
[Cancer Research 62, 3766-3772, July 1, 2002]
© 2002 American Association for Cancer Research
Molecular Biology and Genetics |
Aberrant Expression of HMGA2 in Uterine Leiomyoma Associated with Loss of TSC2 Tumor Suppressor Gene Function1
Deborah S. Hunter,
Michael Klotzbücher,
Hiroyuki Kugoh,
Sheng-Li Cai,
Johanna P. Mullen,
Guidalberto Manfioletti,
Ulrike Fuhrman and
Cheryl L. Walker2
Department of Carcinogenesis, The University of Texas M. D. Anderson Cancer Center, Science ParkResearch Division, Smithville, Texas 78957 [D. S. H., H. K., S-L. C., J. P. M., C. L. W.]; Research Laboratories of Schering AG, D-13342 Berlin, Germany [M. K., U. F.]; and Department of Biochemistry, Biophysics and Macromolecular Chemistry, University of Trieste, Trieste, Italy 34127 [G. M.]
 |
ABSTRACT
|
|---|
Unregulated proliferation of mesenchymal cells in leiomyomas, lipomas, hamartomas,and other diseases has been linked to the high mobility group (HMGA) family of DNA architectural proteins. HMGA genes are primarily expressed during embryonal development and silenced in adult tissues but can become reactivated in neoplasia as a result of chromosomal rearrangements. Although the genetic data suggesting a role for HMGA proteins in tumorigenesis are compelling, the biological role of these proteins in mesenchymal proliferation and differentiation is incompletely defined. Uterine myometria and spontaneous leiomyomas from the Eker rat, which carries a germ-line mutation in the tuberous sclerosis complex-2 (Tsc2) tumor suppressor gene, were analyzed for genetic defects in and expression of the Tsc2 and HMGA proteins. Eker leiomyomas exhibited a 50% incidence of loss of the wild-type Tsc2 allele and an almost uniform loss of protein expression, implicating loss of function of the Tsc2 gene in these tumors. Concomitantly, HMGA2 protein, which was completely absent in normal myometria, was expressed in 16 of 19 Eker leiomyomas. HMGA1 was expressed in both leiomyoma and normal myometria. No structural alterations were observed at the HMGA2 locus in either primary rat leiomyomas or leiomyoma-derived cell lines that expressed HMGA2. These data support a role for HMGA2 in the development of smooth muscle neoplasms and suggest HMGA2 expression is a point of convergence between the human disease and the Eker rat model. Furthermore, these data indicate that aberrant HMGA2 expression can result from dysfunction of the Tsc2 tumor suppressor gene, in the absence of structural alterations involving the HMGA2 locus.
 |
INTRODUCTION
|
|---|
Uterine leiomyomas occur at an extraordinarily high frequency in the human population, with an overall incidence of >75% (1)
, and result in clinically significant morbidity in women of childbearing age, often necessitating hysterectomy (2)
. The molecular genetics of these tumors is largely unknown, but at a cytogenetic level they share common features with many other mesenchymal neoplasms such as lipomas, endometrial polyps, pulmonary chondroid hamartomas, and others (3)
. Several recurring cytogenetic abnormalities have been noted in human leiomyoma (4)
; two of the most common alterations have been mapped to specific gene loci. Rearrangements at 12q14-15 and 6p21 map to the high mobility group genes HMGA23
(formerly HMGIC) and HMGA1 (formerly HMGI/Y), respectively. Alterations involving one or the other of these loci have been observed in up to 50% of leiomyomas, depending on the observer and methodology used (4
, 5)
.
The HMGA proteins are architectural factors with the ability to influence gene transcription (6)
; they are highly expressed during development, and expression is greatly diminished or absent in normal, mature tissues (7
, 8)
, including the smooth muscle layer of the uterus, termed the myometrium (9)
. HMGA protein expression is reactivated in many tumors, and, therefore, has been suggested as a diagnostic indicator for neoplastic transformation or increased metastatic potential (Ref. 10
and references therein). The observed chromosomal rearrangements at HMGA loci in leiomyoma are linked to aberrant expression (5
, 11)
, suggesting an activating role for these proteins in uterine smooth muscle proliferation. Moreover, studies have demonstrated that truncated or chimeric HMGA proteins produced by translocations are associated with neoplasia in other mesenchymal tissues (7
, 12, 13, 14)
. However, the biochemical role of HMGA in vivo remains unclear. Expression of a truncated form of HMGA2 in transgenic mice is sufficient to perturb adipogenesis predisposing to lipomas (15
, 16)
and for the onset of natural killer cell lymphomas (17)
. At present it is not known whether in vivo expression of the unmodified HMGA protein itself is sufficient to drive tumorigenesis.
The only other gene to be conclusively associated with leiomyoma development is the TSC2 tumor suppressor gene in the Eker rat model of uterine leiomyoma (18)
. Eker rats (Tsc2Ek/+) develop spontaneous leiomyomas at a high frequency (65%) as a result of a germ-line inactivation of one allele of the Tsc2 gene. These leiomyomas have many features of the human disease, particularly a dependence on ovarian hormones for tumor development and an enhanced responsiveness to estrogen (18, 19, 20, 21, 22)
. The TSC2 gene encodes a Mr 180,000 protein with a number of proposed functions (23, 24, 25, 26)
, but its precise role in the inhibition of tumorigenesis is still unclear. Because of phenotypic similarity between rat and human leiomyoma, we have hypothesized they share a common pathway for aberrant smooth muscle proliferation. Here we investigate molecular features of Eker rat leiomyoma and provide evidence that HMGA2 is up-regulated in these tumors subsequent to TSC2 inactivation, suggesting that HMGA2 dysfunction may be a convergence point between pathways in the Eker rat and human that result in the development of uterine leiomyoma.
 |
MATERIALS AND METHODS
|
|---|
Animals and Cell Lines.
Leiomyoma samples and normal myometria were obtained from female Eker rats housed one to three per cage in filter-capped polycarbonate cages, and provided food and water ad libitum. Animals used in this study were maintained at American Association of Laboratory Animal Care-accredited facilities and handled according to NIH guidelines for the care of laboratory animals. The ELT rat uterine leiomyoma cell lines (ELT3, ELT4, ELT6, ELT9, and ELT10) derived previously from Eker leiomyomas (27)
were maintained in DF8 medium containing 10% FCS (Hyclone Laboratories Inc., Logan, UT), 37°C, 5% CO2 as described previously.
HPLC TSC2 Genotyping and LOH Analysis.
Genomic DNA from rat frozen tissues was extracted by DNeasy kit (Qiagen Inc., Valencia, CA) and quantitated. To analyze the TSC2 genotype in uterine leiomyoma tissues, a multiplex PCR reaction was set up with the common forward primer (GAC TGG TAC TTC CTA GCA CCA T) for both wild-type and mutant TSC2 alleles located in intron 30. Unique reverse primers were used for the mutant (AAA CTC CAC GCA TGC TCA GT) and wild-type (CTC GGC CTC CAA GTA CCA TCT) alleles. PCR conditions were 35 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 30 s. The PCR amplified 180-bp mutant and 220-bp wild-type TSC2 allele products that were analyzed in an automated HPLC device (Transgenomics, Santa Clara, CA). DNA was eluted at a flow rate of 0.9 ml/min within a linear acetonitrile gradient consisting of buffer A (0.1 M triethylammonium acetate) and buffer B (0.1 M triethylammonium acetate, 25% acetonitrile) at 50°C. Under these conditions, DNA fragments of different size can be separated by elution over time. The AR between the mutant and wild-type peak was calculated.
Westerns.
Liquid nitrogen frozen tissue samples were pulverized and homogenized in SDS-loading buffer. Samples were cleared by centrifugation, electrophoresed on SDS-polyacrylamide gels, and transferred to polyvinylidene difluoride membranes. Nonspecific protein interactions were blocked by preincubation with 0.75% blocking reagent (Boehringer Mannheim, Indianapolis, IN) for 1 h at room temperature. Membranes were then incubated with primary antibody overnight in rabbit anti-HMGA2 peptide serum (28)
diluted 1:5000 in 0.75% blocking reagent or in rabbit anti HMGA1 peptide serum (N-19; Santa Cruz Antibodies, Santa Cruz, CA) at 1:4000 in 0.75% blocking reagent, followed by three washes with PBS, incubation with horseradish peroxidase-conjugated secondary antibodies (Amersham-Buchler, Brunswick, Germany) 1:3000 in 0.75% blocking reagent for 4 h, and final 3X wash with PBS. Bound antibodies were visualized using the enhanced chemiluminescence detection system (Amersham-Buchler). Additional Western blots were performed using the tuberin antibody (sc893; Santa Cruz Antibodies) or a second HMGA2 antibody (5)
, with a slightly different protocol as follows: pulverized samples were homogenized in radioimmunoprecipitation assay buffer with proteinase inhibitors. Preantibody blocking was performed using TBS with 5% milk for 1 h, and primary antibody incubations (1:500) were performed in TBS/0.5% Tween 20/1% milk for 1.5 h followed by secondary antibody for 1 h. Washes in between antibody incubations were performed 3 x 10 min in TBS/0.5% Tween 20.
RNA Analysis.
Liquid nitrogen frozen tissues were pulverized and total RNA was isolated using the RNAeasy kit (Qiagen) according to manufacturers instructions. Aliquots (5 µg) of these RNA samples were treated with DNAase (Life Technologies, Inc., Rockville, MD) and subjected to reverse transcription by Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) primed with random hexamers. The resultant first strand cDNA samples and "no-reverse transcription" controls underwent standard PCR amplification and qRT-PCR using a method described by Celi et al. (29)
substantiated previously in our laboratory (30)
. In this assay, absolute levels (in arbitrary units) of HMGA2 message in test samples were divided by absolute levels of GAPDH or
-tubulin housekeeping gene controls. Data are excluded if product fragments are observed in control reactions prepared without reverse transcriptase. Primer sequences for RT-PCR and qRT-PCR were as follows: HMGA2 and HMGA2-qPCR, forward CAGCCGTCCACATCAGCCCAG, reverse CTTGCGAGGATGTCTCTTCAG, reverse for competitor synthesis CTTGCGAGGATGTCTC TTCAGCATTTCCTGGGTCTGCCTCTTG; HMGA1 forward CTCCAGGGAGGAAACCAA GG, reverse TGCGGCTAAATGGGAAGTTA; GAPDH, forward GGTGCTGAGTA TCTCGTGGA, reverse GCCATGCCAGTGAGCTTCCC; GAPDH qRT-PCR as described previously (30)
; and
-tubulin, forward GCTCTACTGCCTGGAACATGG, reverse GTTATTGGCAGCATCTTCCTT, reverse for competitor synthesis GTTATTG GCAGCATCTTCCTTGGAAGAGCTGGCGGTAGGTGC.
FISH.
Rat genomic clones containing HMGA2 and HMGA1 in p1 plasmids (Incyte Genomics Inc., St. Louis, MO) were labeled with biotin-16-dUTP (Boehringer Mannheim) by nick translation, purified by ethanol precipitation, dissolved in 20 µl of formamide, mixed, and denatured. Hybridization solution [BSA (Boehringer Mannheim):10x SSC:50% dextran sulfate (Sigma), 1:2:2] and labeled probes were mixed 1:1, dropped onto denatured chromosomes, covered with parafilm, and incubated at 37°C for 15 h in a humidified chamber. After hybridization, the slides were washed sequentially at 37°C in 50% formamide/2x SSC, 2x SSC, 1x SSC for 15 min each and once in 4x SSC for 5 min. The slides were immersed in 70 µl of 3 µg/ml FITC-avidin (Vector Laboratories Inc., Burlingame, CA), 4x SSC, and 1% BSA for 45 min at 37°C. The slides were then washed for 5 min each 4x SSC, 4x SSC containing 0.05% Triton X-100, and then 4x SSC. The slides were mounted in antifade solution [1% diazabicyclooctane (Sigma, St. Louis, MO) in glycerol with 10% PBS] containing 1 µg/ml 4',6-diamidino-2-phenylindole (Sigma) and 1 mg/ml p-phenylenediamine (Sigma). Signals were observed with fluorescence microscopy.
Immunohistochemistry.
Frozen sections (5 µM) were affixed on slides with 3.7% formaldehyde in PBS for 10 min, followed by incubations in cold methanol and acetone, and washes with 3% H2O2 in methanol. Avidin-biotin blocking was performed with Vectastain (Vector) followed by PBS wash and blocking with 50% goat serum. Sections were incubated with anti-HMGA2 serum (Ref. 28
; 1:200 in PBS +2% BSA) for 2.5 h, washed with PBS/2% Tween 20, and incubated with 1:1000 goat antirabbit secondary antibody (Zymed, San Francisco, CA) for 60 min. Secondary antibodies were coupled with peroxidase using the Elite- avidin-biotin complex method kit (Vector), and visualization was performed with diaminobenzidine (Zymed).
Southern Analysis.
Genomic DNAs were obtained by phenol-chloroform isolation; 15 µg of DNA from each sample were digested with restriction enzymes, resolved on a 0.7% agarose gel, and transferred by capillary action to nylon membranes (
-probe membrane; Bio-Rad Inc., Hercules, CA). The HMG2A probe is a 280-bp PCR product derived from rat testis cDNA using primers described above and spanning exons 15.
 |
RESULTS
|
|---|
LOH of Tsc2 in Eker Rat Leiomyoma.
Eker rats (Tsc2Ek/+) carry one wild-type allele of the Tsc2 gene and one allele containing an inactivating viral insertion in intron 30. The two alleles can be identified by PCR, and the ratio of the products of these two alleles in tumor tissues can reveal if loss of the wild-type allele has occurred. PCR followed by HPLC analysis was performed on Eker rat leiomyoma to determine the frequency of wild-type allelic loss. First, the mean AR of the PCR products amplified from normal tissue containing both mutant and wild-type alleles was empirically determined as 1.5 ± 0.3 SD (n = 24). (The AR varies from the ideal ratio of 1 because the efficiency of PCR with mutant-specific and wild-type-specific primer pairs differs.) LOH determination of tumor tissues was based on the AR of PCR products (Fig. 1)
. The LOH criterion in this study was empirically defined as being >2 SDs outside of the mean of the heterozygous AR, (i.e., AR >2.1). Nine of 18 uterine leiomyomas were detected by HPLC to have loss of the wild-type allele.

View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. HPLC analysis of multiplex PCR products amplified from wild-type and mutant TSC2 alleles. "mut" and "wt" represent mutant and wild-type alleles, respectively. The ARs between mutant and wild-type alleles are listed below the pictures; A, normal Eker rat uterus without LOH (TSC2Ek/+); B, Eker rat uterine leiomyoma with LOH; C, Eker rat uterine leiomyoma without LOH. Of 18 samples analyzed, 9 fell within the defined parameters for LOH. This method detects primarily complete deletions; gene alterations that do not mutate or delete exon 30 are not detected by this analysis.
|
|
Loss of Tuberin Expression in Eker Rat Leiomyoma.
Western analysis indicated that tuberin was highly expressed in the myometrium of normal Eker (Tsc2Ek/+) and wild-type (Tsc2+/+) rats (Fig. 2)
. Robust expression was observed in both young animals throughout the estrus cycle and myometria from animals in reproductive senescence (16 months old), suggesting that ovarian hormone levels do not regulate expression. In contrast to aged-matched (16-month) normal myometrium, virtually all (28 of 29) of the leiomyoma samples demonstrated absent or greatly diminished tuberin expression (Fig. 2
; data not shown). These data suggest that inactivation of the wild-type allele has occurred in Eker leiomyomas as predicted by Knudsons two-hit model of tumor suppressor gene function.

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Western analysis of tuberin protein in Eker rat leiomyoma and normal myometrium. Antituberin (c20) immunoreactivity against protein lysates from normal rat myometrium from 24-month-old (Young) animals identified according to stage of the estrus cycle, and from uninvolved (Aged) myometrium and uterine leiomyoma (Tumors) obtained from 16-month-old Eker rats.
|
|
HMGA Gene Expression in Normal and Neoplastic Myometrium.
In the human myometrium, HMGA2 and HMGA1 are not generally detected at the message or protein level (8
, 31)
, but approximately half of human leiomyoma express one of these two proteins (4
, 28) . To determine whether HMGA expression was a feature of the Eker model, we first analyzed tissues from these animals to characterize HMGA2 and HMGA1 expression. Fragments of HMGA2 and HMGA1 were first amplified from normal rat testis cDNA using mouse-specific, intron-spanning primers in conserved regions of the coding sequence, and sequenced to confirm identity based on homology with mouse and human sequences. These primer pairs were then used to evaluate the presence of HMGA2 and HMGA1 mRNA in samples obtained from Eker rat tumors and from normal myometria (Fig. 3A)
. RT-PCR for GAPDH was performed as a control for RNA integrity. Fragments of both HMGA2 and HMGA1 could be amplified from both normal myometrium and leiomyoma. To quantitate these results, 2530 cycles of amplification were performed using a qRT-PCR method (29
, 30)
. Using this method, a substantial difference was observed in levels of HMGA2 from identical amounts of cDNA from tumor and normal samples (Fig. 3B)
. However, levels of GAPDH or
-tubulin in tumor tissues were variable and greatly elevated as compared with levels in normal myometrium so that when either of these products were used to normalize HMGA2 levels the apparent differences were equalized. Although the normalization tends to eliminate the difference in the absolute levels of HMGA2 message between tumor and normal tissues, similar substantial increases and variability in housekeeping gene levels in some tumors has been well-documented (32, 33, 34, 35)
. In this context, the absolute message levels may more accurately reflect the tumor biology than do the normalized values. Because changes in message levels were ambiguous, HMGA1 and HMGA2 expression was examined at the protein level.

View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. A, RT-PCR analysis of Eker rat leiomyoma and aged matched normal myometrium. Agarose gel resolution of products for HMGA2 (280-bp) and HMGA1 (323-bp) amplified from normal myometria (Normal) and uterine leiomyoma (Tumors). Positive control (C) is rat testis; B denotes water blank. GAPDH products (465-bp) are shown as a control for cDNA integrity. B, a quantitative RT-PCR assay using a competitive template was used to assess levels of HMGA2 mRNA in leiomyoma (n = 7) compared with normal myometria (n = 5). HMGA2 levels in 5 µg of total RNA were significantly increased in tumors over normal myometria (Students t test, P < 0.01). Parallel quantitative reactions for GAPDH or -tubulin were used to normalize the HMGA2 product levels to housekeeping gene levels. HMGA2 levels normalized by this method did not vary significantly between tumors and normal tissues; bars, ±SD.
|
|
Expression of HMGA Proteins in Eker Leiomyoma.
Normal myometrium and tumor samples from the Eker rat were examined for the presence of the HMGA2 and HMGA1 proteins by Western analysis. Corresponding with the presence of the mRNA, a Mr 15,000 band of roughly equal intensity was present in all of the samples analyzed (14 tumors and 4 normal myometria) using a polyclonal antibody against human HMGA1 (Fig 4A)
. In contrast, HMGA2 protein was not detected in any normal myometrial samples (that were age-matched to animals bearing tumors) but was present in 15 of 22 of Eker rat leiomyoma examined. (Fig. 4, B and C
; data not shown). Expression was analyzed using two different antibodies to HMGA2 (5
, 28)
. There was no correlation between the presence of the immunoreactive band and tumor size or histological appearance (data not shown). HMGA2 expression and localization to the nucleus was corroborated by immunohistochemistry on two frozen tumors that revealed a strong nuclear immunoreactivity in tumor sections that was absent from normal myometrium (Fig. 5)
. ELT (Eker leiomyoma-derived) cell lines (27)
, like most immortalized cells, also expressed HMGA2 (data not shown).

View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Western analysis of HMGA1 and HMGA2 in 30 µg of protein lysates from Eker rat leiomyoma and aged-matched control myometria. A, using an anti-HMGA1 antibody, an immunoreactive band was present at comparable levels in both leiomyoma (Tumor) and aged-matched myometrium (Normal) of all uterine samples examined. B, an HMGA2 antibody produced an immunoreactive band in 9 of 11 uterine leiomyoma but not in unaffected myometrium. Protein lysate from caki-1 (human clear cell carcinoma) cells is used as a positive control. C, analysis of an additional set of Eker rat leiomyoma and aged-matched myometria, using a second antibody against HMGA2, revealed the presence of the protein in the majority of tumors but not in normal myometrium. Bottom panel is a nonspecific hybridization from the secondary antibody, indicative of protein loading. Embryo was intentionally underloaded ( 5 µg) because of robust HMGA2 expression.
|
|
Localization of Rat HMGA2 to 7q21 and Absence of Translocations Affecting This Region in Eker Leiomyoma.
The data above indicate that HMGA2 is aberrantly expressed in the majority of Eker rat tumors. To determine whether, by analogy to the human disease, altered HMGA2 expression results from a structural alteration of the gene, we used a rat p1 genomic clone containing HMGA2 as a probe to map the chromosomal location of the gene by metaphase FISH. HMGA2 was localized in normal diploid fibroblasts to 7q21 as predicted based on synteny with human 12q15 and mouse chromosome 10 (Fig. 6)
. HMGA1 was mapped to 20q11 (data not shown), the position corresponding to human 6p21. The HMGA2 clone was used for FISH analysis of multiple Eker rat leiomyoma-derived cell lines to determine whether any of these lines contained a rearrangement of this locus. Results of the FISH analysis and karyotype determination of several cell lines are shown (Fig. 6
; Table 1
). There was no evidence of translocation of HMGA2 in any of the cell lines, although some lines exhibited aneuploidy of chromosome 7.

View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. FISH mapping of the HMGA2 locus in rat embryo fibroblasts (REF) to 7q21 and visualization of the locus in two cell lines derived from Eker rat leiomyoma (ELT 3 and ELT 10). The p1 genomic probe for HMGA2 exhibited no hybridization to other chromosomal loci. ELT10 exhibited trisomy of chromosome 7.
|
|
To additionally examine the possibility that small rearrangements or deletions had occurred at the HMGA2 locus in Eker tumors, Southern blot analysis was performed on seven Eker leiomyomas in which HMGA2 protein expression was detected. DNA from these tumors were digested with four different restriction enzymes and probed with a 280-bp cDNA fragment of HMGA2. The digests produced fragments varying between 9 kb and 1.3 kb in estimated size. No abnormalities in band size or intensity were noted as compared with DNA from normal Eker rat myometrium or liver (Fig. 7
; data not shown). Although this analysis cannot detect very small deletions or rearrangements in HMGA2, it was also noted that the PCR amplification and Western analysis did not reveal any evidence of alternative size products.
 |
DISCUSSION
|
|---|
In summary, tuberin was abundantly expressed in normal myometrium of the Eker rat, but expression was lost or diminished in 28 of 29 leiomyomas examined. Allelotype analysis suggested that, in at least half of these tumors, loss of expression is due to loss of the normal allele. The majority of these tumors expressed HMGA2 protein as detected by Western analysis and confirmed by immunohistochemistry, whereas no HMGA2 protein was detected in the myometrium in the absence of neoplasia. Cell lines derived from Eker leiomyomas were not found to have sustained structural alterations at the HMGA2 locus, and primary tumors with aberrant HMGA2 expression were not observed to carry deletions or rearrangements of the gene. These data indicate that HMGA2 overexpression is a high frequency event in the development of uterine leiomyoma in the Eker rat that may occur secondary to inactivation of TSC2 rather than as a result of chromosome rearrangement involving the HMGA2 gene itself. These findings also suggest that human and Eker leiomyoma share a common biochemical dysfunction (aberrant HMGA2 expression) that can be precipitated by at least two different genetic events. The apparent convergence of gene dysfunction in human and Eker rat leiomyoma is consistent with a number of other significant shared features that include hormone responsiveness, and the involvement of IGF-I signaling (36, 37, 38)
.
Notably, whereas there was no evidence of structural alteration at the 7q21 locus, several Eker leiomyoma-derived cell lines exhibited trisomy 7. It may not be simply coincidental that the IGF-I gene, of which the product participates in an autocrine loop in Eker leiomyoma (39)
, is also present on chromosome 7 near the HMGA2 locus. Some human leiomyoma similarly exhibit trisomy of chromosome 12 where IGF-I and HMGA2 are located (4)
.
Published reports have addressed the potential mechanism of HMGA2 involvement in human tumors arising from uterine smooth muscle and other tissues. The occurrence of frequent translocations at the HMGA2 locus in human uterine leiomyoma and other mesenchymal neoplasms suggests the participation of this protein in tumorigenesis. However, many of these translocations result in fusion proteins and truncations of the coding sequence (13
, 28)
; in these cases the modified protein may contribute to tumor formation. Whether or not the overexpression of the full-length HMGA2 protein is sufficient to promote cellular proliferation in vivo remains an open question. Several reports show that HMGA2 overexpression is strictly correlated with cytogenetic alterations, with the majority of these being either translocations or aberrant splicing within the coding sequence (14
, 40
, 41)
. In fact, some authors have accumulated considerable evidence implicating one of the fusion partners (Rad51) of HMGA2 in tumorigenesis (42)
, suggesting the critical contribution of gain of function arising from the ectopic sequences. Conversely, a few identified translocations have been mapped well upstream of the coding sequence (43)
, and some authors report HMGA2 expression at a higher frequency than the translocations (28
, 42)
. These observations are consistent with the contribution of the full-length protein, rather than a truncated or fusion protein, to the tumor phenotype. Furthermore, HMGA1 and HMGA2 protein expression can be rapidly induced in normal vascular smooth muscle in conjunction with damage-induced proliferation in vivo (44)
, indicating that wild-type proteins in adult tissues may participate in early neoplastic processes. Published data using transgenic mice have demonstrated that truncated versions of HMGA2 can promote hyperplasia in some tissues (15
, 16)
. Thus far, there are no conclusive data from transgenic models supporting a role for overexpression of the wild-type protein.
In the Eker model, the overexpression of HMGA2 appears unrelated to any structural alteration in the gene that would modify protein sequence or transcriptional regulation. This observation suggests a pathway link between TSC2 and HMGA2, and supports a role for aberrant expression of wild-type HMGA2 uterine smooth muscle tumorigenesis. A pathway linking TSC2 and HMGA2 could be relevant to disorders other than uterine leiomyoma. Heterozygosity for TSC2 in humans results in the development of tuberous sclerosis, a serious condition that is manifested by mental retardation, and tumors of the skin, kidney, lung, heart, and other organs. Tuberous sclerosis patients have a high incidence of otherwise unusual proliferative lesions such as pulmonary hamartomas, angiomyolipomas of the kidney, MMPH, and the rare, but often fatal disease, pulmonary LAM. Each of these conditions has been convincingly linked to TSC2 (45, 46, 47, 48)
, and each has an independent connection with HMGA2 expression or genetic alteration. HMGA2 expression is observed in pulmonary hamartomas (40
, 49)
and has been described in LAM lesions (50)
, which are characterized by the diffuse hyperproliferation of pulmonary smooth muscle. No published reports have examined HMGA expression in renal angiomyolipomas or MMPH; however, the kidney and the lung (specifically Type II pneumocytes, the hyperproliferative cell in MMPH) are among the rare exceptions to the exclusion of HMGA2 expression in normal adult tissues (9
, 40)
. Collectively, these observations tend to support a hypothesis that one effect of TSC2 dysfunction may be the induction of HMGA2 expression or that their biochemical functions are linked because defects in either of these genes can result in a similar phenotype in specific tissues. Strikingly, evidence for the interplay between these proteins exists in both rodent and human species, even though the manifestations of TSC2 heterozygosity differ. For example, the rat does not develop certain features of tuberous sclerosis such as cortical tubers, angiomyolipomas, or pulmonary hamartomas. Similarly, uterine leiomyomas are not a recognized feature of tuberous sclerosis, although a role for tuberin dysfunction in human leiomyoma development has not, to our knowledge, been systematically examined. These incongruities are likely the result of multigenic factors that determine phenotypic effects of TSC2 dysfunction, because even among affected members of a single family, disease severity and clinical presentation may profoundly differ (51)
.
Although, like tuberin, the biological function of HMGA2 is not fully understood, data amassed thus far suggest that this protein plays a role in both the proliferation and differentiation of certain tissues. We speculate that one role for HMGA2 in developing tissues is to modulate sensitivity to exogenous signals for proliferation or differentiation. This function is analogous to the role of another DNA architectural factor, HMGB1, that has been shown to enhance transactivation by the steroid hormone receptors (52
, 53)
. This function would be critical in the developing embryo or perhaps during damage repair but may not be needed in most normal adult tissues. If activated, directly or indirectly, in adult tissues, this function could make cells exquisitely sensitive to growth signals, resulting in proliferation. This increased sensitivity would not eliminate growth control, resulting in a benign growth that would still be subject to regulation. This paradigm describes tumors like leiomyomas, which, unlike the normal myometrium, are growth-promoted by ovarian hormones but become quiescent when the hormonal stimulus is removed (54
, 55)
.
Cumulatively, these data suggest that leiomyoma development in humans and rodents share a high frequency of aberrant expression of HMGA2, and that this expression can result from at least two distinct mechanisms. Future studies could substantiate and define a biochemical pathway linking HMGA2 and TSC2 in the pathogenesis of proliferative disorders.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Peter Vonier and Sara Gibson for experimental assistance, and Rebecca Deen and Judy Ing for help with manuscript preparation.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by National Institute of Environmental Health Sciences ES07784, NIH CA16672, ES08263 (to C. L. W.), by Associazone Italiana per la Ricerca sul Cancro (AIRC; to G. M.), by FKZ 0311773/7 of the Bundesministerium für Bildung und Forschung (to U. F.), and by the generous support of the LAM Foundation (fellowship to D. S. H.). 
2 To whom requests for reprints should be addressed, at Department of Carcinogenesis, The University of Texas M.D. Anderson Cancer Center, Science ParkResearch Division, P.O. Box 389, Smithville, TX 78957. Phone: (512) 237-9550; Fax: (512) 237-2475; E-mail: cwalker{at}odin.mdacc.tmc.edu 
3 The abbreviations used are: HMG, high mobility group; qRT-PCR, quantitative reverse transcription-PCR; RT-PCR, reverse transcription-PCR; LOH, loss of heterozygosity; IGF, insulin-like growth factor; TSC2, tuberous sclerosis complex-2; LAM, lymphangioleiomyomatosis; MMPH, multifocal micronodular pneumocyte hyperplasia; HPLC, high-performance liquid chromatography; AR, area ratio; TBS, Tris-buffered saline; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FISH, fluorescence in situ hybridization. 
Received 12/19/01.
Accepted 4/22/02.
 |
REFERENCES
|
|---|
- Cramer S. F., Patel A. The frequency of uterine leiomyomas. Am. J. Clin. Pathol., 94: 435-438, 1990.[Medline]
- Buttram V. C., Jr., Reiter R. C. Uterine leiomyomata: etiology, symptomatology, and management. Fertil. Steril., 36: 433-445, 1981.[Medline]
- Hess J. L. Chromosomal translocations in benign tumors: the HMGI proteins. Am. J. Clin. Pathol., 109: 251-261, 1998.[Medline]
- Ligon A. H., Morton C. C. Genetics of uterine leiomyomata. Genes Chromosomes Cancer, 28: 235-245, 2000.[Medline]
- Tallini G., Dal Cin P., Rhoden K. J., Chiapetta G., Manfioletti G., Giancotti V., Fusco A., Van den Berghe H., Sciot R. Expression of HMGI-C and HMGI(Y) in ordinary lipoma and atypical lipomatous tumors: immunohistochemical reactivity correlates with karyotypic alterations. Am. J. Pathol., 151: 37-43, 1997.[Abstract]
- Reeves R. Molecular biology of HMGA proteins: hubs of nuclear function. Gene, 277: 63-81, 2001.[Medline]
- Tallini G., Dal Cin P. HMGI(Y) and HMGI-C dysregulation: a common occurrence in human tumors. Adv. Anat. Pathol., 6: 237-246, 1999.[Medline]
- Rogalla P., Drechsler K., Frey G., Hennig Y., Helmke B., Bonk U., Bullerdiek J. HMGI-C expression patterns in human tissues. Implications for the genesis of frequent mesenchymal tumors. Am. J. Pathol., 149: 775-779, 1996.[Abstract]
- Gattas G. J., Quade B. J., Nowak R. A., Morton C. C. HMGIC expression in human adult and fetal tissues and in uterine leiomyomata. Genes Chromosomes Cancer, 25: 316-322, 1999.[Medline]
- Chiappetta G., Manfioletti G., Pentimalli F., Abe N., Di Bonito M., Vento M. T., Giuliano A., Fedele M., Viglietto G., Santoro M., Watanabe T., Giancotti V., Fusco A. High mobility group HMGI(Y) protein expression in human colorectal hyperplastic and neoplastic diseases. Int. J. Cancer, 91: 147-151, 2001.[Medline]
- Tkachenko A., Ashar H. R., Meloni A. M., Sandberg A. A., Chada K. K. Misexpression of disrupted HMGI architectural factors activates alternative pathways of tumorigenesis. Cancer Res., 57: 2276-2280, 1997.[Abstract/Free Full Text]
- Fedele M., Berlingieri M. T., Scala S., Chiariotti L., Viglietto G., Rippel V., Bullerdiek J., Santoro M., Fusco A. Truncated and chimeric HMGI-C genes induce neoplastic transformation of NIH3T3 murine fibroblasts. Oncogene, 17: 413-418, 1998.[Medline]
- Petit M. M. R., Mols R., Schoenmakers E. F., Mandahl N., Van de Ven W. J. LPP, the preferred fusion partner gene of HMGIC in lipomas, is a novel member of the LIM protein gene family. Genomics, 36: 118-129, 1996.[Medline]
- Kurose K., Mine N., Iida A., Nagai H., Harada H., Araki T., Emi M. Three aberrant splicing variants of the HMGIC gene transcribed in uterine leiomyomas. Genes Chromosomes Cancer, 30: 212-217, 2001.[Medline]
- Arlotta P., Tai A. K., Manfioletti G., Clifford C., Jay G., Ono S. J. Transgenic mice expressing a truncated form of the high mobility group I-C protein develop adiposity and an abnormally high prevalence of lipomas. J. Biol. Chem., 275: 14394-14400, 2000.[Abstract/Free Full Text]
- Battista S., Fidanza V., Fedele M., Klein-Szanto A. J., Outwater E., Brunner H., Santoro M., Croce C. M., Fusco A. The expression of a truncated HMGI-C gene induces gigantism associated with lipomatosis. Cancer Res., 59: 4793-4797, 1999.[Abstract/Free Full Text]
- Baldassarre G., Fedele M., Battista S., Vecchione A., Klein-Szanto A. J., Santoro M., Waldmann T. A., Azimi N., Croce C. M., Fusco A. Onset of natural killer cell lymphomas in transgenic mice carrying a truncated HMGI-C gene by the chronic stimulation of the IL-2 and IL-15 pathway. Proc. Natl. Acad. Sci. USA, 98: 7970-7975, 2001.[Abstract/Free Full Text]
- Everitt J. I., Wolf D. C., Howe S. R., Goldsworthy T. L., Walker C. Rodent model of reproductive tract leiomyomata. Clinical and pathological features. Am. J. Pathol., 146: 1556-1567, 1995.[Abstract]
- Burroughs K. D., Fuchs-Young R., Davis B., Walker C. L. Altered hormonal responsiveness of proliferation and apoptosis during myometrial maturation and the development of uterine leiomyomas in the rat. Biol. Reprod., 63: 1322-1330, 2000.[Abstract/Free Full Text]
- Schwartz S. M., Marshall L. M., Baird D. D. Epidemiologic contributions to understanding the etiology of uterine leiomyomata. Environ. Health Perspect., 108 (Suppl.5): 821-827, 2000.
- Walker C. L. Role of hormonal and reproductive factors in the etiology and treatment of uterine leiomyoma. Recent. Prog. Horm. Res., 57: 277-294, 2002.[Abstract/Free Full Text]
- Burroughs K. D., Howe S. R., Okubo Y., Fuchs-Young R., LeRoith D., Walker C. L. Disregulation of insulin-like growth factor-I signaling in uterine leiomyoma. J. Endocrinol., 172: 83-93, 2002.[Abstract]
- Aicher L. D., Campbell J. S., Yeung R. S. Tuberin phosphorylation regulates its interaction with hamartin. Two proteins involved in tuberous sclerosis. J. Biol. Chem., 276: 21017-21021, 2001.[Abstract/Free Full Text]
- Kleymenova E., Ibraghimov-Beskrovnaya O., Kugoh H., Everitt J., Xu H., Kiguchi K., Landes G., Harris P., Walker C. Tuberin-dependent membrane localization of polycystin-1: a functional link between polycystic kidney disease and the TSC2 tumor suppressor gene. Mol. Cell, 7: 823-832, 2001.[Medline]
- Hengstschlager M., Rodman D. M., Miloloza A., Hengstschlager-Ottnad E., Rosner M., Kubista M. Tuberous sclerosis gene products in proliferation control. Mutat. Res., 488: 233-239, 2001.[Medline]
- Cheadle J. P., Reeve M. P., Sampson J. R., Kwiatkowski D. J. Molecular genetic advances in tuberous sclerosis. Hum. Genet., 107: 97-114, 2000.[Medline]
- Howe S. R., Gottardis M. M., Everitt J. I., Goldsworthy T. L., Wolf D. C., Walker C. Rodent model of reproductive tract leiomyomata. Establishment and characterization of tumor-derived cell lines. Am. J. Pathol., 146: 1568-1579, 1995.[Abstract]
- Klotzbucher M., Wasserfall A., Fuhrmann U. Misexpression of wild-type and truncated isoforms of the high-mobility group I proteins HMGI-C and HMGI(Y) in uterine leiomyomas. Am. J. Pathol., 155: 1535-1542, 1999.[Abstract/Free Full Text]
- Celi F. S., Zenilman M. E., Shuldiner A. R. A rapid and versatile method to synthesize internal standards for competitive PCR. Nucleic Acids Res., 21: 1047 1993.[Free Full Text]
- Hodges L. C., Bergerson J. S., Hunter D. S., Walker C. L. Estrogenic effects of organochlorine pesticides on uterine leiomyoma cells in vitro. Toxicol. Sci., 54: 355-364, 2000.[Abstract/Free Full Text]
- Williams A. J., Powell W. L., Collins T., Morton C. C. HMGI(Y) expression in human uterine leiomyomata. Involvement of another high-mobility group architectural factor in a benign neoplasm. Am. J. Pathol., 150: 911-918, 1997.[Abstract]
- Goidin D., Mamessier A., Staquet M. J., Schmitt D., Berthier-Vergnes O. Ribosomal 18S RNA prevails over glyceraldehyde-3-phosphate dehydrogenase and ß-actin genes as internal standard for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell subpopulations. Anal. Biochem., 295: 17-21, 2001.[Medline]
- Spanakis E. Problems related to the interpretation of autoradiographic data on gene expression using common constitutive transcripts as controls. Nucleic Acids Res., 21: 3809-3819, 1993.[Abstract/Free Full Text]
- Chang T. J., Juan C. C., Yin P. H., Chi C. W., Tsay H. J. Up-regulation of ß-actin, cyclophilin and GAPDH in N1S1 rat hepatoma. Oncol. Rep., 5: 469-471, 1998.[Medline]
- Bhatia P., Taylor W. R., Greenberg A. H., Wright J. A. Comparison of glyceraldehyde-3-phosphate dehydrogenase and 28S-ribosomal RNA gene expression as RNA loading controls for northern blot analysis of cell lines of varying malignant potential. Anal. Biochem., 216: 223-226, 1994.[Medline]
- Strawn E. Y., Jr., Novy M. J., Burry K. A., Bethea C. L. Insulin-like growth factor I promotes leiomyoma cell growth in vitro. Am. J. Obstet. Gynecol., 172: 1837-1843, discussion 18431844 1995.[Medline]
- Giudice L. C., Irwin J. C., Dsupin B. A., Pannier E. M., Jin I. H., Vu T. H., Hoffman A. R. Insulin-like growth factor (IGF). IGF binding protein (IGFBP), and IGF receptor gene expression and IGFBP synthesis in human uterine leiomyomata. Hum. Reprod., 8: 1796-1806, 1993.[Abstract/Free Full Text]
- Englund K., Lindblom B., Carlstrom K., Gustavsson I., Sjoblom P., Blanck A. Gene expression and tissue concentrations of IGF-I in human myometrium and fibroids under different hormonal conditions. Mol. Hum. Reprod., 6: 915-920, 2000.[Abstract/Free Full Text]
- Howe S. R., Pass H. I., Ethier S. P., Matthews W. J., Walker C. Presence of an insulin-like growth factor I autocrine loop predicts uterine fibroid responsiveness to tamoxifen. Cancer Res., 56: 4049-4055, 1996.[Abstract/Free Full Text]
- Tallini G., Vanni R., Manfioletti G., Kazmierczak B., Faa G., Pauwels P., Bullerdiek J., Giancotti V., Van Den Berghe H., Dal Cin P. HMGI-C and HMGI(Y) immunoreactivity correlates with cytogenetic abnormalities in lipomas, pulmonary chondroid hamartomas, endometrial polyps, and uterine leiomyomas and is compatible with rearrangement of the HMGI-C and HMGI(Y) genes. Lab. Investig., 80: 359-369, 2000.[Medline]
- Hauke S., Rippe V., Bullerdiek J. Chromosomal rearrangements leading to abnormal splicing within intron 4 of HMGIC?. Genes Chromosomes Cancer, 30: 302-304, 2001.[Medline]
- Takahashi T., Nagai N., Oda H., Ohama K., Kamada N., Miyagawa K. Evidence for RAD51L1/HMGIC fusion in the pathogenesis of uterine leiomyoma. Genes Chromosomes Cancer, 30: 196-201, 2001.[Medline]
- Fejzo M. S., Ashar H. R., Krauter K. S., Powell W. L., Rein M. S., Weremowicz S., Yoon S-J., Kucherlapati R. S., Chada K., Morton C. c. Translocation breakpoints upstream of the HMGIC gene in uterine leiomyomata suggest dysregulation of this gene by a mechanism different from that in lipomas. Genes Chromosomes Cancer, 17: 1-6, 1996.[Medline]
- Chin M. T., Pellacani A., Hsieh C. M., Lin S. S., Jain M. K., Patel A., Huggins G. S., Reeves R., Perrella M. A., Lee M. E. Induction of high mobility group I architectural transcription factors in proliferating vascular smooth muscle in vivo and in vitro. J. Mol. Cell. Cardiol., 31: 2199-2205, 1999.[Medline]
- Smolarek T. A., Wessner L. L., McCormack F. X., Mylet J. C., Menon A. G., Henske E. P. Evidence that lymphangiomyomatosis is caused by TSC2 mutations: chromosome 16p13 loss of heterozygosity in angiomyolipomas and lymph nodes from women with lymphangiomyomatosis. Am. J. Hum. Genet., 62: 810-815, 1998.[Medline]
- Carsillo T., Astrinidis A., Henske E. P. Mutations in the tuberous sclerosis complex gene TSC2 are a cause of sporadic pulmonary lymphangioleiomyomatosis. Proc. Natl. Acad. Sci. USA, 97: 6085-6090, 2000.[Abstract/Free Full Text]
- Franz D. N., Brody A., Meyer C., Leonard J., Chuck G., Dabora S., Sethuraman G., Colby T. V., Kwiatkowski D. J., McCormack F. X. Mutational and radiographic analysis of pulmonary disease consistent with lymphangioleiomyomatosis and micronodular pneumocyte hyperplasia in women with tuberous sclerosis. Am. J. Respir. Crit. Care Med., 164: 661-668, 2001.[Abstract/Free Full Text]
- Niida Y., Stemmer-Rachamimov A. O., Logrip M., Tapon D., Perez R., Kwiatkowski D. J., Sims K., MacCollin M., Louis D. N., Ramesh V. Survey of somatic mutations in tuberous sclerosis complex (TSC) hamartomas suggests different genetic mechanisms for pathogenesis of TSC lesions. Am. J. Hum. Genet., 69: 493-503, 2001.[Medline]
- Kazmierczak B., Rosigkeit J., Wanschura S., Meyer-Bolte K., Van de Ven W. J., Kayser K., Krieghoff B., Kastendiek H., Bartnitzke S., Bullerdiek J. HMGI-C rearrangements as the molecular basis for the majority of pulmonary chondroid hamartomas: a survey of 30 tumors. Oncogene, 12: 515-521, 1996.[Medline]
- Foronjy R., Kolesnikova N., Wilt J., Simonelli P., Thomashow B., Ginsburg M., Schulman L., DArmiento J. D., Chada K. Benign mesenchymal tumor gene HMGI-C as a diagnostic marker in lymphangioleiomyomatosis (LAM). Am. J. Respir. Crit. Care Med., 163: A559 2001.
- Gomez M. R. Sampson J. R. Whittemore V. H. eds. . Tuberous Sclerosis Complex: Developmental Perspectives in Psychiatry, Ed. 3. Oxford University Press New York 1999.
- Romine L. E., Wood J. R., Lamia L. A., Prendergast P., Edwards D. P., Nardulli A. M. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element. Mol. Endocrinol., 12: 664-674, 1998.[Abstract/Free Full Text]
- Boonyaratanakornkit V., Melvin V., Prendergast P., Altmann M., Ronfani L., Bianchi M. E., Taraseviciene L., Nordeen S. K., Allegretto E. A., Edwards D. P. High-mobility group chromatin proteins 1 and 2 functionally interact with steroid hormone receptors to enhance their DNA binding in vitro and transcriptional activity in mammalian cells. Mol. Cell. Biol., 18: 4471-4487, 1998.[Abstract/Free Full Text]
- Robboy S. J., Bentley R. C., Butnor K., Anderson M. C. Pathology and pathophysiology of uterine smooth-muscle tumors. Environ. Health Perspect., 108 (Suppl.5): 779-784, 2000.
- Olive D. L. Review of the evidence for treatment of leiomyomata. Environ. Health Perspect., 108 (Suppl.5): 841-843, 2000.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Gui, G. H. He, M. P. Walsh, and X.-L. Zheng
Predisposition to tetraploidy in pulmonary vascular smooth muscle cells derived from the Eker rats
Am J Physiol Lung Cell Mol Physiol,
September 1, 2007;
293(3):
L702 - L711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. Laping, J. I. Everitt, K. S. Frazier, M. Burgert, M. J. Portis, C. Cadacio, L. I. Gold, and C. L. Walker
Tumor-Specific Efficacy of Transforming Growth Factor-{beta}RI Inhibition in Eker Rats
Clin. Cancer Res.,
May 15, 2007;
13(10):
3087 - 3099.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Cook, B. J. Davis, S.-L. Cai, J. C. Barrett, C. J. Conti, and C. L. Walker
Interaction between genetic susceptibility and early-life environmental exposure determines tumor-suppressor-gene penetrance
PNAS,
June 14, 2005;
102(24):
8644 - 8649.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Sales, S. Battersby, A. R. W. Williams, R. A. Anderson, and H. N. Jabbour
Prostaglandin E2 Mediates Phosphorylation and Down-Regulation of the Tuberous Sclerosis-2 Tumor Suppressor (Tuberin) in Human Endometrial Adenocarcinoma Cells via the Akt Signaling Pathway
J. Clin. Endocrinol. Metab.,
December 1, 2004;
89(12):
6112 - 6118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Hockenbery
Nailing Down a Link between Tuberin and Renal Cysts
Am. J. Pathol.,
February 1, 2003;
162(2):
369 - 371.
[Full Text]
[PDF]
|
 |
|