Cancer Research Cancer Epigenetics  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masuda, T.-a.
Right arrow Articles by Mori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masuda, T.-a.
Right arrow Articles by Mori, M.
[Cancer Research 62, 3819-3825, July 1, 2002]
© 2002 American Association for Cancer Research


Tumor Biology

Clinical and Biological Significance of S-Phase Kinase-associated Protein 2 (Skp2) Gene Expression in Gastric Carcinoma

Modulation of Malignant Phenotype by Skp2 Overexpression, Possibly via p27 Proteolysis1

Taka-aki Masuda, Hiroshi Inoue, Hideto Sonoda, Shinji Mine, Yasuji Yoshikawa, Keiko Nakayama, Kei-Ichi Nakayama and Masaki Mori2

Departments of Molecular and Surgical Oncology [T-a. M., H. I., H. S., S. M., M. M.], Pathology [Y. Y.], Molecular and Cellular Biology [K-I. N.], and Molecular Genetics [K. N.], Medical Institute of Bioregulation, Kyushu University, Beppu 874-0838, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 Biological Significance of Skp2...
 DISCUSSION
 REFERENCES
 
Reduced expression level of p27, a cyclin-dependent kinase inhibitor, is associated with highaggressiveness and poor prognosis of various malignant tumors, including gastric carcinoma. S-phase kinase-associated protein 2 (Skp2), a member of the F-box family of substrate-recognition subunits of Skp1-Cullin-F-box ubiquitin-protein ligase complexes, is necessary for p27 ubiquitination and degradation. In the present study, we examined the clinical and biological significance of Skp2 expression in human gastric carcinoma and the relationship between the expression of Skp2 and p27. Northern blot analysis showed that Skp2 mRNA was overexpressed in carcinoma tissues (P < 0.05), and the high Skp2 expression group showed significantly poorer prognosis in 98 patients with gastric carcinoma (P < 0.05). Immunohistochemical analysis showed that Skp2 protein was expressed predominantly in carcinoma cells. We also found an inverse correlation between the expression of Skp2 mRNA and p27 protein in vivo (P < 0.01). To analyze the biological behavior of Skp2, we established stably Skp2-transfected gastric carcinoma cell lines. Western blot analysis showed that Skp2-transfected cells expressed lower levels of p27 protein than the control cells. Skp2-transfected cells showed significantly higher levels of growth rate (P < 0.05), percentage of bromodeoxyuridine-positive cells after serum starvation (P < 0.01), resistance to apoptosis induction by actinomycin D treatment (P < 0.05), and invasion potential (P < 0.01) than the control cells. These findings indicate that Skp2 expression can modulate the malignant phenotype of gastric carcinoma, possibly via p27 proteolysis. Skp2 can play an important role in gastric carcinoma progression and would be a novel target for the treatment of gastric carcinoma as well as a strong prognostic marker.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 Biological Significance of Skp2...
 DISCUSSION
 REFERENCES
 
Dysregulation of the cell cycle is required for the formation of most malignant tumors. The importance of G1-S progression in the formation of malignant tumors has been highlighted by the high incidence of aberrations in genes involved in this progression in a wide variety of tumors. Recently, the mechanisms that drive the cell from the G0-G1 phase into S-phase have been discovered. p27 is an inhibitor of the protein kinases cyclin-dependent kinase 2/cyclin E and cyclin-dependent kinase 2/cyclin A, which drive cells from the G1 to the S-phase of the cell division cycle (1 , 2) .

Many clinical studies have indicated that low levels of p27 are associated with high aggressiveness and poor prognosis in a large variety of malignant tumors (1 , 2) , including breast (3, 4, 5, 6) and colorectal (6 , 7) carcinomas. We reported previously that p27 expression status was an independent prognostic factor for patients with gastric carcinomas (8) . The major regulatory machinery of p27 protein levels is posttranslational ubiquitin-mediated proteolysis (9 , 10) . In malignant tumors, reduced p27 protein expression is usually not caused by changes of the gene encoding this protein (11) . Instead, increased degradation of p27 may be an important cause of the frequently observed loss of p27 in malignant tumors.

Recent studies have shown that one mechanism involved in p27 degradation is an SCF3 -type ubiquitin ligase complex (12 , 13) . Skp2 is a member of the F-box family of the specific substrate-recognition subunit of SCF ubiquitin-protein ligase complexes (14) . Expression of Skp2 was required for the ubiquitination and subsequent degradation of p27 in vitro (15, 16, 17) , and Skp2 knock-out cells show high levels of p27 and free cyclin E, polyploidy, and centrosome overduplication, as we reported previously (18) . Therefore, a decreased level of p27 expression in human malignant tumors may be caused by increased expression of Skp2, which targets p27 for degradation.

Recently, a line of evidence has indicated a possible relationship between Skp2 expression and the malignancy of tumors. Skp2 expression was shown to be greatly increased in malignantly transformed cells lines (14) including oral squamous cell carcinoma (19) and correlated directly with the grade of malignancy of lymphoma (20) and oral squamous cell carcinoma (19) . The level of p27 was reported to be inversely related to that of Skp2 in lymphoma (20) , oral squamous cell carcinoma (19 , 21) , and colorectal carcinoma (22) . Kudo et al. (21) reported that high Skp2 expression was correlated with poor prognosis in oral squamous cell carcinoma. Thus, Skp2 may have a great significance in human carcinogenesis. However, there have not been any studies regarding the clinical significance or the biological behavior of Skp2 expression in human gastric carcinomas.

We therefore investigated Skp2 expression in human gastric carcinomas, the significance of Skp2 expression, and the relationship between Skp2 and p27 in vivo. We then established Skp2 stably transfected human gastric carcinoma cell lines and examined the biological behavior of Skp2-transfected cells and the relationship between Skp2 and p27 expression in vitro.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 Biological Significance of Skp2...
 DISCUSSION
 REFERENCES
 
Clinical Samples.
Fresh surgical specimens were obtained from 98 patients with primary gastric carcinoma and their paired adjacent normal gastric mucosa after informed consent was obtained. The patients had undergone surgery at the Department of Molecular and Surgical Oncology, Medical Institute of Bioregulation, Kyushu University (Beppu, Japan) from 1993 to 2000. None of these patients received preoperative treatment such as radiation or chemotherapy. Data concerning patient outcome, including overall survival and development of metastasis, were available for all 98 patients, and the observation period ranged from 3 months to 77 months (the median follow-up period was 36.6 months). Of the 98 patients, 45 died of gastric carcinoma.

