| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Stabilization
Institute of Virology, Slovak Academy of Sciences, Bratislava, Slovak Republic [S. K., M. K., A. C., S. P., J. P.]; British Columbia Cancer Research Centre and British Columbia Cancer Agency, Vancouver, British Columbia, V5Z 1L3 Canada [P. L. O.]; Laboratory of Immunobiology, National Cancer Institute, NIH, Bethesda, Maryland 20889 [M. I. L.]; and Department of Microbiology and Molecular Genetics, University of California, Irvine, California 92717 [E. J. S.]
| ABSTRACT |
|---|
|
|
|---|
was not observed in dense cultures. In contrast to sparse cell culture conditions, phosphatidylinositol 3'-kinase (PI3K) activity was significantly increased in dense HeLa cultures. The PI3K inhibitors LY294002 and wortmannin inhibited CAIX expression in dense cultures in a dose-dependent manner, specifically targeting the CA9 promoter (-173/+31 region) that was transactivated by constitutively active p110 PI3K subunit. The mechanism controlling CAIX expression in dense cultures is, however, dependent on lowered O2 tension because stirring abrogates induction of CAIX expression. Hypoxia- and cell density-induced CAIX expressions were mediated by two seemingly independent mechanisms, as documented by the additive effect of increased cell density and treatment with the hypoxia-mimic CoCl2 on levels of CAIX expression. The minimal cell density-dependent region within the CA9 promoter consists of the juxtaposed protected region 1 and hypoxia-response elements. However cell density-dependent CAIX expression was abrogated in the HIF-1
-deficient Kal3.5 cells, suggesting an important role of HIF-1 in the corresponding mechanism. Thus, induction of CAIX in high-density cultures requires separate but interdependent pathways of PI3K activation and a minimal level of HIF-1
. These interdependent pathways function at a lowered O2 concentration that is, however, above that necessary for HIF-1
stabilization. | INTRODUCTION |
|---|
|
|
|---|
In comparison with normal tissues, solid tumors are poorly oxygenated and contain hypoxic regions. Observations that expression of the transmembrane CA CAIX is induced under hypoxic conditions in cultured cells and of expression of CAIX in hypoxic regions of human tumors are suggestive of the potentially important role of CAIX in tumor adaptation to hypoxic conditions (3 , 6) . By catalyzing the reversible hydration of carbon dioxide, hypoxia-inducible CAIX activity may influence tumor pHe (3) . It is widely accepted that pHe in tumors is acidic due to increasing lactate production by glycolysis (7) , and CAs may contribute to maintaining more neutral intracellular pH at the expense of lowering pHe (3) . CAIX was postulated as an intrinsic marker of tumor hypoxia, and its clinical usefulness was indicated because the scoring of its expression in clinical samples is rapid, reproducible, and simple (8) .
Preliminary characterization of the CA9 promoter identified a functional HRE (6) . Under hypoxic conditions, HREs are transactivated by the key mediator of hypoxic response, HIF-1 (9) . However, it is now clear that a number of genes whose regulatory regions contain a HRE and are activated via stabilization of HIF-1 may also be regulated in a HIF-1-independent fashion (10 , 11) . In the case of CAIX, recent studies showed significant overlap between CAIX expression and regions of hypoxia in solid tumors, but expression of CAIX extended beyond the hypoxic regions (6 , 12) . This partial discordance raised questions about the mechanism(s) governing CAIX expression and the role of HIF-1 in regulation of CAIX expression at intermediate O2 levels.
Relatively little is known about the molecular mechanisms controlling CAIX expression. Functional analysis of the CA9 upstream sequence suggested that the (-173/+31) region (designated as the CA9 promoter) contains the critical regulatory elements (13) . Within this region, five PRs, PR15, were identified by DNase I protection assay under normoxic conditions (13) . Detailed mutational analysis identified SP1/SP3 and AP1 as the critical factors binding PR1 and PR2, respectively (14) .
A functional TACGTGCA HRE was identified immediately upstream of the CA9 transcription start in the position (-3/-10) on the antisense strand (6)
. HIF-1, which binds HRE, is a heterodimeric transcription factor consisting of the regulated HIF-1
and constitutive HIF-1ß subunits (15)
. Activity of the
subunit can be increased through stabilization by either low oxygen concentration (16)
or inactivation of the VHL tumor suppressor gene (17)
. VHL forms part of the ubiquitin-ligase complex that targets the HIF-1
subunit for oxygen-dependent proteolysis (17)
. In renal carcinoma cells defective for VHL, constitutive CAIX up-regulation is associated with the loss of O2-dependent regulation, consistent with the critical function of VHL in the regulation of HIF-1 (6)
. In addition to stabilization of the HIF-1
protein, the HIF-1
promoter can be transactivated under apparently normoxic conditions by a number of stimuli, including cytokines (18
, 19) , hormones (20
, 21)
, and growth factors (22
, 23)
.
To increase our knowledge of the regulation of CAIX expression, we have used the experimental model of sparse and dense cultures for studying O2-related mechanisms of inducible CAIX expression. The dependence of CAIX expression on cell density in vitro is striking: the protein is absent in sparse, rapidly proliferating HeLa cells; whereas its synthesis is induced in dense, overcrowded (albeit still proliferating) cultures that express CAIX protein in significant amounts (2) . As a part of our ongoing effort to understand the molecular mechanisms governing CAIX expression, we were interested in mechanism(s) that were differentially activated in sparse/dense cultures. In this study, we have identified the role of the PI3K pathway in the induction of CAIX expression in dense HeLa cultures. We have also mapped the cis elements in the CA9 promoter that are necessary for the density-dependent induction of CAIX expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Constructions.
pBMN5, MN6, and MN7 constructs contain the (-173/+31), (-45/+31), and (-30/+31) CA9 fragments, respectively, in the pBLCAT6 vector (24)
. pBMN5PR1mut and pBMN5HREmut are pBMN5 derivatives with point mutations (underlined) in the PR1 [(-45/-24); GGCTTGCTCCTAACCCACCCAG] and HRE [(-19/+8); CGTTTCCAATGCTTTTACAGCCCGTAC] CA9 regions, respectively. The (-173/+31) fragment was also cloned in the firefly luciferase pGL2 basic vector (Promega). pRL-CMV (Promega) was used as an internal control for the luciferase construct. pBLCAT5, used as a control for cell density-dependent activation, contains the herpes simplex virus thymidine kinase promoter (24)
. Plasmids CD2p110 and CD2p110KD expressing a constitutively active mutant of PI3K p110 catalytic subunit and its kinase-dead mutant, respectively, were kindly provided by Dr. D. A. Cantrell (Cancer Research UK, London, United Kingdom; Ref. 25
).
Cell Culture and Transfections.
The cervical carcinoma cell line HeLa and the fibrosarcoma cell line HT 1080 were grown in DMEM (BioWhittaker) supplemented with 10% FCS (Life Technologies, Inc.) and 0.16 mg/ml gentamicin (Sigma). The Chinese hamster ovary cell lines C4.5 (control) and Kal3.5 (HIF-1
deficient; Ref. 26
), kindly provided by Dr. P. J. Ratcliffe, were grown in Hams F-12 medium (Life Technologies, Inc.) supplemented with 10% FCS, L-glutamine (2 mM), penicillin (50 IU/ml), and streptomycin sulfate (50 µg/ml). The effects of cell density, stirring, pH, glucose, inhibitors, hypoxia-mimic CoCl2, and dense culture-conditioned medium on levels of endogenous CAIX were tested on the cells that had been seeded at 10,000 cells/cm2 and grown for 3 days. These cells were then plated at varying densities, incubated with or without gentle stirring at 37°C, and harvested after 24 h. The effect of medium height was investigated on cells plated at 160,000 cells/cm2 for 12 h. The effect of PI3K inhibitors LY294002 (Calbiochem) and wortmannin (Sigma) and the nitric oxide synthase inhibitor S-isopropylisothiourea (Alexis Corp.) was tested on cells seeded at 160,000 cells/cm2 for 24 h. Controls for LY294002 and wortmannin were treated with appropriate volumes of DMSO vehicle. HIF-1
levels were tested in cells seeded at varying densities in the presence or absence of 240 µM CoCl2 with or without stirring for the indicated intervals. Dense culture-conditioned medium was prepared by plating cells at 160,000 cells/cm2, changing the medium after 24 h, and incubating cells for an additional 24 h. Conditioned medium was gently added to cells plated at 20,000 cells/cm2 and incubated for 24 h.
For transient cotransfections of HeLa, C4.5, and Kal3.5 cells with the (-173/+31) CA9 fragment in pGL2 vector and pRL-CMV plasmid, Effectene Transfection Reagent (Qiagen) was used. Transfectants were treated with the indicated concentrations of LY294002 for 48 h and harvested 52 h after transfection. Luciferase (firefly and Renilla) activities were assayed with the dual-luciferase reporter assay system (Promega) in a Monolight 2010 luminometer. For mapping of the minimal cell density-dependent CA9 region, a modification of the standard transient transfection procedure (GenePORTER 2; Gene Therapy Systems) was used. After 4 h at 37°C, the cells transfected with CA9 fragments in pBLCAT6 vector were rinsed with PBS and trypsinized, and the suspension was split into halves that were seeded at 20,000 and 160,000 cells/cm2 and cultivated for an additional 48 h. CAT activity was assayed with the CAT ELISA kit (Roche). CAT activities from at least three independent experiments were normalized against protein concentration determined with the BCA Protein Assay Reagent (Pierce).
Western Blot Analysis.
For CAIX protein, total cellular protein was prepared from control and appropriately treated cells 24 h after plating by lysis with radioimmunoprecipitation assay buffer [7.5 mM phosphate buffer (pH 7.2), 140 mM NaCl, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, and 10 µg/ml aprotinin] at 4°C for 10 min. For HIF-1
, approximately 450,000 cells were seeded at varying densities. Control and treated cells were scraped into 100 µl of 1x sample buffer [62.5 mM Tris (pH 6.8), 2% SDS, 10% glycerol, 50 mM dithiotreitol, and 0.01% bromphenol blue] and passed through a needle several times to decrease the viscosity of the lysate. Samples containing 30 µg of protein (for CAIX protein) or 50 µl of lysate (for HIF-1
) were electrophoretically separated by 8% SDS-PAGE and transferred onto an Immobilon-P transfer membrane (Millipore). The membrane was blocked in ST buffer [20 mM Tris (pH 7.5), 150 mM NaCl, and 0.1% Tween 20] containing 5% nonfat milk for 1 h, incubated with 0.75 µg/ml anti-CAIX monoclonal Ab M-75 (27)
or rabbit anti-HIF-1
Ab (Santa Cruz Biotechnology) in blocking buffer for 1 h at room temperature, and washed three times with ST buffer for 5 min. The membrane was then incubated with horseradish peroxidase-conjugated antimouse or antirabbit Ab (1:5000; Santa Cruz Biotechnology) for 1 h at room temperature and washed three times with ST buffer for 5 min, and immune complexes were detected with SuperSignal Chemiluminiscent Substrate (Pierce). To verify equal protein loading, the membrane was reprobed with a monoclonal anti-ß-actin Ab (Sigma).
PI3K Activity.
HeLa cells (3 x 106) were seeded at 20,000 and 160,000 cells/cm2 and grown for 24 h. Cells were rinsed with ice-cold PBS, scraped, and lysed for 5 min on ice with 0.5 ml of cell lysis buffer [20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM Na PPI, 1 mM ß-glycerolphosphate, 1 mM Na3VO4, 10 µg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride]. The lysate was sonicated four times (5 s each) on ice and centrifuged for 10 min. Tyrosine-phosphorylated proteins were immunoprecipitated by rocking 100 µg of total protein with 2 µg of monoclonal anti-phosphotyrosine Ab (Cell Signaling Technology) at 4°C overnight. The immune complexes were bound to protein A-Sepharose CL-4B (Amersham Pharmacia Biotech) for 3 h at 4°C. The immunoprecipitates were washed twice with PBS containing 1% NP40 and 200 µM Na3VO4; once with 0.5 M LiCl, 100 mM Tris (pH 7.4), and 200 µM Na3VO4; and twice with 10 mM Tris (pH 7.4), 100 mM NaCl, 1 mM EDTA, and 200 µM Na3VO4. The beads were mixed with 10 µg of phosphoinositide (Sigma), [
-32P]ATP (0.37 MBq, 925 TBq/mmol; ICN), and 30 µl of 40 mM HEPES (pH 7.5), 20 mM MgCl2 and incubated at 37°C for 30 min. The reaction was stopped by the addition of 40 µl of 4 M HCl and 160 µl of CHCl3/CH3OH (1:1). The organic phase was recovered and applied to a silica gel thin layer chromatography plate precoated with 1% potassium oxalate (Analtech). The plate was developed in CHCl3/CH3OH/H2O/NH4OH (60:47:11.3:2), dried, and autoradiographed.
| RESULTS |
|---|
|
|
|---|
|
|
Levels in HeLa Cells.
levels (compared with sparse cultures) were found in dense cultures of some cell lines possessing constitutively active HIF-1 under normoxic conditions (29
, 30)
. This led to the suggestion that confluence (dense cultures) under normoxic conditions induces HIF-1
levels due to mild hypoxia from cell-to-cell contact (30)
. The above-mentioned reports prompted us to investigate the possible involvement of HIF-1
in cell density-induced CAIX expression in HeLa cells. To this end, we analyzed HIF-1
levels in lysates prepared from cells plated at different densities by Western blotting. Under these conditions, HIF-1
Ab recognized Mr 115,000 and Mr 105,000 bands constitutively present at a relatively low level. The amount of this protein did not change appreciably after 4, 8 (data not shown), and 24 h over the whole range of densities tested (Fig. 3)
forms are independent of cell density (Fig. 3)
expression remains constant during the hypoxia mimic treatment. We conclude that HeLa cells constitutively express a small amount of labile HIF-1
that is not regulated by cell density and that the activation of cell density-mediated CAIX expression is independent of HIF-1
stabilization.
|
-ATP and phosphatidylinositol. PI3K activity in dense cultures is two to three times higher than that observed in sparse cultures (Fig. 4)
|
|
protein compared with hypoxia mimic alone. There was also a decrease in the amount of CAIX protein compared with hypoxia mimic only. However, in the case of dense culture alone, there was substantially more CAIX protein, even though there were barely detectable levels of active HIF-1
protein. And, in the presence of LY294002, there was almost complete absence of CAIX protein. The decrease in HIF-1
protein seen in the condition of hypoxia mimic plus LY294002 is possibly a result of LY294002-mediated inhibition of transcriptional activation of the HIF-1
promoter (34)
. However, this point will require further investigation. Thus, these results further support our conclusion that high density culture conditions induce significant CAIX protein in the absence of significant levels of HIF-1
protein and that this induction is almost completely inhibited by the PI3K inhibitor LY294002.
The (-173/+31) CA9 promoter appears to contain cis elements essential for CA9 transcription at high cell density. To test the effects of PI3K inhibition on the CA9 promoter, HeLa cells were transiently transfected with a reporter construct driven by the (-173/+31) CA9 fragment and treated with LY294002. Reporter assays confirmed that there is a dose-dependent inhibition of expression from the CA9 promoter by LY294002, whereas the control cytomegalovirus promoter was unaffected by the tested inhibitor concentrations (Fig. 5C)
. This confirms that the PI3K-dependent mechanism activated in dense cultures specifically targets the (-173/+31) CA9 promoter region.
Constitutively Active p110 PI3K Subunit Activates the CA9 Promoter.
To gain further insight into the role of PI3K in the regulation of CA9 transcription, we studied the effects of overexpression of the constitutively active p110 PI3K subunit on CA9 promoter activity. We transiently cotransfected HeLa cells with the CA9 promoter reporter construct and a construct expressing either the constitutively active p110 PI3K subunit or its kinase-dead mutant. Compared with the kinase-dead mutant, the constitutively active p110 transactivated the CA9 promoter 3-fold (Fig. 6)
.
|
. Other investigators have recently shown that, in comparison with pO2 in equilibrated medium (16%; 116 mmHg), pO2 close to the surface of plated cells 48 h after plating was 13% (96 mmHg) for sparse and 9% (70 mmHg) for dense LNCaP human prostate carcinoma cells (29)
. Although some changes in pO2 occur near the cell surface of dense cultures, these changes are relatively small and are not as low as those seen in experimentally induced hypoxic responses (0.11%). Despite this, elimination of the pO2 gradient by gentle shaking prevented activation of a HRE-driven reporter, leading to the conclusion that the formation of this small gradient is an important component of cell density-mediated transcriptional activation (29)
. We also studied the effects of oxygenation on CAIX expression. A pO2 gradient was generated by incubating cells plated at 160,000 cells/cm2 with varying volumes of medium. We found that covering cells with 1.5 mm of medium already induced CAIX expression after 12 h. Increasing the medium height up to 3 mm led to further induction of CAIX expression (Fig. 7A)
activity (data not shown). We also tested the effects of reoxygenation by gentle stirring on CAIX expression. Cells were plated at 160,000 cells/cm2, covered with 1 cm of medium, allowed to attach for 5 h, and stirred for an additional 12 h. Reoxygenation by stirring abolished CAIX induction (Fig. 7B)
|
(Fig. 8B
; and (c) despite being dependent on a lowered O2 level, the cell density-mediated mechanism does not depend on the O2 sensor that is linked with stabilization of HIF-1
. Taken together, these results confirm that cell density-induced CAIX expression is brought about by pericellular mild hypoxia that is independent of HIF-1
stabilization.
|
|
We therefore conclude that the cell density-induced mechanism requires cooperation between factors bound to PR1 and factors bound to the neighboring HRE. Thus, the (-45/+31) fragment, containing the HRE and PR1, appears to be the minimal CA9 region that can be induced by cell density.
Cell Density-induced CAIX Expression Is Dependent on HIF-1
.
Mutational analysis demonstrated that for cell density-mediated CA9 promoter activation even in the absence of HIF-1
stabilization, the functional HRE was required. This suggested that HIF-1 activity could be involved in cell density-dependent transcriptional activation. To test this hypothesis, we used HIF-1
-deficient Kal3.5 cells (26)
and investigated the activity of the CA9 promoter under conditions of increased cell density. In transiently transfected control C4.5 cells, the CA9 promoter was activated by CoCl2 and increased cell density (Fig. 10)
. In Kal3.5 cells, however, the promoter was not activated by CoCl2 and was moderately activated by cell density (1.5x, compared to 89x in C4.5 cells; Fig. 10
). Thus, we conclude that there is an essential role for some minimal level of HIF-1 activity for cell density-induced CAIX expression.
|
| DISCUSSION |
|---|
|
|
|---|
-independent fashion (10
, 11)
. In the case of CAIX, recent studies have shown substantial but incomplete colocalization of CAIX expression and regions of hypoxia in tumors, with CAIX-positive areas extending beyond regions of hypoxia (6
, 12)
. This partial discordance suggested the existence of additional pathway(s) that controls CAIX expression under pathophysiological conditions in tumors independently of HIF-1
stabilization. Compared with cells grown in sparse culture, cells in dense cultures have to adjust to greatly changed conditions by down- and up-regulating expression of appropriate genes. In doing so, they alter the expression pattern of cell surface receptors, transcription factors, enzymes, oncogenes, and growth factors (28) . CAIX also ranks among the proteins regulated by cell density; it is not detectable in sparse HeLa cultures, but it is present in large amounts in dense HeLa cultures. Because of this strikingly tight correlation with cell density, we chose this cervical cell line as a model system for studying mechanisms participating in CAIX regulation. Investigation of differences between sparse and dense HeLa cultures should primarily identify pathways that are differentially activated in these cultures and are required for CAIX expression. Although not fully reflecting the situation inside tumors, this model of transformed cells is easy to study in vitro, and conclusions from this comparative study could be of certain relevance to carcinogenesis in vivo.
Study of the process of cell density-induced CAIX expression in HeLa cells allowed us to draw the following conclusions: (a) this process is anchorage independent because growing cells on agarose-coated plates had no effect on CAIX levels; (b) this process is not mediated by a soluble factor because conditioned medium from dense cultures had no effect on CAIX levels in sparse cells; and (c) this process is serum independent because serum-starved cells still expressed CAIX, albeit with a reduced efficiency. Although these results appeared to implicate the importance of cell-cell contacts, additional experiments confirmed that cell contacts per se do not initiate CAIX expression. Instead, we proved the importance of microenvironmental factors that prevail in dense cultures. The microenvironmental factors could be eliminated by gentle stirring, and of these factors, we considered acidosis, glucose deprivation, and lowered O2 concentrations, all of which can have an effect on VEGF expression (35
, 36)
. Lowered medium pH as well as decreased glucose concentration failed to elicit any effect on CAIX expression in HeLa cells. Apparently, the pO2 gradient produced by depletion and limited diffusion of O2 in dense cultures (37)
is the major causative factor in the CAIX induction by cell density. However, the pO2 gradient produced under these conditions is modest (9% in dense cultures compared with 13% in sparse cultures; Ref. 29
) and well above the concentrations used for hypoxic inductions (0.11%). This argued that the effect of mild hypoxia in dense cultures is not mediated by HIF-1 but by a novel pathway that is turned on at intermediate O2 levels that are higher concentrations than that required for HIF-1
stabilization.
Several lines of evidence suggest that transcription of genes coding for CAIX and the angiogenic factor VEGF may be regulated in similar ways. Both genes possess functional HREs; in the case of VEGF, it reads TACGTGGG [position (-975/-967); Refs. 6 and 9 ]. Expression of both proteins is positively correlated with increasing cell density in vitro (23 , 28 , 38) . The factors that trigger VEGF induction in dense cultures may depend on the cells used: in human colon carcinomas, it appeared to be a soluble factor (28) ; whereas in U87 glioblastoma-astrocytoma cells, the presence of such a factor was ruled out (38) . In the latter study, the mitogen-activated protein kinase pathway was implicated in the cell density-mediated induction of VEGF (38) .
Although undoubtedly critical for hypoxic induction, it is noteworthy that HRE does not always play a critical role in VEGF regulation. VEGF promoter fragments with or without HRE were stimulated to the same level after treatment with epidermal growth factor (10) . Differential expression of VEGF in human pancreatic adenocarcinoma cells was also independent of HRE but correlated strongly with differential levels of constitutive SP1 activity (11) . Glioblastoma cells express high levels of VEGF in the absence of external stimuli, suggesting the existence of factors intrinsic to these cells and independent of the environment (10) .
Analogies with VEGF prompted us to test the involvement of the PI3K pathway in cell density-dependent CAIX expression. Several lines of evidence confirm the crucial role of PI3K in the process of cell density-induced CAIX expression. We found that the dense HeLa culture displayed significantly higher PI3K activity than the sparse culture. Also, pharmacological inhibitors of PI3K activity, LY294002 and wortmannin, efficiently suppressed CAIX expression in dense cultures in a dose-dependent manner. In addition, we were able to demonstrate that the cell density-induced mechanism mediated by PI3K specifically targets the (-173/+31) CA9 promoter. Finally, the constitutively active PI3K p110 mutant transactivated the CA9 promoter.
The requirement of PI3K activity for cell density-dependent CAIX expression may provide a link between the tumor-associated nature of CAIX protein and the well-established role of the PI3K pathway in tumorigenesis (39) . Mutations in several proteins in the PI3K/Akt and mammalian target of rapamycin/p70S6K signaling pathways, which regulate cell survival (40) , growth (41) , and proliferation (42) , are causally involved in a high percentage of common human malignancies (39) . In addition, numerous human malignancies are associated with inactivating mutations in the tumor suppressor gene PTEN (43) , a 3'-phosphoinositide phosphatase that dephosphorylates PI3K products. It is possible that tumors with deregulated PI3K activity may express CAIX constitutively. Additional studies will be required to investigate this possibility.
Hypoxia has a profound activating effect on CAIX expression, implicating HIF-1 as a strong regulator of the CA9 promoter (6)
. HIF-1 activity is dependent on the availability of its HIF-1
subunit (15
, 16)
. The emerging theme from several recent reports is that there are two mechanistically distinct modes of increasing the total available amount of HIF-1
(44
, 45)
. The first is mediated by the posttranslational stabilization of HIF-1
as a result of either hypoxic conditions (16)
or defects in the VHL-dependent degradation pathway (17)
. The second appears to induce HIF-1 activity via transcriptional activation of HIF-1
(18, 19, 20, 21, 22)
. In the latter group, the role of the PI3K pathway has received much attention lately. Several earlier studies indicated that the PI3K pathway might be involved in the transcriptional activation of HIF-1
(31, 32, 33)
; however, evidence presented in more recent reports distinguishes induction of HIF-1 activity from activation of the PI3K pathway (44
, 45) . Chemical or genetic interference with PI3K completely prevented Akt activation without affecting the stabilization of HIF-1
by hypoxia (18
, 46)
. Furthermore, the enhancement of VEGF induction by hypoxia found in cells with a constitutively active PI3K pathway is not mediated by HIF (10)
.
All these reports, together with the suggestion that cell-to-cell contact causes mild hypoxia (30)
and the observation that HIF-1 activity depends on cell density in prostate cell lines (29)
, prompted us to investigate levels of HIF-1
in HeLa cultures of various densities. We were unable to detect any changes of HIF-1
levels as a consequence of increased density. At the same time, HIF-1
levels increased substantially in response to treatment with hypoxic mimics. The observation that the steady-state levels of HIF-1
are not subject to change at high cell density distinguishes the mechanisms of cell density-dependent induction of CAIX from that of induction due to hypoxia-mediated HIF-1
stabilization. However, this does not rule out participation of a minimal level of active HIF-1
.
The requirement for PI3K activation and a minimal level of active HIF-1
at high cell densities suggests that there are two separate but interdependent pathways for CAIX induction. PI3K activity and HIF-1
activity both appear to contribute to CAIX induction at high cell density and under conditions of true hypoxia. However, PI3K plays the major inducing role at high cell density, whereas HIF-1 takes on this major role under true hypoxic conditions.
We have identified the critical cis elements that are required for the cell density-dependent induction of the CA9 promoter. Deletion and mutational analysis revealed that PR1 and the HRE together are necessary and sufficient for density-dependent transactivation of the CA9 promoter. Characterization of PR1 was the subject of our recent study in which we defined PR1 as a functional SP1 site binding SP1/SP3 factors (14) . For a long time, there was a widely held notion that SP1 sites represent constitutive promoter elements that support basal transcription from these promoters (47) . However, there is now mounting evidence that SP1 sites can participate in modulation of gene activity by binding differentially expressed Krüppel-like factors with which they share binding sites. These factors play an important role in growth factor signal transduction pathways (48) and apoptosis (49) and can be the subject of modulation by oncogene proteins, tumor suppressors, and cell cycle control molecules (47) . We are currently investigating the mechanism of transcriptional activation from the PR1-HRE module and the role of SP1/SP3 factors in this process.
Finally, by using HIF-1
-deficient Chinese hamster ovary cells, we proved that in the absence of HIF-1
, not only hypoxia-mediated but also cell density-mediated CAIX expression is lost. This shows that the small amount of constitutive HIF-1
present under these conditions plays an essential role in cell density-dependent activation of the CA9 promoter. Unlike the expression of VEGF, which can be independent of HRE/HIF-1 (10
, 11)
, activation of CAIX expression requires functional HRE and HIF-1
activity.
In this report, we provide evidence for an alternative pathway that controls CAIX expression. Based on our results, we have developed the following model (Fig. 11)
: there are two pathways controlling CAIX expression, both of which involve HIF-1
. Both pathways are O2 sensitive, and they differ in the O2 threshold required for their initiation. The intermediate O2 levels generated by high cell density do not increase the overall amount of HIF-1
but activate PI3K by an as yet undetermined mechanism, which, in turn, affects induction of CAIX expression. This induction itself is also dependent on a minimal level of HIF-1
activity. However, for efficient activation, cooperation between factors that bind both the PR1 and HRE domains is required. Under conditions of true hypoxia, stabilization of HIF-1
occurs that leads to a lower level of CAIX induction in the absence of PI3K activity, as seen in the LY294002 experiments.
|
It may also explain why certain human tumors, other than those with defective VHL, constitutively express CAIX, i.e., due to constitutive PI3K activity. These possibilities are currently under investigation.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by National Cancer Institute Grant CA 19401, The Avon Foundation, and Research Grant 2/6074/99 from the Slovak Scientific Grant Agency and Bayer Corp. ![]()
2 S. K. and M. K. contributed equally to this work. Present address for both of these authors: Department of Microbiology and Molecular Genetics, Medical Science I B210, University of California at Irvine, CA 92697-4025. ![]()
3 To whom requests for reprints should be addressed, at Department of Microbiology and Molecular Genetics, Medical Science I B210, University of California at Irvine, CA 92697-4025. Phone: (949) 824-5259; Fax: (949) 824-8598; E-mail: ejstanbr{at}uci.edu ![]()
4 The abbreviations used are: CAIX, MN/carbonic anhydrase IX; Ab, antibody; CA, carbonic anhydrase; CAT, chloramphenicol acetyl transferase; HIF-1, hypoxia-inducible factor 1; HRE, hypoxia-response element; PI3K, phosphatidylinositol 3'-kinase; PR, protected region; VEGF, vascular endothelial growth factor; VHL, von Hippel-Lindau; pHe, extracellular pH. ![]()
Received 3/18/02. Accepted 6/17/02.
| REFERENCES |
|---|
|
|
|---|
by the inflammatory mediators nitric oxide and tumor necrosis factor-
in contrast to desferroxamine and phenylarsine oxide. J. Biol. Chem., 276: 39805-39811, 2001.
-dependent regulation of HIF-1
. FEBS Lett., 505: 269-274, 2001.[Medline]
in vascular smooth muscle cells. J. Biol. Chem., 275: 26765-26771, 2000.
/ARNT. EMBO J., 17: 5085-5094, 1998.[Medline]
-subunit (HIF-1
). J. Biol. Chem., 273: 8360-8368, 1998.
via nitric oxide and Ras/MAP kinase mediated signaling pathways. Oncogene, 20: 7624-7634, 2001.[Medline]
and hypoxia-inducible factor 2
in human bladder tumors and cell lines. Clin. Cancer Res., 7: 1263-1272, 2001.
expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/Akt/FRAP pathway in human prostate cancer cells: implications for tumor angiogenesis and therapeutics. Cancer Res., 60: 1541-1545, 2000.
(HIF-1
) synthesis: novel mechanism for HIF-1-mediated vascular endothelial growth factor expression. Mol. Cell. Biol., 21: 3995-4004, 2001.
nor sufficient for HIF-1-dependent target gene transcription. J. Biol. Chem., 277: 15162-15170, 2002.This article has been cited by other articles:
![]() |
K. Salnikow, O. Aprelikova, S. Ivanov, S. Tackett, M. Kaczmarek, A. Karaczyn, H. Yee, K. S. Kasprzak, and J. Niederhuber Regulation of hypoxia-inducible genes by ETS1 transcription factor Carcinogenesis, August 1, 2008; 29(8): 1493 - 1499. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Kazi and R. D. Koos Estrogen-Induced Activation of Hypoxia-Inducible Factor-1{alpha}, Vascular Endothelial Growth Factor Expression, and Edema in the Uterus Are Mediated by the Phosphatidylinositol 3-Kinase/Akt Pathway Endocrinology, May 1, 2007; 148(5): 2363 - 2374. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Brennan, K. Jirstrom, A. Kronblad, R. C. Millikan, G. Landberg, M. J. Duffy, L. Ryden, W. M. Gallagher, and S. L. O'Brien CA IX is an Independent Prognostic Marker in Premenopausal Breast Cancer Patients with One to Three Positive Lymph Nodes and a Putative Marker of Radiation Resistance. Clin. Cancer Res., November 1, 2006; 12(21): 6421 - 6431. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaluz, M. Kaluzova, and E. J. Stanbridge Proteasomal Inhibition Attenuates Transcriptional Activity of Hypoxia-Inducible Factor 1 (HIF-1) via Specific Effect on the HIF-1{alpha} C-Terminal Activation Domain Mol. Cell. Biol., August 1, 2006; 26(15): 5895 - 5907. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Franco, S. Man, L. Chen, U. Emmenegger, Y. Shaked, A. M. Cheung, A. S. Brown, D. J. Hicklin, F. S. Foster, and R. S. Kerbel Targeted Anti-Vascular Endothelial Growth Factor Receptor-2 Therapy Leads to Short-term and Long-term Impairment of Vascular Function and Increase in Tumor Hypoxia. Cancer Res., April 1, 2006; 66(7): 3639 - 3648. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mayer, M. Hockel, and P. Vaupel Carbonic Anhydrase IX Expression and Tumor Oxygenation Status Do Not Correlate at the Microregional Level in Locally Advanced Cancers of the Uterine Cervix Clin. Cancer Res., October 15, 2005; 11(20): 7220 - 7225. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Proescholdt, C. Mayer, M. Kubitza, T. Schubert, S.-Y. Liao, E. J. Stanbridge, S. Ivanov, E. H. Oldfield, A. Brawanski, and M. J. Merrill Expression of hypoxia-inducible carbonic anhydrases in brain tumors Neuro-oncol, October 1, 2005; 7(4): 465 - 475. [Abstract] [PDF] |
||||
![]() |
M M Vleugel, A E Greijer, A Shvarts, P van der Groep, M van Berkel, Y Aarbodem, H van Tinteren, A L Harris, P J van Diest, and E van der Wall Differential prognostic impact of hypoxia induced and diffuse HIF-1{alpha} expression in invasive breast cancer J. Clin. Pathol., February 1, 2005; 58(2): 172 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Evans, K. D. Judy, I. Dunphy, W. T. Jenkins, W.-T. Hwang, P. T. Nelson, R. A. Lustig, K. Jenkins, D. P. Magarelli, S. M. Hahn, et al. Hypoxia Is Important in the Biology and Aggression of Human Glial Brain Tumors Clin. Cancer Res., December 15, 2004; 10(24): 8177 - 8184. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Hutchison, H. R. Valentine, J. A. Loncaster, S. E. Davidson, R. D. Hunter, S. A. Roberts, A. L. Harris, I. J. Stratford, P. M. Price, and C. M. L. West Hypoxia-Inducible Factor 1{alpha} Expression as an Intrinsic Marker of Hypoxia: Correlation with Tumor Oxygen, Pimonidazole Measurements, and Outcome in Locally Advanced Carcinoma of the Cervix Clin. Cancer Res., December 15, 2004; 10(24): 8405 - 8412. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bhattacharya, K. Toth, R. Mazurchuk, J. A. Spernyak, H. K. Slocum, L. Pendyala, R. Azrak, S. Cao, F. A. Durrani, and Y. M. Rustum Lack of Microvessels in Well-Differentiated Regions of Human Head and Neck Squamous Cell Carcinoma A253 Associated with Functional Magnetic Resonance Imaging Detectable Hypoxia, Limited Drug Delivery, and Resistance to Irinotecan Therapy Clin. Cancer Res., December 1, 2004; 10(23): 8005 - 8017. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kaluzova, S. Kaluz, M. I. Lerman, and E. J. Stanbridge DNA Damage Is a Prerequisite for p53-Mediated Proteasomal Degradation of HIF-1{alpha} in Hypoxic Cells and Downregulation of the Hypoxia Marker Carbonic Anhydrase IX Mol. Cell. Biol., July 1, 2004; 24(13): 5757 - 5766. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Kharas, J. A. Deane, S. Wong, K. R. O'Bosky, N. Rosenberg, O. N. Witte, and D. A. Fruman Phosphoinositide 3-kinase signaling is essential for ABL oncogene-mediated transformation of B-lineage cells Blood, June 1, 2004; 103(11): 4268 - 4275. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hopfl, O. Ogunshola, and M. Gassmann HIFs and tumors--causes and consequences Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2004; 286(4): R608 - R623. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-i. Kusakai, A. Suzuki, T. Ogura, S.'i. Miyamoto, A. Ochiai, M. Kaminishi, and H. Esumi ARK5 Expression in Colorectal Cancer and Its Implications for Tumor Progression Am. J. Pathol., March 1, 2004; 164(3): 987 - 995. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Crawford, S. Jovanovic, G. R. Budas, A. M. Davies, H. Lad, R. H. Wenger, K. A. Robertson, D. J. Roy, H. J. Ranki, and A. Jovanovic Chronic Mild Hypoxia Protects Heart-derived H9c2 Cells against Acute Hypoxia/Reoxygenation by Regulating Expression of the SUR2A Subunit of the ATP-sensitive K+ Channel J. Biol. Chem., August 15, 2003; 278(33): 31444 - 31455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaluz, M. Kaluzova, and E. J. Stanbridge Expression of the Hypoxia Marker Carbonic Anhydrase IX Is Critically Dependent on SP1 Activity. Identification of a Novel Type of Hypoxia-responsive Enhancer Cancer Res., March 1, 2003; 63(5): 917 - 922. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |