This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Calvo, A. Articles by Green, J. E. Search for Related Content PubMed PubMed Citation Articles by Calvo, A. Articles by Green, J. E.

Adenovirus-mediated Endostatin Delivery Results in Inhibition of Mammary Gland Tumor Growth in C3(1)/SV40 T-Antigen Transgenic Mice

Laboratory of Cell Regulation and Carcinogenesis [A. C., J. E. G.] and Surgery Branch [A. L. F., S. K. L.], National Cancer Institute, NIH, Bethesda, Maryland 20892

	ABSTRACT

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
We demonstrate the efficacy of systemic administration of a replication-defectiveadenovirus expressing endostatin (Ad-mEndo) administered during the preinvasive stage of mammary tumor development in C3(1)/T antigen transgenic mice. Mean serum levels of endostatin increased about 8-fold above that of controls and resulted in a significant decrease in tumor growth and an increase in survival. The inhibitory effect of endostatin occurred during or after the progression to invasive carcinoma. Reduced levels of vascular endothelial growth factor mRNA were found in association with high levels of endostatin. Our results demonstrate that the adenoviral induction of high levels of circulating endostatin significantly inhibits mammary tumor growth during the period when the "angiogenic switch" occurs.

	Introduction

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Tumor vascularization is a necessary process for the growth of solid tumors (1 , 2) . Tumor angiogenesis occurs as a consequence of enhanced expression of proangiogenic factors relative to antiangiogenic factors in the tumor microenvironment (2) . This transition has been designated the "angiogenic switch" (2) . A large variety of growth factors modulate tumor angiogenesis through endothelial cell proliferation, migration, and formation of new blood vessels (3) . The increased expression of the proangiogenic factor VEGF³ is often observed in association with the angiogenic switch (2 , 3) . Antiangiogenic therapy has emerged as a means to prevent angiogenesis in primary or metastatic tumors, leading to tumor regression and "dormancy" (2) . Endostatin and angiostatin have been identified as compounds with antiangiogenic properties that inhibit tumor growth (1 , 2 , 4 , 5) . Endostatin, a M_r 20,000 fragment derived from the COOH-terminal domain of collagen XVIII, has been tested in some animal models of cancer (1 , 4 , 6, 7, 8, 9, 10) . Despite its strong antiangiogenic properties, endostatin exhibits minimal detectable toxicity (1) .

Gene therapy approaches offer the ability to induce the expression of exogenous compounds, including antiangiogenic factors such as endostatin, to reduce or eliminate tumors (6, 7, 8, 9, 10) . However, such therapy has not been previously tested in transgenic animal models with intact immune systems where tumors develop spontaneously.

The C3(1)/Tag transgenic mouse model of mammary cancer has been shown to recapitulate several important histopathological and molecular alterations that occur in human breast cancer (11) . Lesion progression in this model follows a very predictable time course with low-grade MIN lesions developing at about 8 weeks of age, progressing to high-grade MIN (similar to human ductal carcinoma in situ) by 12–14 weeks of age, leading to invasive carcinomas at about 15–16 weeks of age (11) . The expression of Tag in this model results in the functional inactivation of the tumor suppressor genes Rb and p53, which is often lost or mutated in human breast cancer (11) . Alterations in the expression of cyclins and cyclin-dependent kinases in this model are similar to those reported for human breast cancer (11 , 12) .

We have demonstrated previously that the C3(1)/Tag is a suitable preclinical model for testing certain chemopreventive or therapeutic compounds, including recombinant endostatin (13) . In this study, we demonstrate that systemic adenoviral delivery of endostatin inhibits the angiogenic switch, delays mammary tumor onset, and decreases tumor burden in C3(1)/Tag mice with high levels of circulating endostatin.

	Materials and Methods

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Adenoviral Vector.
The adenoviral vector used in this study (Ad-mEndo) has been previously characterized and tested for its in vitro and in vivo efficacy (6) . Mouse endostatin cDNA was obtained by RT-PCR from liver extracts and inserted, together with the 18-amino acid E3/19K signal sequence, into the adenoviral shuttle plasmid pAdCMV.1. The resulting plasmid was recombined with 5 E1 A/B-deleted Ad and used to infect 293 cells. The virus was amplified in 293 cells and titered using a standard plaque-forming assay. Control virus was similarly produced lacking the endostatin cDNA.

