 serum antibodies in patients with head and neck squamous cell carcinoma. J. Natl. Cancer Inst., 88: 1228-1233, 1996.[Abstract/Free Full Text]
-
Marincola F. M., Jaffee E. M., Hicklin D. J., Ferrone S. Escape of human solid tumors from T-cell recognition: molecular mechanisms and functional significance. Adv. Immunol., 74: 181-273, 2000.[Medline]
-
Wiedenfeld E. A., Fernandez-Vina M., Berzofsky J. A., Carbone D. P. Evidence for selection against human lung cancers bearing p53 missense mutations which occur within the HLA-A0201 peptide consensus motif. Cancer Res., 54: 1175-1177, 1994.[Abstract/Free Full Text]
-
Jager E., Jager D., Knuth A. Clinical cancer vaccine trials. Curr. Opin. Immunol., 14: 178-182, 2002.[Medline]
-
Whiteside T. L., Rabinowich H. The role of Fas/FasL in immunosuppression induced by human tumors. Cancer Immunol. Immunother., 46: 175-184, 1998.[Medline]
-
Theobald M., Biggs J., Dittmer D., Levine A. J., Sherman L. A. Targeting p53 as a general tumor antigen. Proc. Natl. Acad. Sci. USA, 92: 11993-11997, 1995.[Abstract/Free Full Text]
-
Gnjatic S., Cai Z., Viguier M., Chouaib S., Guillet J-G., Choppin J. Accumulation of the p53 protein allows recognition by human CTL of a wild-type p53 epitope presented by breast carcinomas and melanomas. J. Immunol., 160: 328-333, 1998.[Abstract/Free Full Text]
-
Vierboom M. P., Zwaveling S., Bos G. M. J., Ooms M., Krietemeijer G. M., Melief C. J., Offringa R. High steady-state levels of p53 are not a prerequisite for tumor eradication by wild-type p53-specific cytotoxic T lymphocytes. Cancer Res., 60: 5508-5513, 2000.[Abstract/Free Full Text]
-
Ropke M., Hald J., Guldberg P., Zeuthen J., Norgaard L., Fugger L., Svejgaard A., van der Burg S., Nijman H. W., Melief C. J. M., Claesson M. H. Spontaneous human squamous cell carcinomas are killed by a human cytotoxic T lymphocyte clone recognizing a wild-type p53-derived peptide. Proc. Natl. Acad. Sci. USA, 93: 14704-14707, 1996.[Abstract/Free Full Text]
-
Vierboom M. P., Nijman H. W., Offringa R., van der Voort E. I., van Hall T., van den Broek L., Jan Fleuren G., Kenemans P., Kast W. M., Melief C. J. Tumor eradication by wild type p53 specific cytotoxic T lymphocytes. J. Exp. Med., 186: 695-703, 1997.[Abstract/Free Full Text]
-
Sisk E. A., Bradford C. R., Jacob A., Yian C. H., Staton K. M., Tang G., Harris M. O., Carey T. E., Lancaster W. D., Gregoire L. Human papillomavirus infection in "young" versus "old" patients with squamous cell carcinoma of the head and neck. Head Neck, 22: 649-657, 2000.[Medline]
-
Theobald M., Biggs J., Hernández J., Lustgarten J., Labadie C., Sherman L. A. Tolerance to p53 by A2.1-restricted cytotoxic T lymphocytes. J. Exp. Med., 185: 833-841, 1997.[Abstract/Free Full Text]
-
Hernández J., Lee P. L., Davis M. M., Sherman L. A. 2000 The use of HLA-A2.1/p53 peptide tetramers to visualize the impact of self tolerance on the TCR repertoire. J. Immunol., 164: 596-602, 2000.[Abstract/Free Full Text]
-
Nijman H. M., Houbiers J. G., van der Burg S. H., Vierboom M. P., Kenemans P., Kast W. M., Melief C. J. Characterization of cytotoxic T lymphocyte epitopes of a self-protein, p53, and a non-self-protein, influenza matrix: relationship between major histocompatibility complex peptide binding affinity and immune responsiveness to peptides. J. Immunother., 14: 121-126, 1993.
