| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Departments of Pathology [C. B. M., A. B. C., M. W. J., I. B., C. R. T., C. P., D. J. T., B. T. M.], Civil and Environmental Engineering [D. H.], and Medical Biostatistics [P. V.], University of Vermont, Burlington, Vermont 05405
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
After chronic or lifetime inhalation of asbestos fibers, rodents develop few mesotheliomas or lung cancers but die of asbestosis, which develops in parallel with hyperplastic and neoplastic epithelial changes. Cell proliferation after exposure to asbestos fibers is a consequence of early asbestos-induced injury to pulmonary epithelial and mesothelial cells and is critical to the development of malignancies and other fibroproliferative diseases (3 , 4) . Asbestos fibers cause aggregation and increased immunoreactivity of the EGFR3 protein in human mesothelial cells in vitro (5) , and these events may initiate signaling pathways important in asbestos-induced proliferation and carcinogenesis. In both mesothelial and alveolar type II epithelial cells, EGF and asbestos stimulate DNA synthesis (6 , 7) . Moreover, phosphorylation of the EGFR by asbestos fibers is causally related to increases in phosphorylation and activity of ERKs 1/2 (8 , 9) , mitogen-activated protein kinases that are increased at sites of asbestos deposition, and proliferation in lungs after inhalation of fibers (10) . Asbestos fibers also cause elevations in EGFR mRNA and protein (9) , indicating their potential roles in both EGFR phosphorylation and biosynthesis.
Another consequence of asbestos exposure in mesothelial and pulmonary epithelial cells is the induction of the AP-1 family members, c-fos and c-jun, and increases in AP-1 activity (11 , 12) . The AP-1 early response proto-oncogenes are linked to proliferation and transformation in a number of cell types, representing one common pathway by which cells respond to environmental stress. An understanding of their role in the pathogenic responses to asbestos provides insight into the mechanisms of asbestos-related diseases, as well as the broader role that these genes play in cellular proliferation, transformation, and apoptosis in a number of cell types.
Our studies here were designed to determine whether activation of the EGFR is critical to cell proliferation and proto-oncogene expression induced by asbestos fibers in pulmonary epithelial cells, cell types initially encountering and interacting with asbestos fibers after inhalation, as well as target cells affected in lung cancers and asbestosis. Because asbestos fibers are deposited after inhalation in the distal lung, primarily in the alveolar duct region, we used transgenic mice expressing a mutant EGFR (Tg+) lacking a portion of the intracytoplasmic phosphorylation domain and targeted to alveolar type II and distal bronchiolar epithelial cells using the human SP-C promoter (13) . We then evaluated epithelial cell proliferation, inflammation, and fos/jun family member expression in lungs of Tg+ and (Tg-) littermates after inhalation of crocidolite asbestos. Data show that the EGFR governs acute epithelial cell proliferation and proto-oncogene expression by asbestos. A causal relationship between EGFR phosphorylation, ERK activation, and expression of jun-B, c-fos, and fra-1 was also established in pulmonary epithelial cells in vitro. These data provide a foundation for EGFR targeting in preventive and therapeutic approaches to asbestos-induced neoplasms.
| Materials and Methods |
|---|
|
|
|---|
Inhalation Exposures and Protocols.
Three experiments were performed using groups of 812-week-old mice exposed to ambient air or 7 mg/m3
air of the National Institute of Environmental Health Sciences reference sample of crocidolite asbestos for 6 h/day, generated as described previously (14)
. In Experiment 1, both Tg+ and Tg- mice (an average of 4 mice/group/time period) were evaluated for proliferative responses to asbestos after 2- and 4-day exposures. Sham mice were killed at 3 days. Forty-eight and 24 h before killing, both sham and asbestos-exposed mice received i.p. injections of BrdUrd (100 mg/kg body weight) as described previously (15)
to allow a direct comparison between numbers of proliferating epithelial cells detected by the BrdUrd and PCNA techniques. Because trends were comparable, the PCNA method, a less invasive method not requiring preinjection of animals before death, was used in subsequent experiments. In Experiment 2, inflammation was characterized in sham and asbestos-exposed C57/BL6 mice at 1, 3, and 9 days (n = 4/group/time period). In Experiment 3, both Tg+ and Tg- mice (n = 8/group/time period) were examined for proliferation and inflammation at time periods demonstrating changes, i.e., 4 and 9 days, in Experiments 1 and 2, respectively, and at 30 days. Mice were given a lethal i.p. dose of pentobarbital and evaluated as described below.
Histopathology.
After opening the chest cavity, a polyurethane catheter was inserted into the trachea and the right lung lobes sutured, removed, placed in a cryomold, and immersed in optimal cutting temperature (OCT) embedding compound (Tissue Tek; Sakura Finetek USA, Torrance, CA) before being snap-frozen in liquid nitrogen-cooled 2-methylbutane. Left lung lobes were then instilled with 4% paraformaldehyde at a pressure of 25 cm of water, allowed to fix for 5 min, and placed in a tissue cassette overnight in 4% paraformaldehyde at 4°C before embedding in paraffin blocks. Lung sections were cut at a thickness of 4 µm for histochemistry and histopathology after staining using the Massons trichrome technique.
Immunohistochemistry for PCNA.
Lung sections from sham and asbestos-exposed mice were deparaffinized three times in xylene for 5 min, rehydrated through a series of graded alcohols, and equilibrated with PBS. Slides were then permeabilized with 100% methanol for 10 min at -20°C followed by a 15-min incubation with 0.1% Triton-X100. After rinsing with PBS, the slides were washed with 10 mM citrate buffer, then boiled for 10 min. Tissue sections were incubated in 200 µl of goat serum in 10 ml of 0.1% Triton-X100 in PBS three times for 20 min before addition of a biotinylated antibody to PCNA (PharMingen, San Diego, CA; 1:500 dilution). Lung sections were then incubated with streptavidin followed by a brief incubation in 3,3' diaminobenzidine as a chromogen, according to the manufacturers protocol (Vector Laboratories, Burlingame, CA). Sections were then rinsed with distilled H2O, counterstained with hematoxylin, dehydrated through a series of graded ethanols, cleared with xylene, and mounted using Vectashield (Vector Laboratories).
Image Analysis.
Numbers of epithelial cells incorporating nuclear PCNA in the distal bronchioles and alveolar duct regions were quantitated using image analysis. In brief, immunostained sections were imaged through a BX-50 Olympus microscope (Olympus Corp., Tokyo, Japan). Images were collected with a color video camera and adapter coupled with an Olympus viewing screen and remote control unit (Sony Corp., Tokyo, Japan). Images were stored and analyzed using a SunSPARC Station 5 computer (Sun Microsystems, Mountain View, CA) using Imix/Imagist Version 8 Integrated Microanalyzer for imaging software (Princeton Gamma-tech, Princeton, NJ). Images were then converted from RAF to TIF files and analyzed using Paint Shop Pro 3 and Optimas photo programs. Using a blind coding system, the number of PCNA-positive epithelial cells in distal bronchioles and the alveolar duct region was assessed independently by two individuals by tracing the unit length of basal lamina of each of these compartments and expressing results per unit length as described previously (14)
. A total of 10 discrete structures was evaluated on individual lung sections (n = 2/mouse).
BAL.
After the chest cavity was opened, a polyurethane catheter was placed in the trachea, and lungs were lavaged in situ six times with a 1-ml volume of sterile calcium and magnesium-free PBS at 37°C. BAL samples from each mouse were pooled, measured, and centrifuged to obtain cell pellets for total and differential cell counts. Total cell counts were determined using a hemocytometer. Cytospin preparations were made as described previously (14
, 15) , and slides were stained with Giemsa and May Grunwald stains. Five hundred cells were evaluated on each slide.
