Cancer Research Annual Meeting 2010  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harrison, C.
Right arrow Articles by Melton, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harrison, C.
Right arrow Articles by Melton, D. W.
[Cancer Research 62, 4065-4074, July 15, 2002]
© 2002 American Association for Cancer Research


Molecular Biology and Genetics

Replication Failure, Genome Instability, and Increased Cancer Susceptibility in Mice with a Point Mutation in the DNA Ligase I Gene1

Caroline Harrison, Ann-Marie Ketchen, Nicola J. Redhead, Maureen J. O’Sullivan and David W. Melton2

Sir Alastair Currie Cancer Research UK Laboratories and Department of Pathology, University of Edinburgh, Edinburgh EH4 2XU, Scotland, United Kingdom


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA ligase I has a key role in DNA replication in the joining together of short replication intermediates.We used gene targeting to introduce a point mutation into themouse DNA ligase I gene that was present in a human cancer patient with immunodeficiency and a cellular accumulation of DNA replication intermediates. Mutant mice grew more slowly and showed hematopoietic defects at critical stages at which the demands for DNA replication were highest. In the spleen and thymus of mutant mice, the accumulation of a sub-G1, but nonapoptotic, population was observed that we believe may represent cells with single-strand DNA breaks. In mutant bone marrow, occasional DNA replication failure was observed. The level of genome instability was significantly elevated in the spleens of DNA ligase I mutant mice and, because we have found no evidence for any DNA repair defect associated with DNA ligase I deficiency, we believe that this may result directly from the accumulation of replication intermediates. Mutant mice showed an increased incidence of spontaneous cancers with a diverse range of epithelial tumors, particularly cutaneous adnexal tumors that are rare in mice. The origin of the tumors from generalized genome instability, rather than the inactivation of one key control gene, should make DNA ligase I mutant mice a useful model to investigate the relationship between genome instability and cancer in humans.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
There are a number of inherited disorders that are associated with defects in DNA metabolism or DNA repair and that result in chromosome instability and cancer predisposition (reviewed in Ref. 1 ). The paradigm for genome instability disorders is BS,3 in which there is immunodeficiency, predisposition to a range of cancers, a very high level of sister chromatid exchange, increased mutation and somatic recombination rate, and increased sensitivity to a range of DNA-damaging agents (2) . BS is attributable to mutations in the BLM (gene defective in BS) helicase gene (3) .

Mutations in the DNA ligase I gene have been identified in a patient with similar growth retardation, immunodeficiency and photosensitivity as found in BS (4) . A Glu-566 to Lys mutation at the active site inactivated one allele, whereas an Arg-771 to Trp mutation on the second allele resulted in 20-fold reduced enzyme activity (5) . The 46BR cell line, isolated from this patient, showed increased sensitivity to DNA-damaging agents, delayed joining of Okazaki fragments, and elevated sister chromatid exchange, but not to the level seen in BS (6, 7, 8, 9) .

DNA ligase I is involved at the replication fork in the joining of Okazaki fragments during lagging strand DNA replication (10) and is considered the main replicative ligase. A correlation between DNA ligase I enzyme activity and the rate of cell proliferation supports this observation (11) . DNA ligase I has also been implicated in NER (12 , 13) and acts in the long-patch form of base excision repair (reviewed in Ref. 14 ). DNA ligase I has been reported to be an essential gene for mammalian cells growing in vitro (15) .

We knocked out the mouse Lig1 gene to study the function of DNA ligase I and as the first stage in the production of a mouse model for the 46BR patient (16) . As expected, the DNA ligase I mutation was an embryonic lethal, but mutant embryos developed much further than anticipated; they were indistinguishable from their siblings at embryonic development day 10.5 but then became progressively more anemic and died by embryonic development day 16.5. From embryonic development day 11.5 onwards, the liver takes over from the yolk sac as the major site of hematopoiesis. Mutant embryos failed to make this transition, with livers from mutant embryos lacking erythropoietic islands, leading to a severe deficiency of mature enucleate erythrocytes in the circulation. We found that hematopoietic progenitors were present in mutant fetal liver and that they were able to repopulate the hematopoietic system and rescue lethally irradiated recipients, which showed that there was not a qualitative hematopoietic block in Lig1 null cells, but rather that there was a quantitative impediment. We think that other tissues can compensate for the lack of DNA ligase I, presumably through the action of another ligase, but that this compensation fails under the high replicative pressure of fetal erythropoiesis, leading to reduced proliferation, anemia, and death. Using Lig1 null fibroblast cell lines, we found no evidence of any DNA repair deficit associated with DNA ligase I deficiency, but there was a delayed joining of DNA replication intermediates and decreased genome stability (17) . Our work contradicts the suggestion (15) that Lig1 is essential for cell viability.

We have now carried out a further round of gene targeting to introduce the Arg-771-to-Trp mutation found in the 46BR patient into the mouse Lig1 gene. In this report, we describe the production of mice homozygous for the 46BR mutation and use the animals to study the relationship between DNA replication failure, genome instability, and cancer susceptibility.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Production of Mice with the 46BR (Arg-771-to-Trp) Point Mutation in the Lig1 Gene.
The 46BR-targeting vector consisted of the 13.5-kb EcoRI fragment containing exons 22–27 of the Lig1 gene, with the Arg-771 (CGG)-to-Trp (TGG) point mutation introduced into exon 23, cloned into the EcoRI site of pUC8. This is the same fragment used previously to make the Lig1 knockout vectors (16 , 17) . The point mutation was introduced in a PCR reaction for exon 23, using primers G3506 and G3507 and carried out on the cloned Lig1 gene fragment. Primer sequences were obtained from the mouse Lig1 cDNA sequence (Ref. 18 ; GenBank accession no. U19604) as follows: G3506, Forward, TTGGTGCCTACCTGGGCCGGGGGAAGTGGGCTGGCCGG (a BanI restriction site is underlined and the CGG-to-TGG point mutation is shown in bold and underlined); G3507, Reverse, CTTGCATATAGCCTGAAGGCTCTTC (an XmnI restriction site is underlined). The 101-bp PCR product containing the 46BR mutation was restricted at the naturally occurring BanI and XmnI sites within exon 23 and cloned, via a series of intermediate steps, into the 13.5-kb EcoRI fragment in place of the wild-type sequence. The presence of the 46BR mutation and the lack of additional alterations in the exons (exons 22–27) present in the 46BR targeting vector was confirmed by DNA sequencing.

Two hundred µg of 46BR targeting vector DNA was restricted with EcoRI and electroporated as described (19) into 3 x 107 HM-1 ES cells heterozygous for the Lig1-(no.12) knockout allele (17) . Selection in 6-thioguanine was carried out as described previously (20) , and resistant clones were picked and screened for the 46BR mutation. This was achieved by AciI restriction of a PCR product for exon 23 with primers M5175, Forward, CGCGGATCCGCTGAAGAAGGACTACCTTGA (located at the 5' end of exon 23 with an additional synthetic BamHI restriction site underlined) and M5176, Reverse, CCGGAATTCCGGCTTGCATATAGCCTGAAGCTCTTC (located at the 3' end of exon 23 with an additional synthetic EcoRI restriction site underlined). PCR was carried out as described (21) , in 35 cycles with cycle conditions as follows: 94°C for 1 min, 63°C for 30 s, and 72°C for 30 s.

Clones heterozygous for the 46BR mutation were used for blastocyst injection and germ-line transmission was obtained as described (19) . Germ-line chimeras were outbred with BALB/c and resulting 46BR homozygous lines and a wild-type control line were all maintained on a segregating 129/OlaXBALB/c background. Primary fibroblasts were isolated from mouse embryos on embryonic development days 10.5–13.5 and cultured as described previously (22) .