Animals and Treatment Schedule.
All manipulations of mice were carried out in accordance with the guidelines of the Animal Care and Use Committee and with the procedure outlined in the guide for the Care and Use of Laboratory Animals (NIH Publication No. 86-23, 1985). Thirty-six heterozygous C3(1)/Tag transgenic females in the FVB/N background were randomly divided into three groups: (a) experimental group (n = 12), animals treated with adenovirus containing the endostatin gene (Ad-mEndo); (b) control group 1 (n = 12), animals injected with the empty adenoviral vector (Ad-emptyV); and (c) control group 2 (n = 12), animals injected with PBS.

Mice received tail vein injections of 10⁹ plaque-forming units of Ad-mEndo, Ad-emptyV, or PBS at 12 weeks of age and again at 13 weeks of age. Blood samples were taken from the saphenous vein 4 days after both injections to measure serum levels of circulating endostatin. Previous experiments have demonstrated that the expression peak for this adenoviral vector occurs 4 days after the i.v. injection (6) . Because repeated blood extractions can alter endostatin levels,⁴ serum samples were taken only on these particular days.

Five mice from each group were sacrificed at 14 weeks of age, and mammary glands, liver, and blood samples were taken for analyses. Body weight and tumor volume were measured weekly in the remaining animals as described previously (14) . Animals were euthanized when tumors reached 1.5 cm or when animals appeared sickly.

Evaluation of Endostatin Levels in Serum and Mammary Glands.
Mammary glands were homogenized in radioimmunoprecipitation assay buffer containing proteinase inhibitors (1x PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, and 10 µg/ml phenylmethylsulfonyl fluoride), maintained at 4°C for 45 min, and cleared by centrifugation. Protein concentration was measured using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA).

Endostatin levels in serum and mammary gland samples were determined by competitive enzyme immunoassay (EIA; Cytimmune Sciences, College Park, MD) according to the manufacturer’s instructions. All determinations were performed in duplicate wells using a Multiskan MCC/340 plate reader (Titertek, Huntsville, AL).

Histopathology and Quantification of Mammary Gland Alterations.
Mammary glands and liver were fixed immediately in fresh 4% paraformaldehyde overnight, embedded in paraffin, cut (4-µm thick), and stained with H&E. MIN lesions were quantified as described previously (15) . Five mice per experimental group were analyzed.

In Situ Hybridization.
The plasmid pBS-VEGF, kindly provided by Dr. D. Hanahan, was used to generate antisense and sense probes. ³⁵S-CTP-labeled probes were generated by run-off transcription with T3 or T7 polymerase. In situ hybridization was performed as described previously (16) . The developed slides were visualized in both bright field and dark field using a Zeis Axoplan microscope.

RNA Extraction and Quantitative Real-time RT-PCR.
Total RNA was extracted from frozen tissues using the RNeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol (RNase-free DNase set 50; Qiagen). The quality of the RNA was assessed by running aliquots on agarose gels. Six µg of RNA were reverse-transcribed into cDNA with the High Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA), as per the manufacturer’s protocol.

PCR primers for real-time RT-PCR of CD-31 (PECAM), VEGF₁₆₄, and 28S rRNA were designed using Vector NTI software. The specificity of each primer was checked by performing a BLAST search using the National Center for Biotechnology Information tools. The sequences of the primers were as follows (5'-3'): (a) VEGF₁₆₄ sense primer, ACAGGACAAAGCCAGAAAAACAC; (b) VEGF₁₆₄ antisense primer, GTTTAACTCAAGCTGCCTCGCCT; (c) CD-31 sense primer, GAGCCCAATCACGTTTCAGTTT; (d) CD-31 antisense primer, TCCTTCCTGCTTCTTGCTAGCT; (e) 28S rRNA sense primer, GGGTGGTAAACTCCATCTAA; and (f) 28S rRNA antisense primer, AGTTCTTTTCAACTTTCCCT.

To verify the specificity of each primer set, the melting temperature curves of the amplicons generated from the PCR reaction were analyzed. Gel analyses were performed as well to show single PCR products. Quantitative analysis of gene expression was done with the SYBR Green master mix kit (Applied Biosystems). A Bio-Rad I-Cycler IQ Real-time detection system was used for PCR amplification and analysis. The levels of CD-31 and VEGF₁₆₄ expression were normalized to that of 28S rRNA. Results were presented as relative units of expression with respect to 28S rRNA levels. Samples were analyzed in triplicates.