Cell Culture.
The human gastric cancer cell lines AZ-521, KATOIII, MKN7, MKN28, MKN45, NUGC3, and NUGC4 were obtained from Cell Resource Center for Biomedical Research Institute of Development, Aging and Cancer (Tohoku University, Sendai, Japan), and maintained in RPMI 1640 supplemented with 10% FBS at 37°C in a 5% humidified CO2 atmosphere.

Antibodies.
Mouse monoclonal antibodies to Skp2 and p27 were purchased from Zymed Laboratory (San Francisco, CA) and Transduction Laboratories (Lexington, KY), respectively. These antibodies were used for immunohistochemistry and Western blot analysis.

Total RNA Isolation.
Frozen tissue specimens or cultured cell lines in a state of subconfluency were homogenized, and the total RNA was extracted using the modified acid-guanidine-phenol-chloroform method as described previously (23) .

RT-PCR and Northern Blot Analysis.
The reverse transcriptase reaction was performed as described previously (23) . PCR amplification was performed by 24 cycles of incubation at 94°C for 1 min, at 54°C for 1 min, and at 72°C for 1 min. The following primers were used (all 5' to 3' direction): Skp2 sense primer, GCTGCTAAAGGTCTCTGGTGT, and antisense primer AGGCTTAGATTCTGCAACTTG; and GAPDH sense primer GTCAACGGATTTGGTCTGTATT and antisense primer AGTCTTCTGGGTGGCAGTGAT.

Northern blot analysis was performed as described previously (24) . In brief, total RNA was electrophoresed in 1.0% formaldehyde-agarose gels, transferred to Hybond N nylon filters (Amersham, Tokyo, Japan), and then hybridized with randomly primed {alpha}-32P-labeled cDNA probes for Skp2. Filters were exposed to autoradiography for 2 h, and the mRNA levels were quantitated using a Bio-Image analyzer BAS 2500 (Fuji Film, Inc., Tokyo, Japan).

Immunohistochemistry.
Immunohistochemical studies of Skp2 and p27 in 32 gastric carcinoma cases were performed using the avidin-biotin-peroxidase method (LSAB kit; DAKO, Kyoto, Japan) on formalin-fixed, paraffin-embedded tissues as described previously (5) . All sections were counterstained with hematoxylin. The primary monoclonal antibodies against Skp2 and p27 were used at dilutions of 1:500 and 1:1000, respectively.

p27 scores were determined by observing 1000 cancer cells in at least five high-power fields and were classified as high (staining in >50% of cells) or low (staining in <=50% of cells) as described previously (8) . The scoring was independently determined by two observers (T-a. M. and Y. Y).

Western Blot Analysis.
Total protein was extracted from samples with RIPA buffer. Aliquots of total protein were applied to 10% acrylamide gradient gels. After electrophoresis, samples were electroblotted onto a polyvinylidene membrane (Immobilon; Millipore, Inc., Bedford, MA) at 0.5 A for 40 min at 4°C. Skp2 and p27 were detected using the mouse monoclonal antibodies at a dilution of 1:2000 and 1:2500, respectively. The blots were developed with horseradish peroxidase-linked antimouse immunoglobulin (Promega, Inc., Madison. WI). Signals were detected using Supersignal (Pierce, Inc., Rockford, IL).

Transfection Assays and Establishment of Stable Skp2-transfected Gastric Carcinoma Cell Lines.
Human Skp2 cDNA was generated by RT-PCR and subcloned into pcDNA3.1+ expression vector (Invitrogen, Carlsbad. CA) as described previously (18) and then transfected into the cell lines by the Lipofectamine method (Life Technologies, Inc., Tokyo, Japan) as described previously (25) . Then, three stably transfected clones expressing abundant Skp2 protein were selected after G418 (800 µg/ml) treatment and used for the subsequent experiments. A mock vector-transfected clone of each cell line was used for the control.

In Vitro Proliferation Assay.
Skp2-transfected cells and mock-transfected cells were plated at a density of 1.0 x 105 cells/well in three 6-cm plates and were harvested and counted on days 3, 7, and 10. The medium was changed every 72 h. This experiment was repeated three times.

Cell Cycle Analysis.
Skp2-transfected cells and mock-transfected cells (2.0 x 106) were preincubated for 72 h in serum-free medium at 37°C and then were kept in medium with serum (10% FBS) for 18 h at 37°C. The cells were harvested and fixed in 70% ethanol at -20°C. Then, the cells were washed and resuspended in PI staining buffer (5 µg/ml PI and 0.25 mg/ml RNase) in PBS. DNA content was evaluated using an EPICS XL flow cytometer (Beckman Coulter Corp., Tokyo, Japan).

Measurement of BrdUrd uptake was performed as described previously (26) . Briefly, after Skp2-transfected cells and mock-transfected cells (2.0 x 106/plate) were incubated for 72 h in serum-free medium at 37°C and 18 h after addition of 10% FBS at 37°C, BrdUrd was added to the culture medium (10 µM), and the cultures were incubated for 30 min at 37°C. The cells were fixed in 70% ethanol at -20°C. To denature the DNA, the cells were incubated for 30 min at room temperature in 2 N HCl with 0.5% Triton X-100. After neutralization with 0.1 M sodium tetraborate (pH 8.5), the cells were incubated with anti-BrdUrd FITC (Becton Dickinson, San Jose, CA) for 30 min at room temperature and resuspended in 5 µg/ml PI. The cells were analyzed using an EPICS XL flow cytometer (Beckman Coulter Corp.). This experiment was repeated three times.

Analysis of Apoptotic Cells.
After treatment with 5 µg/ml actinomycin D for 24 h, cells were harvested with 0.05% trypsin, resuspended in binding buffer [10 mM HEPES/NaOH (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl2], and then incubated with FITC-conjugated Annexin V and 5 µg/ml PI (Annexin V-FITC kit; Bender Medsystems). The cells were then analyzed using EPICS XL flow cytometer (Beckman Coulter Corp.). Annexin V-positive and PI-positive cells were considered to be apoptotic. Nonstained actinomycin D-treated cells of Skp2 transfectants or mock transfectants were used as the negative controls, respectively. This experiment was repeated five times.

MTT Assay.
To quantify the viable cells under treatment with actinomycin D, MTT assay was performed (27) . Skp2-transfected cells and mock-transfected cells (1.0 x 104 cells/well) were seeded in 96-well plates in serum-containing medium and treated with 5 µg/ml actinomycin D for 24 h. MTT (Sigma Chemical Co., Tokyo, Japan) was added to each well (0.5 mg/ml). After incubation for 4 h at 37°C, 100 µl of n-propyl alcohol containing 0.1% NP40 and 4 mM HCl were added. The coloring reaction was quantitated using an automatic plate reader, Immuno-Mini NJ-2300 (Nihon InterMed, Tokyo, Japan), at 570 nm with a reference filter of 650 nm. MTT assays were carried out three times.