Hematopoietic Cell Culture.
Single-cell suspensions were obtained from bone marrow, spleen, and thymus by passing tissue progressively through finer needles down to 25-gauge. Cells were plated at 106/ml in 60-mm dishes in RPMI, supplemented with 10% FCS, penicillin, and streptomycin. Proliferating spleenocyte cultures were also supplemented with lipopolysaccharides (25 µg/ml) and interleukin 4 (5 ng/ml). One h after plating, bone marrow and thymocyte cultures were irradiated through the medium with UV (254 nm; 10 Jm-2 for bone marrow, 20 Jm-2 for thymocytes). Proliferating spleenocyte cultures were treated with hydrogen peroxide (600 µM) in medium at 37°C for 30 min before replating into growth medium.

Flow Cytometry.
Cell suspensions from hematopoietic tissues were prepared as described previously (16) , counted electronically (Beckman Coulter), and diluted to 107/ml in PBS. Cells (106) were stained with the desired fluorochrome-linked antibody and washed twice to remove unbound antibody; 25,000–50,000 cells were acquired using a Becton Dickinson FACScan, and the resulting data were analyzed using Lysis II software. The antisera used were obtained from various suppliers: from Caltag Ltd., antimouse IgM F(ab')2 PE-conjugated affinity-purified goat IgG, antimouse CD4 PE-conjugated rat monoclonal IgG2a (clone CT-CD4), antimouse CD8a FITC-conjugated rat monoclonal IgG2a (clone CT-CD8a), antimouse B220 PE-conjugated rat monoclonal IgG2a (clone RA3-6B2), and antimouse GR1 FITC-conjugated rat monoclonal IgG2b (clone RB6-8C5); from PharMingen, antimouse CD45 PE-conjugated rat monoclonal IgG2b (clone 30F 11.1), antimouse TCR{alpha}ß FITC-conjugated hamster monoclonal IgG (clone H57-597), and antimouse Ter-119 FITC-conjugated rat monoclonal IgG2b (clone Ter-119); and from Sigma-Aldrich Company Ltd., antimouse CD3 FITC-conjugated rat monoclonal IgG (clone 53–7.3).

Propidium iodide-stained nuclei (20,000) were assayed on a Coulter EPICS XL to determine DNA content as described previously (22) . Apoptotic cells were detected using the TACS Annexin V-FITC apoptosis detection kit using the manufacturer’s protocol (R&D Systems).

Detection of Micronuclei.
Single-cell suspensions prepared from spleen and thymus were washed twice in PBS and fixed in absolute ethanol at -20°C. Fixed cells were stained with 4,6-diamidino-2-phenylindole (10 µg/ml). Fifteen µl of fixed cell suspension (~106 cells/ml) were mounted on a slide, a coverslip added, and micronuclei were scored under a fluorescence microscope.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Production of Mice with the 46BR (Arg-771 to Trp) Point Mutation in the Lig1 Gene.
The double-replacement gene-targeting strategy that we have devised for use with the Hprt-deficient ES cell line, HM-1, and Hprt minigenes as selectable markers (20 , 23 , 24) was used to introduce the human 46BR point mutation (Arg-771 to Trp) into the mouse Lig1 gene. The starting point was HM-1 cells heterozygous for the Lig1-(no.12) knockout allele (17) . We have previously shown that the DWM110 Hprt minigene present in this knockout allele is stably expressed, resulting in a very low frequency of spontaneous resistance to 6-thioguanine (25) , which makes it ideal for the second step of double-replacement gene targeting.

The structures of the 3' end of the wild-type Lig1 allele, the knockout allele, the 46BR-targeting vector, and the 46BR allele are shown schematically in Fig. 1Citation . Homologous recombination between the knockout allele and the targeting vector will result in the incorporation of the 46BR mutation into the Lig1 locus, with selection for targeting events being provided by loss of the Hprt minigene and resistance to 6-thioguanine. Resistant clones were picked and 11 of the 38 that were screened contained the 46BR mutation. This was determined by AciI restriction of a PCR product for exon 23, the site of the 46BR mutation. The AciI recognition site (GCGG) coincides with the position of the 46BR mutation (GTGG) so that the Lig146BR allele is not cleaved. Seven clones were analyzed further by Southern blotting with a Lig1 cDNA probe (16) and found to be correctly targeted (data not shown). All of the clones had lost hybridizing restriction fragments diagnostic for the knockout allele and contained only fragments expected from the wild-type allele, with no evidence of randomly integrated vector sequences. The seven clones heterozygous for the 46BR mutation were used for blastocyst injection, and germ-line transmission was obtained from three. Founders were used to establish two independent lines homozygous for the 46BR mutation. The AciI polymorphism in exon 23 was used to genotype mice (see Fig. 1Citation ). Automated DNA sequencing of RT-PCR products was used as described previously (17) to confirm that the 46BR mutation was the only change present in the part of the Lig1 coding region (exons 22–27) involved in the gene-targeting manipulations.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Production of mice with the Arg-771-to-Trp (46BR) mutation in the Lig1 gene. A, double-replacement gene-targeting strategy. The structure of the 3' end of the wild-type and Lig1 knockout allele (Lig1-(no.12)) is shown schematically. Numbered open boxes, Lig1 exons. In the Lig1-(no.12) allele, exons 23–27 have been replaced by the DWM110 Hprt minigene. Numbered closed boxes, Hprt exons; stippled area, the Hprt promoter. The 46BR-targeting vector is based on a 13.5-kb EcoRI fragment containing the 3' end of the Lig1 gene with the Arg-771-to-Trp mutation in exon 23 (cross-hatched box). Selection in 6-thioguanine for the indicated homologous recombination event between the targeting vector and the Lig1 knockout allele yields the Lig146BR allele. B, detection of the 46BR allele in mice. A PCR reaction for exon 23 was carried out on tail biopsy DNA. The 175-bp product from the wild-type Lig1 allele is cut in half by restriction with AciI. The recognition site for AciI coincides with the position of the 46BR mutation so that the Lig146BR allele is not cleaved by AciI. Reactions on wild-type (+/+), heterozygous (+/46), and homozygous (46/46) samples are shown. The mobility of molecular size markers on the same gel is shown.

 
46BR Mice Grow More Slowly.
Mice homozygous for the 46BR mutation (46BR mice) developed normally and were overtly healthy. However, from 5 weeks of age, it became apparent that they were growing more slowly than wild-type animals. This applied to both sexes (see Fig. 2Citation for males) and a 20% difference in body weight opened up and was maintained for up to 6 months, by which time the weights of wild-type animals had plateaued. When older animals (350–500 days) were sampled, it was found that the weights of 46BR mice had reached wild-type levels. These data are consistent with the DNA ligation defect associated with the 46BR mutation delaying DNA replication and slowing growth.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. 46BR mice grow more slowly than wild-type controls. The relationship between body weight and age is shown for male wild-type ({bullet}) and 46BR ({circ}) mice. Mice (47 wild-type and 29 46BR animals) were weighed on 2–3 separate occasions to obtain the data shown. Each data point, the mean weight from two or more animals.

 
Normal Hematopoiesis in Older 46BR Mice.
The hematopoietic tissues of 6- and 10-month-old 46BR mice were compared with age-matched controls for evidence of any defect. Hematocrits from 46BR mice were within the normal range (42–50%), and the number of cells recovered from all of the hematopoietic tissues examined (peripheral blood, bone marrow, mesenteric and peripheral lymph nodes, spleen, and thymus) were reduced only proportionately to the smaller size of the 46BR mice compared with controls. FACScan with antibodies to all hematopoietic cell lineages was used: B220 (expressed on cells committed to the B lymphoid lineage); IgM and IgD (present on mature B lymphocytes which have undergone V(D)J recombination); CD4 and CD8 (present on thymocytes); TCR{alpha}ß (present on thymocytes with rearrangement of the TCR gene); CD3 (present on T cells and a subset of B cells); CD45 (present on nonerythroid hematopoietic cells; GR1 (present on granulocytes); and Ter-119 (present on erythroid cells). The staining profiles of 46BR mice were indistinguishable from wild-type controls (data not shown). We conclude that there is no evidence in older 46BR mice for the severe quantitative hematopoietic defect that we have seen in Lig1 null embryos (16) and in lethally irradiated mice rescued by Lig1 null fetal liver cells (17) .