Cell Cultures.
The C10 cell line is a nontumorigenic murine alveolar type II epithelial cell line originally derived from a NAL 1A alveolar type II epithelial cell line (16)
. The cell line was isolated from adult mice and maintains a characteristic epithelial cell morphology, including surface microvilli, desmosomes, and lamellar bodies. C10 cells were maintained and passaged in Connaught Medical Research Laboratories 1066 medium (Life Technologies, Inc., Grand Island, NY) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and antibiotics. At confluence, cells were switched to 0.5% serum-containing medium for 24 h before addition of crocidolite asbestos (National Institute of Environmental Health Sciences reference sample; Research Triangle Park, NC). Fibers were weighed after sterilization in a dry oven to remove possible endotoxin and so on and suspended at 1 mg/ml in Hanks Balanced Salt Solution before trituration in a syringe and addition at 5 µg/cm2 area of dish, a concentration-inducing cell proliferation (7)
. AG1478 (10 µM), an inhibitor of EGFR phosphorylation (8
, 9)
, and the MAP/ERK kinase 1/2 inhibitors PD98059 (30 µM; Ref. 7
) or U0126 (10 µM; all from Calbiochem, San Diego, CA) were added alone or 30 min before asbestos in 0.1% DMSO-containing medium. Solvent controls and initial studies with the structurally similar, inactive compound U0124, which had no effects on ERK activation or proto-oncogene expression, were also included.
RPA.
Total RNA was prepared from C10 cells and lung homogenates as described previously (17)
. Steady-state mRNA levels of c-jun, jun-B, jun-D, c-fos, fra-1, fra-2, fosB, L32, and glyceraldehyde-3-phosphate dehydrogenase were examined using the RiboQuant multiprobe RPA system and the mFos/Jun multiprobe template set (PharMingen), according to the manufacturers protocol. Autoradiograms were quantitated using a Bio-Rad phosphorimager. Results were normalized to expression of the housekeeping gene L32.
LCM.
Distal lung bronchiolar epithelial cells were microdissected from 10-µm thick cryostat sections cut from mouse lungs frozen in OCT. The sections were cut at -23°C with stainless steel blades mounted in a Microm Microtome Cryostat and picked up onto Fisherbrand Superfrost/Plus-treated slides (Fisher Scientific, Pittsburgh, PA). The sections were stored at -80°C until use. Sections were fixed for 30 s in 70% ethanol, rinsed with autoclaved-double-distilled H2O for 30 s, and dehydrated with 70, 95, and 100% ethanol. To ensure dehydration, slides were rinsed in fresh xylenes twice for 10 min. The dehydrated sections were stored in a dessicator until use. All sections were used within 24 h of dehydration. Microdissection was performed with an Arcturus PixCell II LCM system (Arcturus Engineering, Mountain View, CA), according to the manufacturers protocol. After microdissection, debris that had adhered nonspecifically to the CapSure film was removed using a CapSure Pad (Arcturus Engineering).
QRT-PCR.