In Vitro Invasion Assay.
The invasive potential of Skp2-transfected cells was determined by a Matrigel invasion assay using polycarbonate membranes (8.0-µm pore size) in the upper chamber of 24-well Transwell culture chambers coated with Matrigel (Becton Dickinson, San Jose, CA). Skp2-transfected cells and mock-transfected cells (1.0 x 104 cells/well) were placed in the upper chamber, and the lower chamber was filled with 750 µl of RPMI 1640 with 10% FBS as a chemoattractant. After 48 h of incubation at 37°C, the membranes were stained with May-Grunwald and Giemsa solutions. The invasive cells that had migrated through the membrane to the lower surface were counted in three different fields under a light microscope at x200. Each experiment was performed in triplicate wells and repeated five times.

Immunofluorescence Detection.
Actin filaments were stained by fixing the cells in 4% paraformaldehyde followed by incubation with rhodamine-conjugated phalloidin (Molecular Probes, Eugene, OR). Actin filaments were detected using immunofluorescence microscopy.

Statistical Analysis.
Associations between the variables were tested by Student’s t test or Fisher’s exact test. Survival curves were drawn according to the Kaplan-Meier method, and the survival analysis was carried out by the Mantel-Cox test. All statistical differences were deemed significant at the level of P < 0.05. The histological type and staging of gastric carcinomas were classified on the basis of the criteria set by the Japanese Society for Cancer of the Stomach (28) .


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 Biological Significance of Skp2...
 DISCUSSION
 REFERENCES
 
Clinical Significance of Skp2 Expression in Gastric Carcinoma
Skp2 Expression in Gastric Carcinoma Tissues.
The gastric carcinoma tissue and normal mucosa showed variable levels of Skp2 mRNA signals by Northern blot analysis and RT-PCR (Fig. 1A)Citation . Northern blot analysis revealed that the expression of Skp2 mRNA was greater in carcinoma tissue than in normal mucosa in 21 of the 30 cases (70.0%; P < 0.05; Student’s t test). Immunohistochemical analysis revealed that Skp2 protein was predominantly expressed in the gastric carcinoma cells (Fig. 1B)Citation . We examined the Skp2 mRNA expression in several gastric carcinoma cell lines: AZ-521, KATOIII, MKN7, MKN28, MKN45, NUGC3, and NUGC4 with RT-PCR. All of them expressed Skp2 mRNA (data not shown).



View larger version (71K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Skp2 expression in human gastric carcinoma tissues and relationship between Skp2 and p27 expression. A, five representative cases of Northern blot (a) and RT-PCR (b) analysis for Skp2 in human gastric carcinomas. KATOIII, gastric carcinoma cell line; T, gastric carcinoma tissue; N, normal tissue; GAPDH, internal control. B, immunohistochemical staining of two consecutive sections of Skp2 and p27 in gastric carcinoma tissues with monoclonal antibody. a and b, Skp2 immunostaining and HE staining. c and d, strong Skp2 immunostaining and weak p27 immunostaining. e and f, weak Skp2 immunostaining and strong p27 immunostaining. a and b, x100; cf, x400.

 
Skp2 Expression Correlates Inversely with p27 Expression in Gastric Carcinoma.
To perform the quantitative analysis, we evaluated the expression of Skp2 mRNA in the tumor tissues (T) by normalization as follows: T = Skp2 (T)/GAPDH (T)/Skp2 of KATOIII/GAPDH of KATOIII as determined by Northern blot analysis. In this analysis, Ts ranged from 0 to 5.9 (median, 0.96). In practical evaluations, we set a cutoff value (T, 0.48) for these mRNA expression levels in tumor tissues, because the median level of Skp2 mRNA in the 30 normal tissues was 0.48 (normal mucosa, range 0–1.02). Using this cutoff value, we classified tumors into two groups: a high expression group (n = 65) and a low expression group (n = 33).

The relationship between Skp2 gene expression and p27 protein expression was examined in 32 cases of gastric carcinoma. Expression of p27 protein in tumor tissues was evaluated by immunohistochemistry with anti-p27 monoclonal antibody. Fourteen of 17 cases in the high Skp2 group were in the low p27 group, and 10 of 15 cases in the low Skp2 group were in the high p27 group (Table 1)Citation . This indicated that Skp2 mRNA expression was inversely correlated with p27 protein levels in gastric carcinoma (P < 0.01). In gastric carcinoma tissues, cells positive for Skp2 showed no or very low p27 protein and vice versa, implying that there was an inverse relationship between the expression profiles of Skp2 and p27 proteins (Fig. 1B)Citation .


View this table:
[in this window]
[in a new window]

 
Table 1 Relationship between Skp2 mRNA and p27 protein expression in gastric carcinomaa

 
The Prognostic Significance of Skp2 Gene Expression in Gastric Carcinoma.
As shown in Table 2Citation , a significant difference in histological type was found between the high Skp2 mRNA expression group and the low expression group (P < 0.01). On the other hand, no significant difference was seen regarding age, sex, depth of invasion, vascular or lymphatic involvement, or lymph node metastasis. With regard to prognosis, the high Skp2 mRNA expression group showed a significantly poorer prognosis than the low expression group (P = 0.018; Fig. 2Citation ). On multivariate analysis for prognosis, Skp2 mRNA expression, lymph node metastasis, lymphatic involvement, and depth of invasion, which were found to be prognostic factors on univariate analysis, were included for the parameters. This analysis demonstrated that Skp2 mRNA expression was not an independent factor (P = 0.06).


View this table:
[in this window]
[in a new window]

 
Table 2 Skp2 mRNA expression and clinicopathological factors in gastric carcinoma

 


View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Overall survival of patients with gastric carcinoma according to Skp2 mRNA expression in tumor tissues. High Skp2 mRNA expression group: T value >0.48 (n = 65). Low Skp2 mRNA expression group: T value <=0.48 (n = 33). P = 0.018; Mantel-Cox method.

 

    Biological Significance of Skp2 Expression in Gastric Carcinoma
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 Biological Significance of Skp2...
 DISCUSSION
 REFERENCES
 
Relationship between Skp2 and p27 Expression in Skp2-transfected Carcinoma Cells.
We examined the Skp2 mRNA expression in several gastric carcinoma cell lines: AZ521, KATOIII, MKN7, MKN28, MKN45, NUGC3, and NUGC4. RT-PCR analysis showed that AZ521 expressed the lowest level of Skp2 mRNA among these cell lines (data not shown). Therefore, we used the AZ521 cell line for the subsequent assays. Three stable Skp2-transfected clones were established, and their Skp2 expression was confirmed by both Northern and Western blot analysis. All three stable Skp2-transfected clones showed a lower level of expression of p27 protein than the controls (Fig. 3)Citation . Treatment with proteasome inhibitor (MG132) blocked p27 down-regulation in Skp2-transfected cells (data not shown).



View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Northern blot analysis (a) and Western blot analysis (b) of three Skp2 transfectants and the controls and the relationship between Skp2 and p27 expression in vitro.

 
High Proliferation Activity of Skp2-transfected Carcinoma Cells.
We analyzed whether Skp2 transfection altered the growth rate of gastric carcinoma cells. As shown in Fig. 4ACitation , there was a significant difference in growth rate between Skp2-transfected cells and the mock-transfected cells at 7 days (P < 0.05). Both the Skp2-transfected cells and mock-transfected cells reached confluency by 10 days. To investigate how the Skp2-transfected cells acquired their high proliferation ability, we analyzed the cell cycle after serum starvation and after refeeding with serum. (Fig. 4B)Citation . The percentage of BrdUrd-positive cells (cells in S-phase) in Skp2 transfectants was significantly higher than in the mock transfectant after serum starvation for 72 h (P < 0.01; Fig. 4CCitation ). However, 18 h after addition of serum, there was no significant difference between them (data not shown).



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Proliferation activity and cell cycle of Skp2-transfected cells. A, in vitro growth rate of Skp2-transfected cells in the presence of FBS. The cell number was counted on days 3, 7, and 10 in triplicate. The culture medium was changed every 72 h. Each experiment was performed three times; bars, SD. P < 0.05; Student’s t test. B, cell cycle of Skp2-transfected cells after 72 h of serum starvation and then 18 h after refeeding with 10% FBS. a, mock cells after 72 h serum starvation and then 18 h after refeeding. b, Skp2-transfected cells after 72 h of serum starvation and then 18 h after refeeding. c, mock and Skp2-transfected cells after 72 h of serum starvation. d, mock and Skp2-transfected cells 18 h after refeeding. C, the percentage of BrdUrd-positive cells in Skp2 transfectants after 72 h of serum starvation. Each experiment was performed three times. P < 0.01; Student’s t test.

 
Resistance to Apoptosis Induction by Actinomycin D in Skp2-transfected Carcinoma Cells.
To measure the susceptibility of Skp2-transfected cells to apoptosis-inducing conditions, we performed double staining of cells with Annexin V (FITC) and PI 24 h after the addition of actinomycin D (Fig. 5A)Citation . The percentage of Annexin V- or PI-positive cells was significantly lower in Skp2 transfectants than in the mock transfectants (P < 0.05 and P < 0.01, respectively; Fig. 5BCitation ). Furthermore, to measure the number of viable cells after subjecting the cells to apoptosis-inducing conditions, we performed MTT assays 24 h after the addition of actinomycin D. The percentage of viable cells was significantly higher in Skp2 transfectants than in the mock transfectants (P < 0.01; Fig. 5CCitation ). These results indicate that Skp2-transfected cells may acquire resistance to apoptosis induction.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Susceptibility of Skp2-transfected cells to apoptosis induction. A, apoptosis induction in Skp2-transfected cells by actinomycin D. Double staining of FITC-conjugated Annexin V (top) and PI (bottom) in Skp2 transfectants and mock transfectants after actinomycin D (5 µg/ml) treatment for 24 h. B, the percentage of apoptotic cells in Skp2-transfected and mock cells. Nonstained actinomycin D-treated cells of Skp2 transfectants or mock transfectants were used as the negative controls, respectively. This experiment was repeated five times. Annexin V: P < 0.05; PI: P < 0.01; both by Student’s t test. C, cell viability after actinomycin D treatment. MTT assay of Skp2-transfected cells and mock-transfected cells after actinomycin D (5 µg/ml) treatment for 24 h. Each experiment was performed three times. P < 0.01; Student’s t test.

 
High Invasion and Motility Potential of Skp2-transfected Carcinoma Cells.
We examined the invasion and motility potential of the Skp2-transfected cells using an in vitro Matrigel invasion assay (Fig. 6A)Citation . Skp2-transfected cells exhibited significantly more invasive potential than the mock-transfected cells (P < 0.01; Fig. 6BCitation ). To further investigate the motility potential of Skp2-transfected cells, we performed immunohistochemical staining of actin filaments and examined the reorganization of the actin cytoskeleton in Skp2 transfectants. Most Skp2-transfected cells formed "filopodia" (Fig. 6C)Citation . This indicates that gastric carcinoma cells may acquire high motility by Skp2 transfection.



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Invasion and motility potential of Skp2-transfected cells. A, invasion potential of Skp2-transfected cells. The invasive potential of Skp2-transfected cells was determined by an in vitro Matrigel invasion assay. Invaded cells were stained with May-Grunwald and Giemsa solutions. B, the number of the cells that had invaded on the lower side of the Matrigel. Each experiment was performed five times. P < 0.01; Student’s t test. C, actin filaments were stained with rhodamine-conjugated phalloidin and detected using immunofluorescence microscopy.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 Biological Significance of Skp2...
 DISCUSSION
 REFERENCES
 
In this report, we demonstrated that Skp2 was overexpressed in gastric carcinoma cells, and Skp2 expression was inversely correlated with p27 protein levels in gastric carcinoma, and furthermore, high Skp2 mRNA expression was significantly correlated with poor prognosis in gastric carcinoma. These findings are consistent with observations in other organs reported previously (14 , 19 , 20 , 21 , 22) . We consider it likely that Skp2 is related to degradation of p27 in vivo and could be a potential prognostic factor for gastric carcinoma. Unexpectedly, a significant difference in histological type was found between the high Skp2 mRNA expression group and the low expression group. The prognostic significance of Skp2 mRNA expression is considered to be independent of the histological type, because histological type was not a prognostic factor on univariate analysis. Additional studies will be required to clarify the relation of Skp2 expression to cell differentiation.