Erythropoiesis Struggles to Meet Demand in Young 46BR Mice.
A very different picture emerged when the spleens of 3-week-old 46BR mice were examined. Spleens were 2.5-fold larger than in age-matched controls (46BR average spleen weight, 98 ± 15 mg; wild type, 39 ± 12 mg; n = 4 for each genotype) and this difference was highly significant (P = 0.0009 by Student’s t test; compare Fig. 3, A and BCitation ). Histology indicated that the increased size was caused by an expansion of the red pulp, with the hypercellularity resulting from massive extramedullary hematopoiesis (see Fig. 3DCitation ).



View larger version (92K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Abnormal erythropoiesis in young 46BR mice. A and C, H&E-stained sections of spleen from 3-week-old wild-type mouse; A, x1, showing normal architecture with distinct white (W) and red (R) pulp areas; C, x200, showing white and red pulp with occasional megakaryocytes (arrowhead) within the red pulp. B and D, H&E-stained sections of spleen from 3-week-old 46BR mouse; B, x1, showing preservation of white pulp, but expansion of the red pulp; D, x200, showing that the hypercellularity of the red pulp results from massive extramedullary hematopoiesis with a predominance, in this image, of immature precursors. Myeloid (arrow) and erythroid (small arrowhead) precursors are identified and megakaryocytes (large arrowhead) abound. E and F, fresh blood samples from 3-week-old wild-type (E) and 46BR mice (F) stained with new methylene blue. The higher frequency of immature reticulocytes containing RNA inclusions (arrows) in the 46BR sample is notable.

 
Flow cytometry of propidium iodide-stained nuclei revealed a very different cell cycle distribution in the spleens from 3-week-old 46BR littermates compared with controls. The frequency of S-phase cells was 2-fold higher in 46BR spleens (ages 19–23 days) compared with age-matched controls, and this difference was highly significant (see Table 1Citation ). This difference is illustrated in Fig. 4Citation for wild-type and 46BR littermates sampled on consecutive days. In the wild-type spleens, the frequency of S-phase cells varied from 4 to 9% (Fig. 4, A, C, and E)Citation . In the 18-day-old 46BR spleen, 25% of the cells were in S phase (Fig. 4B)Citation . This high frequency of S-phase cells was maintained in a 19-day-old littermate, but there was now also a prominent and discrete sub-G1 peak comprising 21% of the cells (Fig. 4D)Citation . This discrete sub-G1 peak was seen in 4% (3 of 73) of 46BR spleens examined but was not observed in wild-type spleens (0 of 45 examined). The explanation for this sub-G1 peak will be considered later. In the 20-day-old 46BR littermate, the frequency of S-phase cells was 16%, and no sub-G1 peak was apparent (Fig. 4F)Citation .


View this table:
[in this window]
[in a new window]

 
Table 1 The frequency of S-phase cells in tissues from wild-type and 46BR micea

 


View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Erythropoiesis is under stress in young 46BR mice. Panels show the frequency distribution of DNA content for propidium iodide-stained spleen cell nuclei obtained by flow cytometry from wild-type and 46BR littermates. For each panel, the bracketing used to estimate the percentage of the population with sub-G1 (bracket B), G1 (bracket C), S phase (bracket D), and G2 (bracket E) DNA contents is shown. A, 18-day-old wild type; G1 94%, S-phase 4%, G2 2%. B, 18-day-old 46BR; sub-G1 6%, G1 63%, S phase 25%, G2 6%. C, 19-day-old wild type; sub-G1 1%, G1 92%, S phase 5%, G2 2%. D, 19-day-old 46BR; sub-G1 21%, G1 49%, S phase 24%, G2 5%. E, 20-day-old wild type; sub-G1 1%, G1 87%, S phase 9%, G2 3%. F, 20-day-old 46BR; sub-G1 2%, G1 76%, S phase 16%, G2 6%. The increased frequency of S-phase cells in the 46BR samples is notable, as is the high level in the 19-day sample associated with a discrete sub-G1 peak. Cells (20,000) were assayed for each sample, and the results are displayed on the same frequency scale.

 
Blood samples taken from four individual 19- and 20-day 46BR mice did not reveal significantly lower hematocrits than age-matched controls (47% ± 6% for 46BR and 47% ± 2% for wild-type; P = 0.94 by Student’s t test; n = 4 for each genotype). However, the frequency of immature reticulocytes in the circulation was 2-fold elevated in the 46BR mice (17.5 ± 3% for 46BR and 8.2 ± 2% for wild type; P = 0.001; n = 4 for both genotypes). Reticulocytes are erythrocytes that have been released prematurely into the circulation. They are identified by the retention of ribosomal RNA, which can be stained by new methylene blue, and appears as a reticulated network, or as discrete clumps of reticulum. For ease of scoring, we counted as reticulocytes every red cell with any stained reticulum, even single small fragments. This contributes to the higher than expected value for reticulocytes obtained from wild-type mice (Fig. 3E)Citation . However, the reticulocyte frequency was significantly elevated in age-matched 46BR mice (Fig. 3F)Citation .

From 5 weeks of age, spleens from 46BR mice were no longer disproportionately large, and the cell cycle distributions in the majority of animals examined had returned to normal levels, with the frequency of S-phase cells not being significantly different from wild type (Table 1)Citation . Thus, erythropoiesis seems unable to meet the very high demand for red cells in young mice when other hematopoietic lineages are also being established, but the situation quickly resolves. These data are consistent with the ligation defect associated with the 46BR mutation affecting DNA replication and resemble, albeit in a less extreme way, the erythropoietic crisis observed in Lig1 null embryos (16) and lethally irradiated mice rescued by Lig1 null fetal liver cells (17) .

Occasional DNA Replication Failure in Bone Marrow from 46BR Mice.
Bone marrow and thymus from 3-week-old 46BR mice did not show the same marked increase in the frequency of S-phase cells that was observed in spleen. However, a slight, but significant, increase in the frequency of S-phase cells was found when flow cytometry profiles from 3–14-week-old 46BR bone marrows were compared with wild-type controls (Table 1)Citation . Although the large majority of 46BR bone marrows examined had profiles like the wild-type control sample shown in Fig. 5ACitation , 7% (3 of 45 examined) had an abnormal profile like the example in Fig. 5BCitation . In these abnormal bone marrows, the frequency of S-phase cells was 2-fold less than in normal 46BR samples (Table 1)Citation . This difference between abnormal and normal 46BR bone marrow was significant (P = 2.6 x 10-7), as was the lower frequency of S-phase cells in abnormal 46BR bone marrow compared with wild-type controls (see Table 1Citation ). In the abnormal 46BR bone marrows, there was no longer a discrete G2 peak corresponding to cells that had completed S phase. In the abnormal 46BR sample shown (Fig. 5B)Citation , only 2% of the cells are in G2 compared with 4% of the wild type (Fig. 5A)Citation and a smaller fraction of the population (8%) is in S phase compared with the wild type (14%). Whereas in the wild-type and normal 46BR samples, the frequency of cells at different stages of S phase was fairly constant, in the abnormal 46BR bone marrows, the frequency of cells in the later stages of replication (with higher DNA content) dropped sharply, indicating that a substantial population of cells were not completing a round of DNA replication. These abnormal distributions of S-phase and G2 cells were not consistently accompanied by the presence of a sub-G1 population. Similar abnormal distributions were not observed in wild-type bone marrows.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Altered DNA replication and a discrete sub-G1 peak in hematopoietic tissues from 46BR mice. A, B, C, E, and G, the frequency distribution of DNA content for propidium iodide-stained nuclei obtained by flow cytometry. D, F, and H, Annexin V and propidium iodide labeling of live cells by flow cytometry. Cells (20,000) were assayed for each sample, and the results are displayed on the same frequency scale for corresponding wild-type and 46BR tissues. A and B, bone marrow samples from 8-week-old wild-type (A) and 46BR (B) mice. A, sub-G1 1%, G1 81%, S phase 14%, G2 4%. B, sub-G1 1%, G1 89%, S phase 8%, G2 2%. There is an apparent failure of DNA replication in the 46BR bone marrow sample. C and D, in vitro induction of apoptosis in a bone marrow culture from a wild-type animal. C, DNA content of propidium iodide-stained nuclei 18 h after a UV dose of 10 Jm-2; sub-G1 19%, G1 75%, S phase 4%, G2 1%. The classic G1 arrest and broad apoptotic sub-G1 peak are notable. D, Annexin V and propidium iodide labeling of live cells sampled from the same experiment shown in C. A discrete population (23%) of double-labeled apoptotic cells (quadrant 2) is present. E and F, thymus sample from 8-week-old wild-type mouse. E, sub-G1 1%, G1 91%, S phase 5%, G2 3%. F, 3% double-labeled apoptotic cells. G and H, thymus sample from 8-week-old 46BR mouse. G, sub-G1 30%, G1 59%, S phase 8%, G2 2%. H, 3% double-labeled apoptotic cells. The discrete, large sub-G1 peak in the 46BR thymus sample is not accompanied by a high level of apoptosis. Arrow, a small peak at twice the DNA content of the sub-G1 peak.

 
The abnormal profile of altered replication seen in some bone marrow samples from 46BR mice in vivo was very different from the typical profile associated with DNA-damage-induced apoptosis in vitro. Bone marrow was prepared from wild-type animals, and one-half was used for propidium iodide staining of nuclei to confirm the normal cell cycle distribution. The remaining samples were established in culture, UV-irradiated (10 Jm-2), and incubated for 18 h. Analysis of propidium iodide-stained nuclear preparations (Fig. 5C)Citation revealed a classic G1 arrest with very few cells in S phase (4%) and G2 (1%) and with a large accompanying broad sub-G1 peak (16%). Annexin V and propidium iodide labeling of live cells, sampled at the same time as the propidium iodide-stained nuclear preparations were made, confirmed that the broad sub-G1 peak correlated well with the presence of a discrete apoptotic population (23%) of Annexin V and propidium iodide double-labeled cells (Fig. 5D)Citation . Similar staining of normal 46BR and wild-type bone marrows did not reveal an increased level of apoptosis in 46BR samples (data not shown). The apoptosis assay has not been possible on abnormal 46BR bone marrows because of the low frequency of occurrence.

The Sub-G1 Peak in Thymus from 46BR Mice Is Not Caused by Apoptosis.
The majority of flow cytometry profiles from 3–14-week-old 46BR thymuses were normal, but there was a small, but significant, increase in the frequency of S-phase cells compared with wild-type controls (Table 1)Citation . However, 27% (19 of 70) of 46BR thymuses examined had abnormal profiles with a pronounced discrete sub-G1 peak (Fig. 5G)Citation . In the example shown, 30% of the population is in the sub-G1 peak. The frequency of S-phase cells in these abnormal 46BR thymuses was the same as in normal 46BR thymuses (Table 1)Citation . In abnormal 46BR thymuses with the most pronounced sub-G1 peaks, there was also a small peak corresponding to double the DNA content of the sub-G1 peak (Fig. 5GCitation , arrow). These discrete sub-G1 peaks were not observed in wild-type thymuses (0 of 39 examined).

These data are consistent with the ligation defect associated with the 46BR mutation having a detrimental effect on DNA replication. In some bone marrows, the effect is severe, leading to a failure of normal completion of DNA replication. The obvious explanation for the discrete sub-G1 peak in 46BR thymuses, namely, that it was caused by apoptosis triggered by the replication defect, was ruled out by Annexin V and propidium iodide double-labeling of live cells. The frequency of double-labeled apoptotic cells was the same (only 3%) in wild-type (Fig. 5F)Citation and abnormal 46BR thymus (Fig. 5H)Citation , despite the presence in the latter of 30% of the population in a discrete sub-G1 peak.

The Sub-G1 Peak Can Be Induced in Wild-Type Hematopoietic Cell Cultures by DNA-damaging Agents.
We have shown that the discrete sub-G1 peak that occurs spontaneously in 46BR thymus is not caused by apoptosis. To understand how it could arise we sought to induce a similar peak in wild-type hematopoietic cell cultures. Wild-type thymocyte cultures were established and either UV-irradiated at 20 Jm-2 or left untreated. Eighteen h later, control cultures showed a broad sub-G1 peak (9% of the population in Fig. 6ACitation ), that correlated well with the frequency of apoptotic cells (14%; Fig. 6BCitation ). As expected, the frequency of apoptotic cells was increased in cultures 18 h after UV-irradiation (20%, Fig. 6DCitation ; 25%, Fig. 6FCitation ). Some irradiated cultures (Fig. 6C)Citation showed the same broad sub-G1 peak as control cultures, whereas others (Fig. 6E)Citation displayed, in addition, a discrete sub-G1 peak reminiscent of that seen in abnormal 46BR thymuses in vivo. The equivalent levels of apoptosis in the two types of irradiated culture indicated that it was the broad, rather than the discrete, sub-G1 peak that contained apoptotic cells. The effect of a second DNA-damaging agent, hydrogen peroxide, was studied in proliferating wild-type spleenocyte cultures. Control spleenocyte cultures had a higher frequency of S-phase cells and of the broad sub-G1 peak, diagnostic for apoptosis, than unstimulated control thymocytes (spleenocytes, Fig. 6GCitation : sub-G1, 17%; S phase, 9%; thymocytes, Fig. 6ACitation : sub-G1, 9%; S phase, 1%). Treatment with hydrogen peroxide (600 µM for 30 min) did not affect the frequency of S-phase cells, but 24 h after treatment, the frequency of cells in the sub-G1 peak increased, and a discrete peak superimposed on the broad sub-G1 peak of apoptotic cells was visible. This discrete sub-G1 peak became more pronounced 2 days after treatment (Fig. 6H)Citation . Thus, the characteristic discrete sub-G1 peak, seen spontaneously in 46BR spleens and thymuses in vivo, can be reproduced by treatment of wild-type spleen and thymus cultures in vitro with DNA-damaging agents.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. The discrete sub-G1 peak can be induced in wild-type hematopoietic cell cultures by DNA-damaging agents. A, C, E, G, and H, the frequency distribution of DNA content for propidium iodide-stained nuclei obtained by flow cytometry. B, D, and F, Annexin V and propidium iodide labeling of live cells by flow cytometry. Cells (20,000) were assayed for each sample, and the results for each cell type are displayed on the same frequency scale. A and B, control thymocyte culture. A, sub-G1 9%, G1 87%, S phase 1%, G2 3%. B, 14% double-labeled apoptotic cells. C and D, thymocyte culture 18 h after UV-irradiation. C, sub-G1 16%, G1 79%, S phase 3%, G2 2%. D, 20% double-labeled apoptotic cells. E and F, independent thymocyte culture 18 h after UV-irradiation. E, sub-G1 51%, G1 45%, S phase 3%, G2 1%. F, 25% double-labeled apoptotic cells. The presence of the discrete sub-G1 peak in this irradiated sample, which is independent of the frequency of apoptosis, is notable. G, proliferating control spleenocyte culture; sub-G1 16%, G1 72%, S phase 9%, G2 3%. H, proliferating spleenocyte culture 2 days after hydrogen peroxide treatment; sub-G1 29%, G1 55%, S phase 12%, G2 4%. The presence of the discrete sub-G1 peak in the treated sample is notable.