After RNA isolation from the CapSure film using the PicoPure RNA isolation kit according to manufacturers instructions, RNA was treated with RQ1 RNase-free DNase (Promega, Madison, WI), at a concentration of 0.1units/µl, to remove genomic DNA. Using the isolated RNA as a template, cDNA was prepared using the Promega Reverse Transcription kit, according to manufacturers instructions. Using a Perkin-Elmer ABI 7700 Prism Sequence Detection System (Applied Biosystems, Foster City, CA), the relative abundance of cDNA corresponding to c-jun, c-fos, and hprt were quantitated relative to the levels in standard curves generated from C10 cells treated with 12-O-tetradecanoylphorbol-13-acetate for 2 h. Levels of c-jun and c-fos were then normalized to levels of hprt to allow comparisons between samples. Probes for QRT-PCR analysis used 6-FAM as a fluorophore and either TAMRA or Black Hole Quencher-1 (BHQ-1) as a quencher on the 3'-end. The forward (GAAAACCTTGAAAGCGCAAAAC) and reverse (CACCTGTTCCCTGAGCATGTT) primers and probe (6-FAM-CCGAGCTGGCATCCACGGC-TAMRA) used for QRT-PCR analysis of c-jun were purchased from Applied Biosystems. The forward primer for hprt (TTTGCCGCGAGCCG), reverse primer for hprt (TAACCTGGTTCATCATCGCTAATC), and probe for hprt (6-FAM-CGACCCGCAGTCCCAGCGTC-BHQ-1) were purchased from Biosearch Technologies (Novato, CA). The forward primer for c-fos (AATCCAGGGAGGCCACAGA), reverse primer for c-fos (CCGACCTGCCTGCAAGAT), and probe for c-fos (6-FAM-TCTCCTCTGGGAAGCCAAGGTCATCG-TAMRA) were also purchased from Biosearch Technologies. Probes for all three genes were used at a concentration of 200 nM. Primers were used at a concentration of 900 nM.
Statistical Analysis.
All data are presented as means ± SE. Statistical significance was evaluated by ANOVA using a Student Neuman-Keuls test. Ps
0.05 were considered statistically significant.
| Results |
|---|
|
|
|---|
0.05) in proliferation were first observed after 4 days exposure to asbestos in Tg- but not Tg+ mice in both these compartments (Fig. 1)
0.05) PCNA-positive epithelial cells were noted in Tg+ versus Tg- mice at 4 days in the distal bronchioles (Fig. 1a)
0.5) elevations in proliferation of alveolar epithelial cells when compared with Tg- sham mice (Fig. 1b)
0.05) in the alveolar duct region (Fig. 1d)
|
|
0.05) in mice after 3 and 9 days exposure to asbestos (10)
. This was also reflected by increases in the proportions of neutrophils at 3 and 9 days and of lymphocytes at 9 days. On the basis of these data, we examined patterns of inflammation at 9 days in Tg+ and Tg- animals. Both total cell counts and proportions of macrophages, lymphocytes, and neutrophils in BAL were similar in both sham and asbestos-exposed Tg+ and Tg- mice (Fig. 1, e and f)
The Induction of fos and jun Family Proto-Oncogenes Is Altered by Disruption of Signaling through EGFR.
In comparison to sham controls, analysis of lung tissue homogenates of Tg- mice by RPAs (see representative autoradiograph in Fig. 4a
) showed significant up-regulation (P
0.05) of fos and jun family members after 4 days of exposure to asbestos but no elevations at the 30-day time point, consistent with an early response (Fig. 3a)
. Lungs of Tg+ mice showed no elevations in fos and jun family members after inhalation of asbestos at either time point. QRT-PCR results from bronchiolar epithelium obtained by LCM show that c-fos and c-jun message levels were increased specifically in these cell types in C57/BL6 mice exposed to asbestos.
|
|
| Discussion |
|---|
|
|
|---|
Findings here may also be relevant to the development of mesothelioma and fibrosis as links between EGF, TGF-
, which binds to the EGFR, and cell proliferation have been demonstrated in mesothelioma cells (19)
. Moreover, patients with asbestosis, in comparison to control individuals, show increased amounts of the extracellular domain of the EGFR in sera (20)
. Previous work has also demonstrated that immunoreactivity of EGFR and TGF-
is increased after bleomycin-induced epithelial lung injury and pulmonary fibrosis (21)
. Overexpression of TGF-
targeted to lung epithelium using the human SP-C promoter causes the development of fibrotic lesions in transgenic mice (22)
that can be reversed in bi-transgenic TGF-
overexpressing mice crossbred with mice expressing a mutant EGFR (13)
. TGF-
null mutant mice also are resistant to bleomycin-induced pulmonary fibrosis and do not exhibit compensatory increases in other EGF family members in lung (23)
. The demonstration that TGF-
immunoreactivity is increased in pulmonary epithelium after brief inhalation of asbestos fibers (24)
also suggests that asbestos may cause biosynthesis of TGF-
which then may become available to cause phosphorylation of the EGFR. In addition, studies in our laboratory have shown that asbestos exposure in vitro induces increased EGFR mRNA and protein synthesis in mesothelial cells (9)
. Recent studies also suggest that growth factors such as platelet-derived growth factor or EGF may act in concert to cause phosphorylation events critical in mitogenesis of lung myofibroblasts and fibrogenesis (25)
.