Our next experiments using Skp2 transfectants showed that Skp2 transfectants with high Skp2 levels expressed low levels of p27 protein, and that a high level of proliferation activity, resistance to apoptosis, and invasion potential of gastric carcinoma cells were elicited by Skp2 transfection. These results indicated that Skp2 overexpression could modulate the malignant phenotype of gastric carcinoma, possibly by regulating the p27 protein level.

The relationship of p27 expression to cell proliferation and to susceptibility to apoptosis was reported elsewhere. p27 knock-out cells acquired high proliferation activity (29 , 30) , as we also reported previously (31) , and antisense inhibition of p27 prevented cell cycle arrest in response to mitogen depletion (32) . Overexpression of p27 was reported to trigger apoptosis in carcinoma cells (33) . These findings are consistent with the results of our Skp2 transfection studies. Taking into consideration our results of the inverse correlation between Skp2 and p27 and the reports above, the promotion of proliferation activity and resistance to apoptosis by Skp2 transfection may be attributable to p27 degradation by Skp2 overexpression.

The relationship between p27 expression and invasion or motility potential remains unknown, although many clinical studies have indicated that low p27 expression was correlated with the depth of tumor invasion (1 , 2) , as we also reported previously (8) . The promotion of invasion or motility by Skp2 transfection might be attributable to a different cause from p27 degradation by Skp2 overexpression. To study the molecular mechanism of the promotion of invasion by Skp2 transfection, we performed cDNA microarray assays using Human Cancer Chip Version 2.1 (TaKaRa Biochemicals, Tokyo, Japan) and identified the carcinoma-related genes whose expression level was altered by Skp2 transfection (data not shown). uPA and MMP have been demonstrated recently to be strongly involved in carcinoma invasion and metastasis by degrading the extracellular components (34, 35, 36) , as we also reported previously (37, 38, 39, 40) . We expected that the promotion of invasion potential of Skp2-transfected cells might be attributable to induction of production of uPA or MMP by Skp2 transfection. Unexpectedly, neither uPA nor MMP was up-regulated in Skp2-transfected cells (data not shown). In our assays of immunohistochemical staining of actin filaments, Skp2-transfected cells formed "filopodia." The actin cytoskeleton was reported to be regulated by Rho family GTPases (Rho, Rac, and Cdc42) and to play an important role in cell locomotion via the extension of pseudopods, for example "filopodia" (41) . Cdc42 participates in "filopodia" formation (42) . Therefore, we considered that the promotion of invasion potential might be attributable to the promotion of motility mediated by Skp2. Skp2 expression might have influence on Rho family GTPases, especially Cdc42 activity. We are proceeding to elucidate the roles of the genes identified with the cDNA microarray assay in the modulation of the malignant phenotype of gastric carcinoma.

Recent studies suggested the role of Skp2 expression in malignant transformation. Forced expression of Skp2 in quiescent fibroblasts induced DNA synthesis (16) . Skp2 cooperated with N-Ras in tumorigenesis in an in vivo model (20) . Rodent fibroblasts primarily transformed by both Skp2 and H-Ras gene transfection could form colonies in soft agar and also tumors in nude mice (19) . Cotransfection of Skp2 and cyclin E promoted abundant hepatocyte replication and hyperplasia of the liver in vivo (43) . In our results, Skp2 overexpression modulated the malignant phenotype of the AZ521 gastric carcinoma cell line. These findings indicate that overexpression of Skp2 alone could not malignantly transform normal cells but could modulate the malignant phenotype of malignant tumors.

Recently, Mamillapalli et al. (44) reported that PTEN, a tumor suppressor, regulated the ubiquitin-dependent degradation of p27 through the ubiquitin ligase SCFSkp2. Cantley and Neel (45) showed that PTEN negatively controls the phosphoinositide 3-kinase signaling pathway for regulation of cell growth and survival by dephosphorylating the 3 position of phosphoinositides. Skp2 may function as a critical component in the PTEN/phosphatidylinositol 3-kinase pathway for the regulation of SCFSkp2 and cell proliferation. Studies that clarify the oncogenic pathway leading to increased Skp2 expression and the consequences thereof will identify important targets for development of anticancer therapy.

In conclusion, we showed here that Skp2 gene overexpression could be a prognostic factor for gastric carcinoma and that Skp2 expression was correlated inversely with p27 expression in gastric carcinoma. Furthermore, we clarified that Skp2 expression could modulate the malignant phenotype of gastric carcinoma, possibly via p27 proteolysis. These findings strongly suggest that Skp2 could play an important role in gastric carcinoma progression and would be a novel molecular target for the treatment of gastric carcinoma.


    ACKNOWLEDGMENTS
 
We thank Dr. T. Utsunomiya, F. Tanaka, and H. Masuda for critical advice and T. Shimooka, K. Ogata, and J. Miyake for technical assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas of Cancer (12215116, 11671251, and 12218227) and a Grant-in-Aid for Scientific Research (B) (12557100 and 12470241) and (C) (12213101, 12671232, and 12670166). Back

2 To whom requests for reprints should be addressed, at Department of Molecular and Surgical Oncology, Medical Institute of Bioregulation, Kyushu University, Tsurumibaru 4546, Beppu 874-0838, Japan. Phone: 81-977-27-1650; Fax: 81-977-27-1651; E-mail: mmori{at}beppu.kyushu-u.ac.jp Back

3 The abbreviations used are: SCF, Skp1-Cullin-F-box protein; Skp, S-phase kinase-associated protein; FBS, fetal bovine serum; PI, propidium iodide; BrdUrd, bromodeoxyuridine; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; uPA, urokinase plasminogen activator; MMP, matrix metalloproteinase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. Back

Received 1/ 2/02. Accepted 5/ 1/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 Biological Significance of Skp2...
 DISCUSSION
 REFERENCES
 

  1. Philipp-Staheli J., Payne S. R., Kemp C. J. p27(Kip1): regulation and function of a haploinsufficient tumor suppressor and its misregulation in cancer. Exp. Cell Res., 264: 148-168, 2001.[Medline]
  2. Slingerland J., Pagano M. Regulation of the cdk inhibitor p27 and its deregulation in cancer. J. Cell. Physiol., 183: 10-17, 2000.[Medline]
  3. Tan P., Cady B., Wanner M., Worland P., Cukor B., Magi-Galluizz C., Lavin P., Draetta G., Pagano M., Loda M. The cell cycle inhibitor p27 is an independent prognostic marker in small (T1a, b) invasive breast carcinomas. Cancer Res., 57: 1259-1263, 1997.[Abstract/Free Full Text]
  4. Porter P. L., Malone K. E., Heagerty P. J., Alexander G. M., Gatti L. A., Firpo E. J., Daling J. R., Roberts J. M. Expression of cell-cycle regulators p27Kip1 and cyclin E, alone and in combination, correlate with survival in young breast cancer patients. Nat. Med., 3: 222-225, 1997.[Medline]
  5. Catzavelos C., Bhattacharya N., Ung Y. C., Wilson J. A., Roncari L., Sandhu C., Shaw P., Yeger H., Morava-Protzner I., Kapusta L., Franssen E., Pritchard K. I., Slingerland J. M. Decreased levels of the cell-cycle inhibitor p27Kip1 protein: prognostic implications in primary breast cancer. Nat. Med., 3: 227-230, 1997.[Medline]
  6. Fredersdorf S., Burns J., Milne A. M., Packham G., Fallis L., Gillett C. E., Royds J. A., Peston D., Hall P. A., Hanby A. M., Barnes D. M., Shousha S., O’Hare M. J., Lu X. High level expression of p27(kip1) and cyclin D1 in some human breast cancer cells: inverse correlation between the expression of p27(kip1) and degree of malignancy in human breast and colorectal cancers. Proc. Natl. Acad. Sci. USA, 94: 6380-6385, 1997.[Abstract/Free Full Text]
  7. Loda M., Cukor B., Tam S. W., Lavin P., Fiorentino M., Draetta G. F., Jessup J. M., Pagano M. Increased proteasome-dependent degradation of the cyclin-dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nat. Med., 3: 231-234, 1997.[Medline]
  8. Mori M., Mimori K., Shiraishi T., Tanaka S., Ueo H., Sugimachi K., Akiyoshi T. p27 expression and gastric carcinoma. Nat. Med., 3: 593 1997.[Medline]
  9. Hengst L., Reed S. I. Translational control of p27Kip1 accumulation during the cell cycle. Science (Wash. DC), 271: 1861-1864, 1996.[Abstract]
  10. Pagano M., Tam S. W., Theodoras A. M., Beer-Romero P., Del Sal G., Chau V., Yew P. R., Draetta G. F., Rolfe M. Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science (Wash. DC), 269: 682-685, 1995.[Abstract/Free Full Text]
  11. Fero M. L., Randel E., Gurley K. E., Roberts J. M., Kemp C. J. The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature (Lond.), 396: 177-180, 1998.[Medline]
  12. Nakayama K. I., Hatakeyama S., Nakayama K. Regulation of the cell cycle at the G1-S transition by proteolysis of cyclin E and p27Kip1. Biochem. Biophys. Res. Commun., 282: 853-860, 2001.[Medline]
  13. Schulman B. A., Carrano A. C., Jeffrey P. D., Bowen Z., Kinnucan E. R., Finnin M. S., Elledge S. J., Harper J. W., Pagano M., Pavletich N. P. Insights into SCF ubiquitin ligases from the structure of the Skp1-Skp2 complex. Nature (Lond.), 408: 381-386, 2000.[Medline]
  14. Zhang H., Kobayashi R., Galaktionov K., Beach D. p19Skp1 and p45Skp2 are essential elements of the cyclin A-CDK2 S phase kinase. Cell, 82: 915-925, 1995.[Medline]
  15. Carrano A. C., Eytan E., Hershko A., Pagano M. SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat. Cell Biol., 1: 193-199, 1999.[Medline]
  16. Sutterluty H., Chatelain E., Marti A., Wirbelauer C., Senften M., Muller U., Krek W. p45SKP2 promotes p27Kip1 degradation and induces S phase in quiescent cells. Nat. Cell Biol., 1: 207-214, 1999.[Medline]
  17. Tsvetkov L. M., Yeh K. H., Lee S. J., Sun H., Zhang H. p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr. Biol., 9: 661-664, 1999.[Medline]
  18. Nakayama K., Nagahama H., Minamishima Y. A., Matsumoto M., Nakamichi I., Kitagawa K., Shirane M., Tsunematsu R., Tsukiyama T., Ishida N., Kitagawa M., Hatakeyama S. Targeted disruption of Skp2 results in accumulation of cyclin E and p27(Kip1), polyploidy and centrosome overduplication. EMBO J., 19: 2069-2081, 2000.[Medline]
  19. Gstaiger M., Jordan R., Lim M., Catzavelos C., Mestan J., Slingerland J., Krek W. Skp2 is oncogenic and overexpressed in human cancers. Proc. Natl. Acad. Sci. USA, 98: 5043-5048, 2001.[Abstract/Free Full Text]
  20. Latres E., Chiarle R., Schulman B. A., Pavletich N. P., Pellicer A., Inghirami G., Pagano M. Role of the F-box protein Skp2 in lymphomagenesis. Proc. Natl. Acad. Sci. USA, 98: 2515-2520, 2001.[Abstract/Free Full Text]
  21. Kudo Y., Kitajima S., Sato S., Miyauchi M., Ogawa I., Takata T. High expression of S-phase kinase-interacting protein 2, human F-box protein, correlates with poor prognosis in oral squamous cell carcinomas. Cancer Res., 61: 7044-7047, 2001.[Abstract/Free Full Text]
  22. Hershko D., Bornstein G., Ben-Izhak O., Carrano A., Pagano M., Krausz M. M., Hershko A. Inverse relation between levels of p27(Kip1) and of its ubiquitin ligase subunit Skp2 in colorectal carcinomas. Cancer (Phila.), 91: 1745-1751, 2001.[Medline]
  23. Mori M., Staniunas R. J., Barnard G. F., Jessup J. M., Steele G. D., Jr, Chen L. B. The significance of carbonic anhydrase expression in human colorectal cancer. Gastroenterology, 105: 820-826, 1993.[Medline]
  24. Mori M., Mimori K., Shiraishi T., Haraguchi M., Ueo H., Barnard G. F., Akiyoshi T. Motility related protein 1 (MRP1/CD9) expression in colon cancer. Clin. Cancer Res., 4: 1507-1510, 1998.[Abstract]
  25. Shibata K., Tanaka S., Shiraishi T., Kitano S., Mori M. G-protein {gamma}7 is down-regulated in cancers and associated with p27kip1-induced growth arrest. Cancer Res., 59: 1096-1101, 1999.[Abstract/Free Full Text]
  26. Hara T., Kamura T., Nakayama K., Oshikawa K., Hatakeyama S. Degradation of p27(Kip1) at the G0-G1 transition mediated by a Skp2-independent ubiquitination pathway. J. Biol. Chem., 276: 48937-48943, 2001.[Abstract/Free Full Text]
  27. Vistica D. T., Skehan P., Scudiero D., Monks A., Pittman A., Boyd M. R. Tetrazolium-based assays for cellular viability: a critical examination of selected parameters affecting formazan production. Cancer Res., 51: 2515-2520, 1991.[Abstract/Free Full Text]
  28. Japanese Gastric Cancer Association. . Japanese Classification of Gastric Carcinoma, Ed. 13 Japanese Gastric Cancer Association Tokyo 1999.
  29. Fero M. L., Rivkin M., Tasch M., Porter P., Carow C. E., Firpo E., Polyak K., Tsai L. H., Broudy V., Perlmutter R. M., Kaushansky K., Roberts J. M. A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell, 85: 733-744, 1996.[Medline]
  30. Kiyokawa H., Kineman R. D., Manova-Todorova K. O., Soares V. C., Hoffman E. S., Ono M., Khanam D., Hayday A. C., Frohman L. A., Koff A. Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function of p27(Kip1). Cell, 85: 721-732, 1996.[Medline]
  31. Nakayama K., Ishida N., Shirane M., Inomata A., Inoue T., Shishido N., Horii I., Loh D. Y. Mice lacking p27(Kip1) display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell, 85: 707-720, 1996.[Medline]
  32. Coats S., Flanagan W. M., Nourse J., Roberts J. M. Requirement of p27Kip1 for restriction point control of the fibroblast cell cycle. Science (Wash. DC), 272: 877-880, 1996.[Abstract]
  33. Katayose Y., Kim M., Rakkar A. N., Li Z., Cowan K. H., Seth P. Promoting apoptosis: a novel activity associated with the cyclin- dependent kinase inhibitor p27. Cancer Res., 57: 5441-5445, 1997.[Abstract/Free Full Text]
  34. Liotta L. A., Tryggvason K., Garbisa S., Hart I., Foltz C. M., Shafie S. Metastatic potential correlates with enzymatic degradation of basement membrane collagen. Nature (Lond.), 284: 67-68, 1980.[Medline]
  35. Kim J., Yu W., Kovalski K., Ossowski L. Requirement for specific proteases in cancer cell intravasation as revealed by a novel semiquantitative PCR-based assay. Cell, 94: 353-362, 1998.[Medline]
  36. Ossowski L. Invasion of connective tissue by human carcinoma cell lines: requirement for urokinase, urokinase receptor, and interstitial collagenase. Cancer Res., 52: 6754-6760, 1992.[Abstract/Free Full Text]
  37. Mori M., Barnard G. F., Mimori K., Ueo H., Akiyoshi T., Sugimachi K. Overexpression of matrix metalloproteinase-7 mRNA in human colon carcinomas. Cancer (Phila.), 75: 1516-1519, 1995.[Medline]
  38. Yamashita K., Mori M., Kataoka A., Inoue H., Sugimachi K. The clinical significance of MMP-1 expression in oesophageal carcinoma. Br. J. Cancer, 84: 276-282, 2001.[Medline]
  39. Yamashita K., Mori M., Shiraishi T., Shibuta K., Sugimachi K. Clinical significance of matrix metalloproteinase-7 expression in esophageal carcinoma. Clin. Cancer Res., 6: 1169-1174, 2000.[Abstract/Free Full Text]
  40. Etoh T., Inoue H., Yoshikawa Y., Barnard G. F., Kitano S., Mori M. Increased expression of collagenase-3 (MMP-13) and MT1-MMP in oesophageal cancer is related to cancer aggressiveness. Gut, 47: 50-56, 2000.[Abstract/Free Full Text]
  41. Hall A. Rho GTPases and the actin cytoskeleton. Science (Wash. DC), 279: 509-514, 1998.[Abstract/Free Full Text]
  42. Kozma R., Ahmed S., Best A., Lim L. The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts. Mol. Cell. Biol., 15: 1942-1952, 1995.[Abstract]
  43. Nelsen C. J., Hansen L. K., Rickheim D. G., Chen C., Stanley M. W., Krek W., Albrecht J. H. Induction of hepatocyte proliferation and liver hyperplasia by the targeted expression of cyclin E and skp2. Oncogene, 20: 1825-1831, 2001.[Medline]
  44. Mamillapalli R., Gavrilova N., Mihaylova V. T., Tsvetkov L. M., Wu H., Zhang H., Sun H. PTEN regulates the ubiquitin-dependent degradation of the CDK inhibitor p27(KIP1) through the ubiquitin E3 ligase SCF(SKP2). Curr. Biol., 11: 263-267, 2001.[Medline]
  45. Cantley L. C., Neel B. G. New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc. Natl. Acad. Sci. USA, 96: 4240-4245, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
X.-C. Wang, Y.-P. Wu, B. Ye, D.-C. Lin, Y.-B. Feng, Z.-Q. Zhang, X. Xu, Y.-L. Han, Y. Cai, J.-T. Dong, et al.
Suppression of Anoikis by SKP2 Amplification and Overexpression Promotes Metastasis of Esophageal Squamous Cell Carcinoma
Mol. Cancer Res., January 1, 2009; 7(1): 12 - 22.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H.-C. Huang, T.-D. Way, C.-L. Lin, and J.-K. Lin
EGCG Stabilizes p27kip1 in E2-Stimulated MCF-7 Cells through Down-Regulation of the Skp2 Protein
Endocrinology, December 1, 2008; 149(12): 5972 - 5983.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Fujita, W. Liu, H. Doihara, and Y. Wan
Regulation of Skp2-p27 Axis by the Cdh1/Anaphase-Promoting Complex Pathway in Colorectal Tumorigenesis
Am. J. Pathol., July 1, 2008; 173(1): 217 - 228.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Fujita, W. Liu, H. Doihara, H. Date, and Y. Wan
Dissection of the APCCdh1-Skp2 Cascade in Breast Cancer
Clin. Cancer Res., April 1, 2008; 14(7): 1966 - 1975.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Hattori, T. Isobe, K. Abe, H. Kikuchi, K. Kitagawa, T. Oda, C. Uchida, and M. Kitagawa
Pirh2 Promotes Ubiquitin-Dependent Degradation of the Cyclin-Dependent Kinase Inhibitor p27Kip1
Cancer Res., November 15, 2007; 67(22): 10789 - 10795.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
L. Hong, Y. Zhao, Y. Han, W. Guo, H. Jin, T. Qiao, Z. Che, and D. Fan
Mechanisms of growth arrest by zinc ribbon domain-containing 1 in gastric cancer cells
Carcinogenesis, August 1, 2007; 28(8): 1622 - 1628.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. Itoh, A. Taketomi, S. Tanaka, N. Harimoto, Y.-i. Yamashita, S.-i. Aishima, T. Maeda, K. Shirabe, M. Shimada, and Y. Maehara
Role of Growth Factor Receptor Bound Protein 7 in Hepatocellular Carcinoma
Mol. Cancer Res., July 1, 2007; 5(7): 667 - 673.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
G. Chiappetta, C. De Marco, A. Quintiero, D. Califano, S. Gherardi, D. Malanga, M. Scrima, C. Montero-Conde, L. Cito, M. Monaco, et al.
Overexpression of the S-phase kinase-associated protein 2 in thyroid cancer
Endocr. Relat. Cancer, June 1, 2007; 14(2): 405 - 420.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Xu, M. Abbasian, P. Patel, K. Jensen-Pergakes, C. R. Lombardo, B. E. Cathers, W. Xie, F. Mercurio, M. Pagano, D. Giegel, et al.
Substrate Recognition and Ubiquitination of SCFSkp2/Cks1 Ubiquitin-Protein Isopeptide Ligase
J. Biol. Chem., May 25, 2007; 282(21): 15462 - 15470.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
H.-C. Chang, F.-R. Chang, Y.-C. Wang, M.-R. Pan, W.-C. Hung, and Y.-C. Wu
A bioactive withanolide Tubocapsanolide A inhibits proliferation of human lung cancer cells via repressing Skp2 expression
Mol. Cancer Ther., May 1, 2007; 6(5): 1572 - 1578.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Gao, K. Kitagawa, Y. Hiramatsu, H. Kikuchi, T. Isobe, M. Shimada, C. Uchida, T. Hattori, T. Oda, K. Nakayama, et al.
Up-regulation of GPR48 Induced by Down-regulation of p27Kip1 Enhances Carcinoma Cell Invasiveness and Metastasis
Cancer Res., December 15, 2006; 66(24): 11623 - 11631.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Sonoda, H. Inoue, K. Ogawa, T. Utsunomiya, T.-a. Masuda, and M. Mori
Significance of Skp2 Expression in Primary Breast Cancer
Clin. Cancer Res., February 15, 2006; 12(4): 1215 - 1220.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Matsunobu, K. Tanaka, T. Nakamura, F. Nakatani, R. Sakimura, M. Hanada, X. Li, T. Okada, Y. Oda, M. Tsuneyoshi, et al.
The Possible Role of EWS-Fli1 in Evasion of Senescence in Ewing Family Tumors
Cancer Res., January 15, 2006; 66(2): 803 - 811.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Kitajima, Y. Kudo, I. Ogawa, T. Bashir, M. Kitagawa, M. Miyauchi, M. Pagano, and T. Takata
Role of Cks1 Overexpression in Oral Squamous Cell Carcinomas: Cooperation with Skp2 in Promoting p27 Degradation
Am. J. Pathol., December 1, 2004; 165(6): 2147 - 2155.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Osoegawa, I. Yoshino, S. Tanaka, K. Sugio, T. Kameyama, M. Yamaguchi, and Y. Maehara
Regulation of p27 by S-Phase Kinase-Associated Protein 2 Is Associated With Aggressiveness in Non-Small-Cell Lung Cancer
J. Clin. Oncol., October 15, 2004; 22(20): 4165 - 4173.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. H. Min, J.-W. Cheong, M. H. Lee, J. Y. Kim, S. T. Lee, J. S. Hahn, and Y. W. Ko
Elevated S-Phase Kinase-Associated Protein 2 Protein Expression in Acute Myelogenous Leukemia: Its Association with Constitutive Phosphorylation of Phosphatase and Tensin Homologue Protein and Poor Prognosis
Clin. Cancer Res., August 1, 2004; 10(15): 5123 - 5130.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Yokoi, K. Yasui, M. Mori, T. Iizasa, T. Fujisawa, and J. Inazawa
Amplification and Overexpression of SKP2 Are Associated with Metastasis of Non-Small-Cell Lung Cancers to Lymph Nodes
Am. J. Pathol., July 1, 2004; 165(1): 175 - 180.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
H Eguchi, S Carpentier, S S Kim, and S F Moss
p27kip1 regulates the apoptotic response of gastric epithelial cells to Helicobacter pylori
Gut, June 1, 2004; 53(6): 797 - 804.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Itoh, T. Maeda, M. Shimada, S.-i. Aishima, K. Shirabe, S. Tanaka, and Y. Maehara
Role of Expression of Focal Adhesion Kinase in Progression of Hepatocellular Carcinoma
Clin. Cancer Res., April 15, 2004; 10(8): 2812 - 2817.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Q. Zhu, F. H. Blackhall, M. Pintilie, P. Iyengar, N. Liu, J. Ho, T. Chomiak, D. Lau, T. Winton, F. A. Shepherd, et al.
Skp2 Gene Copy Number Aberrations Are Common in Non-Small Cell Lung Carcinoma, and Its Overexpression in Tumors with ras Mutation Is a Poor Prognostic Marker
Clin. Cancer Res., March 15, 2004; 10(6): 1984 - 1991.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T.-a. Masuda, H. Inoue, K. Nishida, H. Sonoda, Y. Yoshikawa, Y. Kakeji, T. Utsunomiya, and M. Mori
Cyclin-Dependent Kinase 1 Gene Expression Is Associated with Poor Prognosis in Gastric Carcinoma
Clin. Cancer Res., November 15, 2003; 9(15): 5693 - 5698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Imaki, K. Nakayama, S. Delehouzee, H. Handa, M. Kitagawa, T. Kamura, and K. I. Nakayama
Cell Cycle-dependent Regulation of the Skp2 Promoter by GA-binding Protein
Cancer Res., August 1, 2003; 63(15): 4607 - 4613.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Eguchi, N. Herschenhous, N. Kuzushita, and S. F. Moss
Helicobacter pylori Increases Proteasome-mediated Degradation of p27kip1 in Gastric Epithelial Cells
Cancer Res., August 1, 2003; 63(15): 4739 - 4746.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E.-H. Shim, L. Johnson, H.-L. Noh, Y.-J. Kim, H. Sun, C. Zeiss, and H. Zhang
Expression of the F-Box Protein SKP2 Induces Hyperplasia, Dysplasia, and Low-Grade Carcinoma in the Mouse Prostate
Cancer Res., April 1, 2003; 63(7): 1583 - 1588.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masuda, T.-a.
Right arrow Articles by Mori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masuda, T.-a.
Right arrow Articles by Mori, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online