 
46BR Mice Show Increased Genome Instability.
We have previously shown that primary fibroblasts isolated from Lig1 null mouse embryos have a 4-fold higher frequency of micronuclei than wild-type control cultures (17) . To investigate whether the DNA ligase I deficiency associated with the 46BR mutation also caused an increased level of genome instability, we first isolated 46BR primary embryonic fibroblast cultures and scored micronuclei. The frequency of micronuclei was equivalent in 46BR and wild-type cultures (see Table 2Citation ). Primary embryonic fibroblasts grow very slowly in culture, and we reasoned that the rate of DNA replication may not be sufficient for the delayed joining of Okazaki fragments by the 46BR protein to be manifested as chromosome breakage or loss (i.e., as micronuclei). For this reason we established an in vivo assay for micronuclei on spleen and thymus. We found that the frequency of micronuclei was higher in wild-type spleen than in wild-type thymus, and that the frequency was higher for both tissues in animals that were 15 months old compared with 7 weeks old. The frequency of micronuclei in 46BR thymus of both ages was 1.5-fold higher than in control tissue, but this difference was not significant at the 5% level. The genotype difference was more pronounced in the spleen, in which micronuclei were twice as frequent in 7-week-old animals and 3-fold more common in 15-month-old animals, with both differences being highly significant.


View this table:
[in this window]
[in a new window]

 
Table 2 The frequency of micronuclei in tissues from wild-type and 46BR mice

 
46BR Mice Have Increased Susceptibility to a Diverse Range of Tumors.
Cohorts of 46BR and wild-type mice were kept for up to 2 years to assess the incidence of spontaneous tumors. Sick animals, animals losing condition, and animals with obvious tumors were culled; and, after a postmortem, samples were taken for histology. Only 2 of 34 wild-type animals were found to have tumors during the experiment, corresponding to a 2-year tumor-free survival rate of 94% (see Fig. 7Citation ). Five times as many tumors occurred in 46BR mice (17 of 53 animals), corresponding to a 2-year tumor-free survival rate of 68%. In addition to the expected lymphomas and adenocarcinomas, a range of other epithelial tumors, rarely seen in mice, occurred in the 46BR stock (These are listed in the legend to Fig. 7Citation ). Most striking were the two superficial, apparently cutaneously based, tumors with histological features of adnexal differentiation. No further visceral epithelial neoplasia was identified in the animals involved to support the alternative interpretation that these might instead represent cutaneous metastases from visceral carcinoma. These tumors exhibited various proportions of pilar and ductal (eccrine) differentiation. Areas of abrupt pilar-type keratinization alternated with lobules of more basaloid-appearing cells, arranged in true ductules with focal necrosis and showing up to moderate pleomorphism and brisk mitotic activity (Fig. 8)Citation .



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Reduced tumor-free survival in 46BR mice. Animals (34 wild-type and 53 46BR) were kept for up to 2 years and the incidence of spontaneous tumors was recorded. Seventeen tumors were recorded in the 46BR mice: lymphoma (8), adenocarcinoma (3), mixed adnexal carcinoma (2), bronchoalveolar carcinoma (1), cystadenoma (1), hilar cell tumor (1), hemangioma (1). Two tumors were found in wild-type mice: adenocarcinoma (1), osteosarcoma (1).

 


View larger version (109K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Adnexal tumor from a 46BR mouse. H&E-stained sections of a skin adnexal tumor. A, intermediate-power view (x100) showing the lobular architecture with basaloid cells forming ductular profiles (D) and showing abrupt zonal keratinization (K). B, higher power view (x400) showing brisk mitotic activity (arrowheads) and necrosis (N) within ductular lumina.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Role of DNA Ligase I.
DNA ligase I has a key role in DNA replication in the joining of Okazaki fragments during lagging strand DNA synthesis (10 , 26, 27, 28) . In vitro reconstitution experiments have also shown that DNA ligase I is involved in NER and the long-patch form of base excision repair (12, 13, 14) . Thus, the report that DNA ligase I was a cell-essential gene (15) was not unexpected. We have generated two different Lig1 knockout alleles and shown both to be embryonic lethals (16 , 17) . However, mutant embryos from both knockout lines developed normally to midterm, and viable cell lines were isolated from the embryos. This clearly contradicts the assertion that Lig1 is a cell-essential gene. Mutant embryos failed with a specific defect in erythropoiesis, although hematopoietic progenitors from Lig1 null fetal liver were able to repopulate the hematopoietic system and rescue lethally irradiated recipients. We believe that other tissues can compensate for the lack of DNA ligase I, presumably through the action of another ligase, but that this compensation fails under the high replicative pressure of fetal erythropoiesis, leading to reduced proliferation, anemia, and death. We found no evidence for any DNA repair defect in Lig1 null cells, but an accumulation of DNA replication intermediates and increased genome instability were detected (17) . For this reason, we consider that failed erythropoiesis in Lig1 null embryos, increased genomic instability in Lig1 null cells, and the phenotype in the human 46BR patient with point mutations in the LIG1 gene (see next section) are likely to result directly from the DNA replication defect, although we cannot exclude the possibility that an as-yet-undetected DNA repair deficiency may also be involved.

Mice Homozygous for the Arg-771-to-Trp Mutation in the Lig1 Gene as a Model for the 46BR Patient.
Two different DNA ligase I point mutations have been reported in a single patient (4) with similar growth retardation and immunodeficiency as found in BS, a paradigm for inherited genome instability/cancer predisposition diseases (2) . This 46BR patient developed lymphoma at age 17 and subsequently died from pneumonia. A Glu-566-to-Lys mutation at the active site inactivated one allele, whereas an Arg-771-to-Trp mutation on the second allele resulted in 20-fold reduced enzyme activity (5) . We have used double-replacement gene targeting in the Hprt-deficient ES cell line, HM-1, to generate mice homozygous for the Arg-771-to-Trp mutation. We chose this milder mutation because only the Arg-771-to-Trp allele is retained in the 46BR cell line. The Glu-566-to-Lys allele, encoding a completely nonfunctional protein, has been lost; and we reasoned that this mutation, like our Lig1 knockouts, would probably be an embryonic lethal in mice. Mice homozygous for the Arg-771-to-Trp mutation are, thus, not a perfect model for the 46BR patient. We also have the potential to generate mice heterozygous for the 46BR mutation over a knockout allele, differences in the phenotype of these two models (Lig146BR/46BR and Lig146BR/-) might be anticipated.

Slower Growth but Normal Hematopoiesis in Older 46BR Mice.
From 5 weeks onward, 46BR mice grew more slowly than wild-type controls and took longer to attain the same mature body weight. This was consistent with their growth being slowed by the DNA ligase I defect leading to the accumulation of DNA replication intermediates. There was no evidence for a spontaneous hematopoietic defect in the older 46BR mice that might have been predicted from the immunodeficiency of the 46BR patient. All hematopoietic lineages were present in the expected amounts. However, the mice were housed in a clean environment, and their health status was good so that the ability of their immune system to respond to infection was not being tested. A difference in the ability of the hematopoietic systems of 46BR and control mice to respond might become apparent in more challenging circumstances.

Erythropoiesis Is under Stress in Young 46BR Mice.
We have previously identified erythropoiesis in Lig1 null embryos and, after transplantation of Lig1 null fetal liver cells into lethally irradiated recipients, as being critical situations in which Lig1 null cells are unable to meet the particularly high demand for DNA replication (16 , 17) . The enlargement of the spleen in 3-week-old 46BR mice, the elevated frequency of S-phase cells, and the increased frequency of immature reticulocytes released prematurely into the circulation, all indicate that erythropoiesis is facing a similar but less severe difficulty in meeting replicative demands attributable to the DNA ligase I deficiency. Alternatively, if an as-yet-undefined DNA repair deficiency contributes to the phenotype of 46BR mice, then a higher exposure to the relevant damage in spleen might also explain this result. This situation quickly resolved, presumably because the demand for red cells dropped, or because of the increasing number of hematopoietic cells that can be devoted to erythropoiesis, and by 5 weeks of age, the sizes of the spleens and the level of DNA replication in 46BR mice were indistinguishable from those in wild-type controls.

Occasional Failure of DNA Replication in Hematopoietic Tissue from 46BR Mice.
Apart from the 2-fold increase in the frequency of S-phase cells in the spleens from 3-week-old 46BR mice, thymus and bone marrow samples also showed a smaller but significant increase. We believe that this reflects an increased number of cells in S phase, because replication takes longer to complete because of the ligase deficiency, rather than an increased rate of proliferation. In rare samples from 46BR bone marrow, the frequency distribution of nuclear DNA content was consistent with a failure occurring during DNA replication, again presumably because there was insufficient DNA ligase I activity in the 46BR bone marrow to sustain the required high rate of proliferation. This in vivo frequency distribution in 46BR bone marrow was quite distinct from that seen after the induction of apoptosis by DNA damage in wild-type bone marrow in vitro, which was associated with a classic G1 arrest, and the prevention of initiation of DNA replication as opposed to the apparent failure during DNA replication seen in vivo. Indeed, although we have observed spontaneous prominent sub-G1 peaks in 46BR spleen and thymus in vivo, we have shown clearly that this is not caused by apoptosis. Thus, we have no evidence that apoptosis is acting to remove abnormal hematopoietic cells that accumulate in 46BR mice because of the DNA ligase deficiency.

The Discrete Sub-G1 Peaks in 46BR Spleen and Thymus Could Arise through Accumulation of Single-Strand DNA Breaks.
Although broad sub-G1 peaks represent apoptotic cells, we have clearly shown that the discrete sub-G1 peaks in 46BR spleen and thymus are not caused by apoptosis. How then can they be explained? Aneuploidy is not a plausible alternative because the sub-G1 peaks indicate apparent reductions in DNA content of up to 35% (32% in the 46BR thymus shown in Fig. 5BCitation ). Such cells would be inviable and unable to replicate their DNA in the way that the abnormal cells in 46BR thymus appear able to do, if our interpretation of the small peak at twice the sub-G1 peak value in samples such as that shown in Fig. 5BCitation is correct. Such discrete sub-G1 peaks can also appear rapidly (overnight after DNA damage in wild-type cultures) and may be relatively persistent in vivo. Although we are unable to sample any single animal twice, the presence of discrete sub-G1 peaks in the thymus of 46BR littermates sampled 2 weeks apart indicates that such peaks may be long lasting. We consider that only one possible explanation remains: that the sub-G1 peak represents an apparent, rather than a real, reduction in DNA content. Such a change could arise from single-strand DNA breaks reducing DNA supercoiling and leading to a reduction in the amount of propidium iodide staining. The amount of propidium iodide fluorescence in flow cytometry is dependent on the method of sample preparation (29) , and the fluorescence from such intercalating dyes is sensitive to the degree of DNA supercoiling, although, in the case of the related dye ethidium bromide, removing supercoiling actually increases the amount of dye that can bind (30) . An increased number of single-strand DNA breaks would be predicted in 46BR mice from the accumulation of DNA replication intermediates that we have detected in Lig1 null cells (17) , or from an, as-yet-undetected DNA repair deficiency. This argument is strengthened by our observation that we can induce equivalent sub-G1 peaks in wild-type cultures in vitro with DNA-damaging agents. Single-strand breaks will be produced during NER of UV-induced damage, whereas hydrogen peroxide causes strand breaks directly, in addition to a range of other lesions. This hypothesis for the origin of the discrete sub-G1 peak in 46BR mice can be tested by measuring single-strand breaks directly by end-labeling or using the alkaline comet assay. In addition to the rate of proliferation in a particular tissue, the other factor that may govern the appearance of the discrete sub-G1 peak in 46BR mice is the level of expression of DNA ligase I and of the other ligases, which may in some circumstances be able to compensate for ligase I deficiency (17) . If our interpretation is correct, we predict that we could increase the frequency of such events by stressing the hematopoietic system, either by blocking DNA replication and then releasing it to generate a surge of replication or by raising a strong, prolonged polyclonal immune response.

Genomic Instability in 46BR Mice Results from Abnormal DNA Replication.
We have previously observed an increased frequency of genome instability, assayed by micronucleus formation, in primary fibroblasts isolated from Lig1 null embryos (17) . It is not unreasonable to suppose that strand breaks and replication failure might result in increased genome instability in 46BR mice. Because DNA repair functions were normal in Lig1 null cells, we consider that the genomic instability is more likely to result directly from the accumulation of replication intermediates rather than from an as-yet-undetected DNA repair deficiency, and we favor a similar explanation for the increased levels of instability observed in 46BR mouse tissues in vivo, in which micronucleus formation was 3-fold higher in spleens from 15-month-old 46BR mice than from controls. The failure to observe an increase in genomic instability in 46BR primary embryonic fibroblasts in vitro that is similar to what we reported in Lig1 null cells could be caused by the 46BR allele encoding a protein with some residual ligase I activity. The difference between the in vivo and in vitro results for mouse 46BR cells could arise from the greater constraints on the coordination of DNA replication and mitosis in a tightly regulated process such as hematopoiesis in vivo. Pressure to enter mitosis to a precise schedule in vivo but not in vitro, coupled with a delay in replication arising from the accumulation of replication intermediates, could result in a failure of chromosome segregation or the loss of chromosome fragments, which would both generate micronuclei.

Increased Susceptibility to Cancer in 46BR Mice.
Genome instability is a key event in the development of cancer. The modest but significant increase in instability observed in the spleens of 46BR mice correlates well with the modest increase in the spontaneous tumor incidence observed. Thirty-two % of our 46BR mice developed tumors over a 2-year study, compared with only 6% of controls. Our model for the origin of these cancers is as follows: the accumulation of replication intermediates in cells in which the reduced amounts of DNA ligase I activity associated with the 46BR mutation are unable to meet demands for joining Okazaki fragments will result in increased DNA strand breaks with resulting genome instability. This will increase the probability of loss of tumor suppressor genes, or of translocation-mediated oncogene activation and cancer formation. If this explanation is correct, then we would expect to be able to increase the spontaneous tumor incidence in the hematopoietic system by increasing the replicative pressure on these animals by blocking DNA synthesis and then releasing or by stimulating a strong, prolonged polyclonal immune response.

Occurrence of Cutaneous Adnexal Tumors in 46BR Mice.
We have observed two of these unusual tumors in our current study of 46BR mice and an additional six in an ongoing study. No wild-type control animals in these studies have developed any such adnexal neoplasm. Cutaneous adnexal tumors, especially carcinomas, are rare neoplasms both in humans and in the mouse, and precise classification remains the object of discussion. Although the designations "basosquamous tumor," of both benign and malignant types, have been applied to the mouse, this nomenclature is considered inappropriate for the tumors under discussion in this study, given their histological appearance with convincing evidence of ductular differentiation and the rather abrupt and, frequently, very prominent pilar-type keratinization. Although most commonly recapitulating solely one of the four elements in the primary epithelial germ of ectoderm, the pluripotential primordial cells may exhibit multidirectional differentiation to produce tumors with a mixed adnexal pattern. This would appear to be the case in the tumors sampled in the present study. Little is understood about the etiology and pathogenesis of adnexal tumors. In humans there is, for several of these, notably of eccrine and pilar type, a predilection for sun-exposed skin with increasing age, as with epidermal-based carcinomas. In conjunction with this fact, the observation that basal cell carcinomas may show focal terminal differentiation toward any of the pilo-sebaceous components, has perhaps generated the reductionist notion in some quarters that all adnexal tumors are, in fact, ultimately basal cell carcinomas. Such a theory is not supported by the diversity, at least in humans, in the clinical course of these neoplasms, which certainly warrants their distinction. Few studies have investigated the genetic abnormalities associated with adnexal tumors, and, therefore, their molecular pathogenesis remains to be explored. Loss of heterozygosity studies have demonstrated confinement of loss of heterozygosity to 17p, with allelic loss and accompanying p53 stabilization being demonstrated in the transition from benign poromatous to porocarcinomatous areas within the same tumor in one particular case (31) . A further study suggests that p53 protein accumulation is not uncommon in adnexal carcinomas but is extremely rare in benign adnexal tumors (32) .

Comparison with Other Genetically Manipulated Mouse Models of Cancer Susceptibility.
Most existing genetically manipulated mouse models for cancer susceptibility involve changes to key genes that act to prevent or cause cancer, such as inactivation of tumor suppressor genes (reviewed in Ref. 33 ), inactivation of DNA repair genes (reviewed in Ref. 1 ), or activation of oncogenes such as members of the ras family (reviewed in Ref. 34 ). Typically, the resulting increases in cancer susceptibility are dramatic (e.g., for the inactivation of the p53 gene, 74% of animals developed tumors within 6 months; Ref. 35 ), reflecting the importance of the manipulated gene to carcinogenesis, but there is often a strong bias in the types of tumor seen. Such genetically modified mice, in which the alteration is present in every cell, do not represent good models for the majority of human cancers that originate from sporadic genetic alterations in individual cells surrounded by normal neighbors. This discrepancy has been addressed in an improved model for sporadic cancer involving activation of a mutant K-ras gene in gene-targeted mice when intrachromosomal recombination occurs randomly in individual somatic cells (36) . If we are correct in our interpretation of the mechanism for carcinogenesis in 46BR mice, this would represent a very different model of cancer susceptibility, one in which the increased cancer frequency results indirectly from increased genome instability rather than directly from the change in expression of a key gene involved in carcinogenesis. As such, this would more closely model the situation in sporadic human cancers that can arise in a wide range of cell types and tissues. The benefits of such a model would be that, potentially, any type of tumor could be obtained, provided that the cell type involved was undergoing DNA replication. The disadvantage is that the tumor frequency, although higher than in control mice, could never be as high as in models in which specific genes directly involved in carcinogenesis have been manipulated. The diverse range of spontaneous tumors seen in our first survey of 46BR mice, particularly the occurrence of a number of unusual epithelial tumors rarely seen in mice, indicates that mice with point mutations in the DNA ligase I gene will, indeed, prove to be a valuable addition to the existing mouse models for cancer.


    ACKNOWLEDGMENTS
 
We are grateful to Carolanne McEwan for targeting vector construction and to Kay Samuel for assistance with the flow cytometry for hematopoietic markers.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Project Grant SP2095/0104 from Cancer Research UK (to D. W. M.). Back

2 To whom requests for reprints should be addressed, at Sir Alastair Currie Cancer Research UK Laboratories, Molecular Medicine Centre, University of Edinburgh, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, Scotland, UK. Phone: 44-(0)131-651-1079; Fax: 44-(0)131-651-1072; E-mail: David.Melton{at}ed.ac.uk Back

3 The abbreviations used are: BS, Bloom’s syndrome; ES, embryonic stem; Hprt, mouse hypoxanthine phosphoribosyltransferase gene; Lig1, mouse DNA ligase I gene; NER, nucleotide excision repair; PE, phycoerythrin; TCR, T-cell receptor. Back

Received 6/29/01. Accepted 5/16/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hoeijmakers J. H. J. Genome maintenance mechanisms for preventing cancer. Nature (Lond.), 411: 366-374, 2001.[Medline]
  2. German J. Bloom syndrome: a Mendelian prototype of somatic mutational disease. Medicine (Baltimore), 72: 393-406, 1993.[Medline]
  3. Ellis N. A., Groden J., Ye T-E., Straughen J., Lennon D. J., Ciocci S., Proytcheva M., German J. The Bloom’s syndrome gene product is homologous to RecQ helicases. Cell, 83: 655-666, 1995.[Medline]
  4. Webster A. D. B., Barnes D. E., Arlett C. F., Lehmann A. R., Lindahl T. Growth retardation and immunodeficiency in a patient with mutations in the DNA ligase I gene. Lancet, 339: 1508-1509, 1992.[Medline]
  5. Barnes D. E., Tomkinson L. H., Lehmann A. R., Webster A. D. B., Lindahl T. Mutations in the DNA ligase I gene in an individual with immunodeficiencies and cellular hypersensitivity to DNA-damaging agents. Cell, 69: 495-504, 1992.[Medline]
  6. Teo I. A., Arlett C. F., Harcourt S. A., Priestley A., Broughton B. C. Multiple hypersensitivity to mutagens in a cell strain (46BR) derived from a patient with immuno-deficiencies. Mutat. Res., 107: 371-386, 1983.[Medline]
  7. Lehmann A. R., Willis A. E., Broughton B. C., James M. R., Steingrimsdottir H., Harcourt S. A., Arlett C. F., Lindahl T. Relation between the human fibroblast strain 46BR and cell lines representative of Bloom’s syndrome. Cancer Res., 48: 6343-6347, 1988.[Abstract/Free Full Text]
  8. Prigent C., Satoh M. S., Daly G., Barnes D. E., Lindahl T. Aberrant DNA repair and DNA replication due to an inherited enzymatic defect in human DNA ligase I. Mol. Cell. Biol., 14: 310-317, 1994.[Abstract/Free Full Text]
  9. Henderson L. M., Arlett C. F., Harcourt S. A., Lehmann A. R., Broughton B. C. Cells from an immunodeficient patient (46BR) with a defect in DNA ligation are hypomutable but hypersensitive to the induction of sister chromatid exchanges. Proc. Natl. Acad. Sci. USA, 82: 2044-2048, 1985.[Abstract/Free Full Text]
  10. Waga S., Bauer G., Stillman B. Reconstitution of complete SV40 DNA replication with purified replication factors. J. Biol. Chem., 269: 10923-10934, 1994.[Abstract/Free Full Text]
  11. Montecucco A., Biamonti G., Savini E., Focher F., Spadari S., Ciarrochi G. DNA ligase I gene expression during differentiation and cell proliferation. Nucleic Acids Res., 20: 6209-6214, 1992.[Abstract/Free Full Text]
  12. Shivji M. K. K., Podust V. N., Hubscher U., Wood R. D. Nucleotide excision repair DNA synthesis by DNA polymerase epsilon in the presence of PCNA, RFC, and RPA. Biochemistry, 34: 5011-5017, 1995.[Medline]
  13. Aboussekhra A., Biggerstaff M., Shivji M. K. K., Vilpo J. A., Moncollin V., Podust V. N., Protic M., Hubscher U., Egly J. M., Wood R. D. Mammalian DNA nucleotide excision repair reconstituted with purified protein components. Cell, 80: 859-868, 1995.[Medline]
  14. Lindahl T., Karran P., Wood R. D. DNA excision repair pathways. Curr. Opin. Genet. Dev., 7: 158-169, 1997.[Medline]
  15. Petrini J. H. J., Xiao Y. H., Weaver D. T. DNA ligase-I mediates essential functions in mammalian cells. Mol. Cell. Biol., 15: 4303-4308, 1995.[Abstract]
  16. Bentley D. J., Selfridge J., Millar J. K., Samuel K., Hole N., Ansell J. D., Melton D. W. DNA ligase I is required for foetal liver erythropoiesis but is not essential for mammalian cell viability. Nat. Genet., 13: 489-491, 1996.[Medline]
  17. Bentley D. J., Harrison C., Ketchen A-M., Redhead N. J., Samuel K., Ansell J. D., Melton D. W. DNA ligase I null mouse cells show normal DNA repair activity but altered DNA replication and reduced genome stability. J. Cell Sci., 115: 1551-1561, 2002.[Abstract/Free Full Text]
  18. Jessop J. K., Melton D. W. Comparison between cDNA clones encoding murine DNA ligase I. Gene (Amst.), 160: 307-308, 1995.[Medline]
  19. Thompson S., Clarke A. R., Pow A. M., Hooper M. L., Melton D. W. Germ line transmission of a corrected Hprt gene produced by gene targeting in embryonic stem cells. Cell, 56: 313-321, 1989.[Medline]
  20. Stacey A., Schnieke A., McWhir J., Cooper J., Colman A., Melton D. W. Use of double-replacement gene targeting to replace the murine {alpha}-lactalbumin gene with its human counterpart in embryonic stem cells and mice. Mol. Cell. Biol., 14: 1009-1016, 1994.[Abstract/Free Full Text]
  21. Tomescu D., Ha T., Kavanagh G., Campbell H., Melton D. W. Nucleotide excision repair gene XPD polymorphism and predisposition to melanoma. Carcinogenesis (Lond.), 22: 403-408, 2001.[Abstract/Free Full Text]
  22. Melton D. W., Ketchen A-M., Nuñez F., Bonatti-Abbondandolo S., Abbondandolo A., Squires S., Johnson R. T. Cells from Ercc1-deficient mice show increased genome instability and a reduced frequency of S-phase-dependent illegitimate chromosome exchange, but a normal frequency of homologous recombination. J. Cell Sci., 111: 395-404, 1998.[Abstract]
  23. Moore R. C., Redhead N. J., Selfridge J., Hope J., Manson J. C., Melton D. W. Double replacement gene targeting for the production of a series of mouse strains with different prion protein gene alterations. Bio/Technology, 13: 999-1004, 1995.[Medline]
  24. Selbert S., Bentley D. J., Melton D. W., Rannie D., Lourenco P., Watson C. J., Clarke A. R. Efficient BLG-Cre mediated gene deletion in the mammary gland. Transgenic Res., 7: 387-396, 1998.[Medline]
  25. Melton D. W., Ketchen A-M., Selfridge J. Stability of Hprt marker gene expression at different gene-targeted loci: observing and overcoming a position effect. Nucleic Acids Res., 25: 3937-3943, 1997.[Abstract/Free Full Text]
  26. Wu W., Hickey R., Lawlor K., Wills P., Yu F., Ozer H., Starr R., Quan J. Y., Lee M., Malkas L. A 17S multiprotein form of murine cell DNA polymerase mediates polyomavirus DNA replication in vitro. J. Cell. Biochem., 54: 32-46, 1994.[Medline]
  27. Turchi J. J., Huang L., Murante R. S., Kim Y., Bambara R. A. Enzymatic completion of mammalian lagging-strand DNA replication. Proc. Nat. Acad. Sci. USA, 91: 9803-9807, 1994.[Abstract/Free Full Text]
  28. Applegren N., Hickey R. J., Kleinschmidt A. M., Zhou Q., Coll J., Wills P., Swaby R., Wei Y., Quan J. Y., Lee M. Y. W. T., Malkas L. H. Further characterization of the human cell multiprotein DNA replication complex. J. Cell. Biochem., 59: 91-107, 1995.[Medline]
  29. Ormerod M. G. Analysis of DNA-general methods Ed. 2 Ormerod M. G. eds. . Flow Cytometry A Practical Approach, : 119-135, IRL Press Oxford 1994.
  30. Sambrook J. Fritsch E. F. Maniatis T. eds. . Molecular Cloning: A Laboratory Manual, Ed. 2 1.23 Cold Spring Harbor Laboratory Press Cold Spring Harbor 1989.
  31. Takata M., Hashimoto K., Mehregan P., Lee M. W., Yamamoto A., Mohri S., Ohara K., Takehara K. Genetic changes in sweat gland carcinomas. J. Cutan. Pathol., 27: 30-35, 2000.[Medline]
  32. Wienecke R., Eckert F., Kaudewitz P., de Viragh P. A., Heidl G., Volkenandt M. p53 protein in benign and malignant sweat gland tumors. Am. J. Dermatopathol., 16: 126-129, 1994.[Medline]
  33. Clarke A. R. Manipulating the germline: its impact on the study of carcinogenesis. Carcinogenesis (Lond.), 21: 435-441, 2000.[Abstract/Free Full Text]
  34. Adams J. M., Cory S. Transgenic models of tumour development. Science (Wash. DC), 254: 1161-1167, 1991.[Abstract/Free Full Text]
  35. Donehower L. A., Harvey M., Slagle B. L., McArthur M. J., Montgomery C. A., Jr, Butel J. S., Bradley A. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature (Lond.), 356: 215-221, 1992.[Medline]
  36. Johnson L., Mercer K., Greenbaum D., Bronson R. T., Crowley D., Tuveson D. A., Jacks T. Somatic activation of the K-ras oncogene causes early onset lung cancer in mice. Nature (Lond.), 410: 1111-1116, 2001.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Lopez Castel, A. E. Tomkinson, and C. E. Pearson
CTG/CAG Repeat Instability Is Modulated by the Levels of Human DNA Ligase I and Its Interaction with Proliferating Cell Nuclear Antigen: A DISTINCTION BETWEEN REPLICATION AND SLIPPED-DNA REPAIR
J. Biol. Chem., September 25, 2009; 284(39): 26631 - 26645.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Soza, V. Leva, R. Vago, G. Ferrari, G. Mazzini, G. Biamonti, and A. Montecucco
DNA Ligase I Deficiency Leads to Replication-Dependent DNA Damage and Impacts Cell Morphology without Blocking Cell Cycle Progression
Mol. Cell. Biol., April 15, 2009; 29(8): 2032 - 2041.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Song, D. S. Levin, J. Varkey, S. Post, V. P. Bermudez, J. Hurwitz, and A. E. Tomkinson
A Conserved Physical and Functional Interaction between the Cell Cycle Checkpoint Clamp Loader and DNA Ligase I of Eukaryotes
J. Biol. Chem., August 3, 2007; 282(31): 22721 - 22730.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Subramanian, S. Vijayakumar, A. E. Tomkinson, and N. Arnheim
Genetic Instability Induced by Overexpression of DNA Ligase I in Budding Yeast
Genetics, October 1, 2005; 171(2): 427 - 441.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Wu, J. A. Roth, H. Zhao, S. Luo, Y.-L. Zheng, S. Chiang, and M. R. Spitz
Cell Cycle Checkpoints, DNA Damage/Repair, and Lung Cancer Risk
Cancer Res., January 1, 2005; 65(1): 349 - 357.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harrison, C.
Right arrow Articles by Melton, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harrison, C.
Right arrow Articles by Melton, D. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online