We document here a temporal pattern of AP-1 family member proto-oncogene expression in the lungs of mice exposed to asbestos. The acute elevations at 4 but not 30 days are consistent with an early response and may be connected causally with cell proliferation. Numerous studies have indicated the involvement of AP-1 in the initiation of mitogenesis and transformation (reviewed in Ref. 26 ). Whereas c-Fos and c-Jun have been studied extensively, less is known about other members of the Fos/Jun family, including Fra-1, an AP-1 dependent gene as well as a prominent component of AP-1 complexes in C-10 (17) and mesothelial cells exposed to asbestos.4 A role for protracted Fra-1 expression in eliciting S-phase increases in response to silica or asbestos has been implicated in recent work (17) . Moreover, ERK-dependent Fra-1 transactivation has recently been linked to mitogenesis and tumor promotion in mouse epidermal cells (27) . Previous studies have also shown that c-fos is induced in an EGFR-dependent manner in mesothelial cells in vitro in response to asbestos (9) . It is noteworthy that results here are the first to show that EGFR phosphorylation plays a critical role in inducing fos/jun proto-oncogenes in both pulmonary epithelial cells in vitro and in an inhalation model of asbestos-induced proliferation. This work is also novel in that LCM and QRT-PCR are used to demonstrate that increased expression of AP-1 family members occurs specifically in asbestos-exposed bronchiolar epithelial cells.
Our results suggest a model for induction of asbestos-induced proliferation via phosphorylation of the EGFR. In this scheme, EGFR phosphorylation leads to activation of ERK 1/2. ERK 1/2 activation, in turn, leads to increased fos/jun family member expression and incorporation of the corresponding proteins into AP-1 complexes. Subsequent AP-1 activation then favors cell cycle progression and proliferation of epithelial cells. The resulting hyperplasia may then contribute to the development of lung cancers and mesothelioma. More importantly, our work shows that asbestos-induced epithelial cell proliferation can be prevented by inhibiting phosphorylation of the EGFR, a finding that may be applicable to control of epithelial cell responses to asbestos and other environmental insults, including oxidants and UV irradiation, which phosphorylate the EGFR (28, 29, 30) . Given the fact that inhibitors of EGFR function are already in advanced stages of clinical trials, linking the inhibition of EGFR function with the prevention of progression of asbestos-related diseases may point to a possible therapeutic strategy for these diseases (31) .
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by NIH Grant ES/HL09213 (to B. T. M.) and T32 ES07122 (to C. B. M.). ![]()
2 To whom requests for reprints should be addressed, at University of Vermont College of Medicine, Department of Pathology, 89 Beaumont Avenue, Burlington, VT 05405. Phone: (802) 656-0382; Fax: (802) 656-8892; E-mail: Brooke.Mossman{at}uvm.edu ![]()
3 The abbreviations used: EGFR, epidermal growth factor receptor; EGF, epidermal growth factor; ERK, extracellular signal-regulated protein kinase; AP-1, activator protein 1; Tg+, transgene positive, Tg-, transgene negative; SP-C, surfactant protein C; BrdUrd, 5' bromodeoxyuridine; PCNA, proliferating cell nuclear antigen; BAL, bronchoalveolar lavage; QRT-PCR, quantitative reverse transcriptase-PCR; 6-FAM, 6-carboxyl-fluorescein; TAMRA, 6-carboxyl-tetramethyl rhodamine; LCM, laser capture microdissection; RPA, ribonuclease protection assay; TGF-
, transforming growth factor
. ![]()
4 M. Ramos-Ninos, C. Timblin and B. Mossman, Mesothelial cell transformation requires increased AP-1 binding and ERK-dependent Fra-1 expression, submitted. ![]()
Received 5/ 1/02. Accepted 6/18/02.