-
Nijman H. M., van der Burg S. H., Vierboom M. P., Houbiers J. G., Kast W. M., Melief C. J. p53, a potential target for tumor-directed T cells. Immunol. Lett., 40: 171-178, 1994.[Medline]
-
Shin D. M., Lee J. S., Lippman S. M., Lee J. J., Tu Z. N., Choi G., Heyne K., Shin H. J., Ro J. Y., Goepfert H., Hong W. K., Hittelman W. N. p53 expressions: predicting recurrence and second primary tumors in head and neck squamous cell carcinoma. J. Natl. Cancer Inst., 88: 519-529, 1996.[Abstract/Free Full Text]
-
Hoffmann T. K., Loftus D. J., Nakano K., Maeurer M. J., Chikamatsu K., Appella E., Whiteside T. L., DeLeo A. B. The ability of variant peptides to reverse the non-responsiveness of T-lymphocytes to the wild-type sequence of p53264272 epitope. J. Immunol., 168: 1338-1347, 2002.[Abstract/Free Full Text]
-
McCarty T. M., Liu X., Sun J. Y., Peralta E. A., Diamond D. J., Ellenborn J. D. I. Targeting p53 for adoptive T-cell immunotherapy. Cancer Res., 58: 2601-2605, 1998.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
F. M. Speetjens, P. J.K. Kuppen, M. J.P. Welters, F. Essahsah, A. M. E.G. Voet van den Brink, M. G. K. Lantrua, A. R. P.M. Valentijn, J. Oostendorp, L. M. Fathers, H. W. Nijman, et al.
Induction of p53-Specific Immunity by a p53 Synthetic Long Peptide Vaccine in Patients Treated for Metastatic Colorectal Cancer
Clin. Cancer Res.,
February 1, 2009;
15(3):
1086 - 1095.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. Nesslinger, R. A. Sahota, B. Stone, K. Johnson, N. Chima, C. King, D. Rasmussen, D. Bishop, P. S. Rennie, M. Gleave, et al.
Standard Treatments Induce Antigen-Specific Immune Responses in Prostate Cancer
Clin. Cancer Res.,
March 1, 2007;
13(5):
1493 - 1502.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jewett, C. Head, and N.A. Cacalano
Emerging Mechanisms of Immunosuppression in Oral Cancers
Journal of Dental Research,
December 1, 2006;
85(12):
1061 - 1073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ito, A. Albers, Y. X. Zhao, C. Visus, E. Appella, T. L. Whiteside, and A. B. DeLeo
The Wild-Type Sequence (wt) p5325-35 Peptide Induces HLA-DR7 and HLA-DR11-Restricted CD4+ Th Cells Capable of Enhancing the Ex Vivo Expansion and Function of Anti-wt p53264-272 Peptide CD8+ T Cells
J. Immunol.,
November 15, 2006;
177(10):
6795 - 6803.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Albers, K. Abe, J. Hunt, J. Wang, A. Lopez-Albaitero, C. Schaefer, W. Gooding, T. L. Whiteside, S. Ferrone, A. DeLeo, et al.
Antitumor Activity of Human Papillomavirus Type 16 E7-Specific T Cells against Virally Infected Squamous Cell Carcinoma of the Head and Neck
Cancer Res.,
December 1, 2005;
65(23):
11146 - 11155.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Cohen, Z. Zheng, R. Bray, Y. Zhao, L. A. Sherman, S. A. Rosenberg, and R. A. Morgan
Recognition of Fresh Human Tumor by Human Peripheral Blood Lymphocytes Transduced with a Bicistronic Retroviral Vector Encoding a Murine Anti-p53 TCR
J. Immunol.,
November 1, 2005;
175(9):
5799 - 5808.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mueller, B. W. Schafer, S. Ferrari, M. Weibel, M. Makek, M. Hochli, and C. W. Heizmann
The Calcium-binding Protein S100A2 Interacts with p53 and Modulates Its Transcriptional Activity
J. Biol. Chem.,
August 12, 2005;
280(32):
29186 - 29193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sirianni, P. K. Ha, M. Oelke, J. Califano, W. Gooding, W. Westra, T. L. Whiteside, W. M. Koch, J. P. Schneck, A. DeLeo, et al.
Effect of Human Papillomavirus-16 Infection on CD8+ T-Cell Recognition of a Wild-Type Sequence p53264-272 Peptide in Patients with Squamous Cell Carcinoma of the Head and Neck
Clin. Cancer Res.,
October 15, 2004;
10(20):
6929 - 6937.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Nagorsen, C. Scheibenbogen, F. M. Marincola, A. Letsch, and U. Keilholz
Natural T Cell Immunity against Cancer
Clin. Cancer Res.,
October 1, 2003;
9(12):
4296 - 4303.
[Abstract]
[Full Text]
[PDF]
|
 |
|