Statistical Analysis.
The two-sided Student’s t test was used to evaluate whether significant differences existed between the mean values of the groups analyzed. The Mann-Whitney test was used in the case of tumor volumes. The log-rank test was used to determine differences in survival curves. Pearson’s correlation was used to analyze whether serum endostatin levels correlated with tumor volume, survival, and expression levels of VEGF mRNA in the mammary glands.

	Results and Discussion

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Antiangiogenic therapy for cancer has received wide attention in recent years because of its potential effectiveness against multiple types of tumors (1 , 2 , 4 , 5) . Endostatin, a COOH-terminal fragment of collagen XVIII, has previously been shown to be one of the most effective antitumor compounds by inhibiting angiogenesis in a variety of cancers (1 , 2 , 4 , 5) . However, high doses of recombinant endostatin are required to achieve tumor regression when delivered by i.p. or s.c. injection (13) . This study is the first report to demonstrate inhibition of tumor development by adenoviral delivery of endostatin in a transgenic mouse model of cancer.

Although administration of either Ad-emptyV or Ad-mEndo did not result in weight loss or signs of distress, a mild liver toxicity was observed in both groups consisting of moderate hepatocytomegaly and inflammation. Therefore, toxicity was not due to endostatin, but to the adenoviral vector. These types of lesions have been described previously after the administration of adenoviral gene therapy vectors (17) .

An increase in VEGF expression is a common molecular event that occurs during the angiogenic switch (2 , 3) . The elevation of VEGF levels promotes migration, sprouting, and blood vessel formation within tumors, with a subsequent increase in vascularization (3) . We have demonstrated by in situ hybridization and by ELISA assay that the transition from MIN lesions to invasive carcinoma is accompanied by a significant increase in the levels of VEGF mRNA (Fig. 1) . Mammary glands from normal FVB/N female mice had a mean value of 82 ± 12.1 pg VEGF/mg total protein, which was not statistically different from the mean value of 93 ± 15 pg VEGF/mg total protein from transgenic mice with MIN lesions at 14 weeks of age. However, mammary glands from 18-week-old mice with invasive carcinomas had a mean value of 790 ± 100 pg VEGF/mg total protein, an almost 10-fold increase compared with the mice with MIN lesions. These results show that the transition from preinvasive to invasive carcinoma is accompanied in this model by an increase in VEGF mRNA and protein levels associated with the angiogenic switch.

View larger version (98K): [in this window] [in a new window]   Fig. 1. In situ localization of VEGF mRNA in mammary glands of C3(1)/Tag female mice. A, the bright-field image shows two types of mammary gland lesions: preinvasive (black arrow) and invasive (white arrowhead). B, the dark-field image shows a strong signal (the area included within the yellow line) with the antisense VEGF probe in the invasive lesions, whereas the preinvasive lesion has no signal. No signal was detected with the VEGF sense probe. x400.

View larger version (17K): [in this window] [in a new window]   Fig. 2. Serum levels of endostatin in control animals (injected with PBS or Ad-emptyV) or animals injected with Ad-mEndo. A, 4 days after the first injections, serum endostatin levels are significantly increased in Ad-mEndo-treated mice as compared with controls. B, at day 11, 4 days after the second injection, levels of endostatin in the Ad-mEndo-treated group are modestly higher than those in control mice.

When delivered by tail vein, adenovirus has a preferential tropism for hepatocytes (20) . We found no detectable endostatin levels in the mammary glands of mice treated with Ad-mEndo or controls. This result revealed that either mammary glands were not infected by the adenovirus or endostatin gene expression by the viral vector was not detectable in the mammary glands. Therefore, the inhibitory effect on tumor development appears to be due to the circulating levels of endostatin produced systemically. Tumor volume was significantly reduced in mice injected with Ad-mEndo, compared with controls (Fig. 3) . By 20–21 weeks of age, the mice treated with Ad-mEndo had an approximately 50% reduction in the average tumor burden, compared with the control animals. An inverse correlation between endostatin levels and tumor volume was found in the group of mice that received Ad-mEndo (Fig. 4A) . Animals with the highest levels of endostatin had the lowest tumor burden (Fig. 4A) . For instance, at week 21 of age, the average cumulative tumor volume for the three mice with the highest levels of endostatin was 493 ± 123 mm³ , whereas the average for mice with lower endostatin levels was 1020 ± 130 mm³ . Tumor multiplicity was not significantly different between the three groups in the study. Survival was increased in mice with the highest levels of endostatin. A statistically significant positive correlation (P = 0.04) was found between levels of endostatin and survival (Fig. 4B) in the group of mice treated with Ad-mEndo. Although tumor volume was reduced in endostatin-treated mice, all of the animals eventually had to be sacrificed due to the presence of large tumors. The extent of tumor reduction that we report in this study is similar to that described for adenoviral gene therapy in xenograft models (6, 7, 8, 9, 10) . Our previous study on tumor development in C3(1)/Tag mice using a 3-week course of recombinant endostatin resulted in an approximately 9-fold decrease in tumor burden at week 21 in treated mice compared with controls (13) . In the present work, levels of circulating endostatin were transiently increased in Ad-mEndo-treated mice for about 2 weeks. Other studies using adenoviral gene therapy have reported a similar duration of elevated endostatin levels (6, 7, 8 , 10) .

View larger version (18K): [in this window] [in a new window]   Fig. 3. Cumulative tumor volume in C3(1)/Tag mice treated with PBS, Ad-emptyV, or Ad-mEndo. Tumor volumes in Ad-mEndo-treated mice are decreased with respect to controls and reach statistical significance at 20 and 21 weeks of age (*, P < 0.05).

View larger version (21K): [in this window] [in a new window]   Fig. 4. Correlation between cumulative tumor volume, weeks of survival, VEGF mRNA levels, and serum endostatin levels in Ad-mEndo-treated mice. A, cumulative tumor volume shows an inverse correlation with endostatin levels, although this does not reach statistical significance (P = 0.08). B, survival of the animals is correlated positively with serum levels of endostatin (P = 0.04). C, real-time RT-PCR for VEGF mRNA in mammary glands of 14-week-old C3(1)/Tag mice after treatment. Levels of VEGF in mice treated with Ad-mEndo are significantly reduced with respect to those of PBS- or Ad-emptyV-treated controls (P < 0.05). D, correlation between VEGF mRNA levels and serum endostatin levels in 14-week-old mice treated with Ad-mEndo. An inverse correlation (r2 = 0.7) was found, although this did not reach statistical significance.

Our results demonstrate that elevation of systemic levels of endostatin is associated with a significant decrease in levels of the proangiogenic factor VEGF in the preinvasive mammary lesions. The reduction in VEGF levels likely contributes to the inhibition of the angiogenic switch, resulting in a delay in tumor angiogenesis and tumor growth. The elevation of endostatin levels, even for a relatively short period of time during the transition phase from MIN to invasive carcinoma, is able to significantly inhibit tumor growth but does not have a lasting effect. Although the effect of endostatin is transient due to the limitations of the adenoviral system used, it seems possible that sustained treatment with endostatin could significantly prolong the inhibition of tumor growth.

In conclusion, we have demonstrated that the systemic administration of an adenoviral vector expressing endostatin during the transition from preinvasive mammary lesions to invasive carcinomas significantly inhibits tumor growth in association with reduced VEGF mRNA levels. These results suggest that endostatin can retard the angiogenic switch in the C3(1)/Tag mammary gland lesions and inhibit tumor formation. Because the currently available adenoviral vectors are not able to maintain sustained levels of circulating endostatin, improved gene therapy delivery systems that provide prolonged production of endostatin may be quite useful in inhibiting human mammary tumor progression at the ductal carcinoma in situ stage, perhaps in combination with other modalities.

	ACKNOWLEDGMENTS

 
We thank Dr. Miriam Anver for critical histological analysis, Lisa Birely for excellent technical assistance, Vanessa Muniz-Medina for assistance with the real-time RT-PCR assays, and Quang Nguyen for assistance with statistical questions.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ A. C. is supported by a Fulbright-Ministerio de Educacion y Ciencia Fellowship at the NIH.

² To whom requests for reprints should be addressed, at Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute, NIH, Building 41, Room C629, 41 Library Drive, Bethesda, MD 20892. Phone: (301) 435-5193; Fax: (301) 496-8395; E-mail: jegreen{at}nih.gov

³ The abbreviations used are: VEGF, vascular endothelial growth factor; MIN, mammary intraepithelial neoplasia; RT-PCR, reverse transcription-PCR; Tag, T-antigen.

⁴ A. L. Feldman and S. K. Libutti, unpublished observations.

Received 2/ 1/02. Accepted 5/22/02.

	REFERENCES

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 

1. O’Reilly M. S., Boehm T., Shing Y., Fukai N., Vasios G., Lane W. S., Flynn E., Birkhead J. R., Olsen B. R., Folkman J. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell, 88: 277-285, 1997.[Medline]
2. Hanahan D., Christofori G., Naik P., Arbeit J. Transgenic mouse models of tumour angiogenesis: the angiogenic switch, its molecular controls, and prospects for preclinical therapeutic models. Eur. J. Cancer, 32: 2386-2393, 1996.
3. Ferrara N. Role of vascular endothelial growth factor in the regulation of angiogenesis. Kidney Int., 56: 794-814, 1999.[Medline]
4. Yoon S. S., Eto H., Lin C. M., Nakamura H., Pawlik T. M., Song S. U., Tanabe K. K. Mouse endostatin inhibits the formation of lung and liver metastases. Cancer Res., 59: 6251-6256, 1999.[Abstract/Free Full Text]
5. Bergers G., Javaherian K., Lo K. M., Folkman J., Hanahan D. Effects of angiogenesis inhibitors on multistage carcinogenesis in mice. Science (Wash. DC), 284: 808-812, 1999.[Abstract/Free Full Text]
6. Feldman A. L., Restifo N. P., Alexander H. R., Bartlett D. L., Hwu P., Seth P., Libutti S. K. Antiangiogenic gene therapy of cancer utilizing a recombinant adenovirus to elevate systemic endostatin levels in mice. Cancer Res., 60: 1503-1506, 2000.[Abstract/Free Full Text]
7. Chen C. T., Lin J., Li Q., Phipps S. S., Jakubczak J. L., Stewart D. A., Skripchenko Y., Forry-Schaudies S., Wood J., Schnell C., Hallenbeck P. L. Antiangiogenic gene therapy for cancer via systemic administration of adenoviral vectors expressing secretable endostatin. Hum. Gene Ther., 11: 1983-1996, 2000.[Medline]
8. Wen X. Y., Bai Y., Stewart A. K. Adenovirus-mediated human endostatin gene delivery demonstrates strain-specific antitumor activity and acute dose-dependent toxicity in mice. Hum. Gene Ther., 12: 347-358, 2001.[Medline]
9. Sauter B. V., Martinet O., Zhang W. J., Mandeli J., Woo S. L. Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases. Proc. Natl. Acad. Sci. USA, 97: 4802-4807, 2000.[Abstract/Free Full Text]
10. Kuo C. J., Farnebo F., Yu E. Y., Christofferson R., Swearingen R. A., Carter R., Von Recum H. A., Yuan J., Kamihara J., Flynn E., D’Amato R., Folkman J., Mulligan R. C. Comparative evaluation of the antitumor activity of antiangiogenic proteins delivered by gene transfer. Proc. Natl. Acad. Sci. USA, 98: 4605-4610, 2001.[Abstract/Free Full Text]
11. Green J. E., Shibata M. A., Yoshidome K., Liu M. L., Jorcyk C., Anver M. R., Wigginton J., Wiltrout R., Shibata E., Kaczmarczyk S., Wang W., Liu Z. Y., Calvo A., Couldrey C. The C3(1)/SV40 T-antigen transgenic mouse model of mammary cancer: ductal epithelial cell targeting with multistage progression to carcinoma. Oncogene, 19: 1020-1027, 2000.[Medline]
12. Zafonte B. T., Hulit J., Amanatullah D. F., Albanese C., Wang C., Rosen E., Reutens A., Sparano J. A., Lisanti M. P., Pestell R. G. Cell-cycle dysregulation in breast cancer: breast cancer therapies targeting the cell cycle. Front. Biosci., 5: 938-961, 2000.
13. Yokoyama Y., Green J. E., Sukhatme V. P., Ramakrishnan S. Effect of endostatin on spontaneous tumorigenesis of mammary adenocarcinoma in a transgenic mouse model. Cancer Res., 60: 4362-4365, 2000.[Abstract/Free Full Text]
14. Fueyo J., Gomez-Manzano C., Yung W. K., Liu T. J., Alemany R., McDonnell T. J., Shi X., Rao J. S., Levin V. A., Kyritsis A. P. Overexpression of E2F-1 in glioma triggers apoptosis and suppresses tumor growth in vitro and in vivo. Nat. Med., 6: 685-690, 1998.
15. Shibata M. A., Liu M. L., Knudson M. C., Shibata E., Yoshidome K., Bandey T., Korsmeyer S. J., Green J. E. Haploid loss of bax leads to accelerated mammary tumor development in C3(1)/SV40-TAg transgenic mice: reduction in protective apoptotic response at the preneoplastic stage. EMBO J., 18: 2692-2701, 1999.[Medline]
16. Fox C. H., Cottler-Fox M. In situ hybridization in HIV research. Microsc. Res. Tech., 25: 78-84, 1993.[Medline]
17. Reynolds P. N., Holmes M. D., Adachi Y., Kaliberova L., Curiel D. T. A novel system for mitigation of ectopic transgene expression induced by adenoviral vectors. Gene Ther., 8: 1271-1275, 2001.[Medline]
18. Burgert H. G., Blusch J. H. Immunomodulatory functions encoded by the E3 transcription unit of adenoviruses. Virus Genes, 21: 13-25, 2000.[Medline]
19. Schuppans D., Cramer T., Bauer M., Strefeld T., Hahn E. G., Herbst H. Hepatocytes as a source of collagen type XVIII endostatin. Lancet, 352: 879-880, 1998.[Medline]
20. Lozier J. N., Csako G., Mondoro T. H., Krizek D. M., Metzger M. E., Costello R., Vostal J. G., Rick M. E., Donahue R. E., Morgan R. A. Toxicity of a first-generation adenoviral vector in rhesus macaques. Decreased expression of gene therapy in relation to multiple infections and tropism for the liver. Hum. Gene Ther., 13: 113-124, 2002.[Medline]

This article has been cited by other articles:

				X. Li, S. P. Raikwar, Y.-H. Liu, S.-J. Lee, Y.-P. Zhang, S. Zhang, L. Cheng, S.-D. Lee, B. E. Juliar, T. A. Gardner, et al. Combination therapy of androgen-independent prostate cancer using a prostate restricted replicative adenovirus and a replication-defective adenovirus encoding human endostatin-angiostatin fusion gene. Mol. Cancer Ther., March 1, 2006; 5(3): 676 - 684. [Abstract] [Full Text] [PDF]

				L Li, Y-Z Yuan, J Lu, L Xia, Y Zhu, Y-P Zhang, and M-M Qiao Treatment of pancreatic carcinoma by adenoviral mediated gene transfer of vasostatin in mice Gut, February 1, 2006; 55(2): 259 - 265. [Abstract] [Full Text] [PDF]

				R. Liu, S. Varghese, and S. D. Rabkin Oncolytic Herpes Simplex Virus Vector Therapy of Breast Cancer in C3(1)/SV40 T-antigen Transgenic Mice Cancer Res., February 15, 2005; 65(4): 1532 - 1540. [Abstract] [Full Text] [PDF]

				C. M. Mazzanti, A. Tandle, D. Lorang, N. Costouros, D. Roberts, G. Bevilacqua, and S. K. Libutti Early Genetic Mechanisms Underlying the Inhibitory Effects of Endostatin and Fumagillin on Human Endothelial Cells Genome Res., August 1, 2004; 14(8): 1585 - 1593. [Abstract] [Full Text] [PDF]

				Q. Zhang, M. Nie, J. Sham, C. Su, H. Xue, D. Chua, W. Wang, Z. Cui, Y. Liu, C. Liu, et al. Effective Gene-Viral Therapy for Telomerase-Positive Cancers by Selective Replicative-Competent Adenovirus Combining with Endostatin Gene Cancer Res., August 1, 2004; 64(15): 5390 - 5397. [Abstract] [Full Text] [PDF]

				C. Kavanaugh and J. E. Green The Use of Genetically Altered Mice for Breast Cancer Prevention Studies J. Nutr., July 1, 2003; 133(7): 2404S - 2409. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Calvo, A. Articles by Green, J. E. Search for Related Content PubMed PubMed Citation Articles by Calvo, A. Articles by Green, J. E.