| REFERENCES |
|---|
|
|
|---|
mice by expression of mutant epidermal growth factor receptor. Am. J. Respir. Cell Mol. Biol., 15: 499-508, 1996.[Abstract]
in asbestos-transformed rat mesothelial cells. Cancer Res., 55: 530-536, 1995.
is increased following bleomycin-induced lung injury in rats. Am. J. Respir. Cell Mol. Biol., 11: 540-551, 1994.[Abstract]
induces lung fibrosis in transgenic mice. J. Clin. Investig., 93: 1691-1699, 1994.
deficiency reduces pulmonary fibrosis in transgenic mice. Am. J. Respir. Cell Mol. Biol., 20: 924-934, 1999.
in the bronchiolar-alveolar duct regions of asbestos-exposed rats. Am. J. Pathol., 149: 205-217, 1996.[Abstract]
This article has been cited by other articles:
![]() |
S. A. Buder-Hoffmann, A. Shukla, T. F. Barrett, M. B. MacPherson, K. M. Lounsbury, and B. T. Mossman A Protein Kinase C{delta}-Dependent Protein Kinase D Pathway Modulates ERK1/2 and JNK1/2 Phosphorylation and Bim-Associated Apoptosis by Asbestos Am. J. Pathol., February 1, 2009; 174(2): 449 - 459. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jeulin, V. Seltzer, D. Bailbe, K. Andreau, and F. Marano EGF mediates calcium-activated chloride channel activation in the human bronchial epithelial cell line 16HBE14o-: involvement of tyrosine kinase p60c-src Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L489 - L496. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Manning, T. Sabo-Attwood, R. F. Robledo, M. B. MacPherson, M. Rincon, P. Vacek, D. Hemenway, D. J. Taatjes, P. J. Lee, and B. T. Mossman Targeting the MEK1 Cascade in Lung Epithelium Inhibits Proliferation and Fibrogenesis by Asbestos Am. J. Respir. Cell Mol. Biol., May 1, 2008; 38(5): 618 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Levis, R. Loi, K. J. Butnor, P. Vacek, C. Steele, B. T. Mossman, and D. J. Weiss Decreased Asbestos-Induced Lung Inflammation and Fibrosis after Radiation and Bone Marrow Transplant Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 16 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Riganti, S. Orecchia, F. Silvagno, G. Pescarmona, P. G. Betta, E. Gazzano, E. Aldieri, D. Ghigo, and A. Bosia Asbestos Induces Nitric Oxide Synthesis in Mesothelioma Cells via Rho Signaling Inhibition Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 746 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Haegens, T. F. Barrett, J. Gell, A. Shukla, M. MacPherson, P. Vacek, M. E. Poynter, K. J. Butnor, Y. M. Janssen-Heininger, C. Steele, et al. Airway Epithelial NF-{kappa}B Activation Modulates Asbestos-Induced Inflammation and Mucin Production In Vivo J. Immunol., February 1, 2007; 178(3): 1800 - 1808. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shukla, T. F. Barrett, K. I. Nakayama, K. Nakayama, B. T. Mossman, and K. M. Lounsbury Transcriptional up-regulation of MMP12 and MMP13 by asbestos occurs via a PKC{delta}-dependent pathway in murine lung FASEB J, May 1, 2006; 20(7): 997 - 999. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Frasca, E. Van der Put, A. M. Landin, D. Gong, R. L. Riley, and B. B. Blomberg RNA Stability of the E2A-Encoded Transcription Factor E47 Is Lower in Splenic Activated B Cells from Aged Mice J. Immunol., November 15, 2005; 175(10): 6633 - 6644. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Haegens, A. van der Vliet, K. J. Butnor, N. Heintz, D. Taatjes, D. Hemenway, P. Vacek, B. A. Freeman, S. L. Hazen, M. L. Brennan, et al. Asbestos-Induced Lung Inflammation and Epithelial Cell Proliferation Are Altered in Myeloperoxidase-Null Mice Cancer Res., November 1, 2005; 65(21): 9670 - 9677. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sithanandam, G. T. Smith, J. R. Fields, L. W. Fornwald, and L. M. Anderson Alternate Paths from Epidermal Growth Factor Receptor to Akt in Malignant Versus Nontransformed Lung Epithelial Cells: ErbB3 Versus Gab1 Am. J. Respir. Cell Mol. Biol., November 1, 2005; 33(5): 490 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sabo-Attwood, M. Ramos-Nino, J. Bond, K. J. Butnor, N. Heintz, A. D. Gruber, C. Steele, D. J. Taatjes, P. Vacek, and B. T. Mossman Gene Expression Profiles Reveal Increased mClca3 (Gob5) Expression and Mucin Production in a Murine Model of Asbestos-Induced Fibrogenesis Am. J. Pathol., November 1, 2005; 167(5): 1243 - 1256. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Baldys and A. E. Aust Role of Iron in Inactivation of Epidermal Growth Factor Receptor after Asbestos Treatment of Human Lung and Pleural Target Cells Am. J. Respir. Cell Mol. Biol., May 1, 2005; 32(5): 436 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yuan, D. J. Taatjes, B. T. Mossman, and N. H. Heintz The Duration of Nuclear Extracellular Signal-Regulated Kinase 1 and 2 Signaling during Cell Cycle Reentry Distinguishes Proliferation from Apoptosis in Response to Asbestos Cancer Res., September 15, 2004; 64(18): 6530 - 6536. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Whitsett, C. J. Bachurski, K. C. Barnes, P. A. Bunn Jr., L. M. Case, D. N. Cook, D. Crooks, M. W. Duncan, L. Dwyer-Nield, R. C. Elston, et al. Functional Genomics of Lung Disease Am. J. Respir. Cell Mol. Biol., August 1, 2004; 31(2/S1): S1 - S81. [Full Text] [PDF] |
||||
![]() |
S. Blanchet, K. Ramgolam, A. Baulig, F. Marano, and A. Baeza-Squiban Fine Particulate Matter Induces Amphiregulin Secretion by Bronchial Epithelial Cells Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 421 - 427. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Nguyen, W. D. Schrump, G. A. Chen, W. Tsai, P. Nguyen, J. B. Trepel, and D. S. Schrump Abrogation of p21 Expression by Flavopiridol Enhances Depsipeptide-Mediated Apoptosis in Malignant Pleural Mesothelioma Cells Clin. Cancer Res., March 1, 2004; 10(5): 1813 - 1825. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kaminski, J. A. Belperio, P. B. Bitterman, L. Chen, S. W. Chensue, A. M.K. Choi, S. Dacic, J. H. Dauber, R. M. du Bois, J. J. Enghild, et al. Idiopathic Pulmonary Fibrosis Am. J. Respir. Cell Mol. Biol., September 1, 2003; 29(3): S1 - 105. [Full Text] [PDF] |
||||
![]() |
E. C. Borden, L. H. Baker, R. S. Bell, V. Bramwell, G. D. Demetri, B. L. Eisenberg, C. D. M. Fletcher, J. A. Fletcher, M. Ladanyi, P. Meltzer, et al. Soft Tissue Sarcomas of Adults: State of the Translational Science Clin. Cancer Res., June 1, 2003; 9(6): 1941 - 1956. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |