
[Cancer Research 62, 4575-4578, August 15, 2002]
© 2002 American Association for Cancer Research
Telomerase Is Regulated by c-Jun NH2-Terminal Kinase in Ovarian Surface Epithelial Cells1
Michelle Y. Alfonso-De Matte,
Hua Yang,
Myria S. Evans,
Jin Q. Cheng and
Patricia A. Kruk2
University of South Florida and the H. Lee Moffitt Cancer Center, Tampa, Florida 33612
 |
ABSTRACT
|
|---|
Telomerase activity is present in >90% of all tumors and appears to be regulated by the phosphatidylinositol 3-kinase signaling pathway. Here we demonstrate that Akt is not involved in the signaling cascade for telomerase regulation in ovarian surface epithelial cells. However, we showed that c-Jun NH2-kinase induces telomerase activity, that inhibition of JNK by JIP abrogates telomerase activity, and that JNK expression activates transcription of a reporter gene fused to the hTERT promoter sequence. Consequently, our data show that JNK is a key regulator of telomerase activity and, hence, may provide new perspectives on tumorigenesis that could be exploited for novel therapeutic strategies.
 |
Introduction
|
|---|
Because telomerase is present in >90% of human tumors and is absent from most normal somatic cells (1)
, it is the most widely expressed and specific cancer marker presently known (2)
. Consequently, understanding the molecular mechanisms regulating telomerase is of significant clinical importance. Transcriptional control of telomerase includes alternate splicing of hTERT3
mRNA transcripts (3)
, hTERT promoter methylation (4)
, and binding of one or more transcription factors, including c-Myc, to the hTERT promoter (5)
. Protein kinase C (6)
, DMSO (7)
, calcium (8)
, and zinc (9)
are also reported to affect telomerase activity, illustrating the complexity associated with telomerase regulation. We and others have shown previously that PI 3-kinase can up-regulate telomerase activity (10
, 11)
. In the present study, we show that the primary target of PI 3-kinase, Akt, did not affect telomerase activity in human OSE cells. However, JNK, also a downstream target of PI 3-kinase, increased telomerase activity, induced hTERT transcription, and led to induced reporter activity by transcriptional activation of hTERT. Therefore, this is the first report to identify JNK as a key regulator of telomerase activity.
 |
Methods and Materials
|
|---|
Cell Culture.
Telomerase-positive ovarian carcinoma cell lines OV1063, OV2008, OVCAR3, SW626, and CaOV3 were used. Four nontumorigenic SV40 large-T antigen-transfected OSE cell lines, FHIOSE 118, FHIOSE 1816686, NFHIOSE 80, and FHIOSE 1816575, derived from normal ovarian surface epithelium (12)
, were also used in this study. FHIOSE 118, NFHIOSE 80, and FHIOSE 1816575 cells were determined previously to be telomerase negative (13)
. Cells were maintained in Medium 199/MDCB 105 (1:1; Sigma Chemical Co., St. Louis, MO) supplemented with 5% fetal bovine serum (Hyclone, Logan, UT) and 10 µg/ml gentamicin (Life Technologies, Inc., Grand Island, NY) in a humidified 5% CO2/95% air atmosphere. Cell growth was determined by MTS assay as described previously (8)
.
Treatment with Anisomycin.
To determine whether JNK signaling was involved in telomerase regulation, SW626 or FHIOSE 118 cells were serum starved for 24 h, treated for 8 or 24 h with 20 or 40 µM of anisomycin (Sigma), a potent stimulator of JNK, and then assayed for telomerase activity. Parallel cultures of cells were collected for RT-PCR.
Transfections.
To examine the role of JNK signaling in telomerase regulation, Flag-tagged JNK, Flag-tagged JIP, which is a specific inhibitor of JNK, HA-tagged AA, and GFP were used for transfection. Cells were serum starved for 24 h and then transfected with 3 µg of DNA using Lipofectamine reagent (Life Technologies, Inc., Grand Island, NY). Cells were collected at 24 h after transfection and assayed for telomerase activity. In all transfection experiments, parallel cultures transfected with GFP were used as a control for transfection efficiency.
Telomerase Assay.
To quantitatively detect changes in telomerase levels, all cells were assayed for telomerase activity using the telomerase PCR-ELISA (Roche Molecular Biochemicals, Indianapolis, IN), as described previously (13)
and according to the manufacturers instructions. After PCR-ELISA, telomerase activity was detected using a Dynex-MRX plate reader (Dynex Technologies, Chantilly, VA) and recorded as absorbance units. These values were expressed as a fold increase above control levels, with the control value used as the denominator for the determination of fold increase for the treated samples. For graphical representation of the effect of Akt, anisomycin, JNK, or JIP on telomerase activity, control values for the untreated samples of all cell lines were set at 1.0. Telomerase activity is shown ±SE.
Immunoprecipitation and Western Blot Analysis.
Cells were lysed on ice using a modified RIPA buffer [50 mM Tris-HCl (pH 7.2), 150 mM NaCl, 0.5% NP40, 5 mM NaF, 1 mM Na3VO4, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 2.0 µg/ml leupeptin, 2.0 µg/ml aprotinin, 1 mM benzamidine, and 10 µg/ml trypsin inhibitor]. Lysates were then centrifuged at 12,000 x g at 4°C for 10 min, and the protein concentrations of the supernatants were determined as described previously (10)
. Protein extracts were solubilized in SDS gel loading buffer (60 mM Tris base, 2% SDS, 10% glycerol, and 5% ß-mercaptoethanol). Samples containing equal amounts of protein (25 µg) were separated on a 10% SDS-PAGE and electroblotted onto Hybond-ECL nitrocellulose membranes (Amersham Life Sciences, Piscataway, NJ) by wet transfer. Immunoblotting was performed using antibodies against JNK (1:1000), phospho-JNK (1:1000), phospho-c-Jun (1:1000), phospho-SEK1 (1:2000), Akt (1:1000), phospho-Akt (1:1000; Cell Signaling, Beverly, MA), ß-actin (Sigma; 1:5000), HA (1:1000), and Flag (1:1000). Blots were visualized using the ECL Western Blotting Analysis System (Amersham Pharmacia Biotech, Piscataway, NJ) according to the manufacturers instructions.
RT-PCR.
To examine the contribution of transcriptional control in telomerase regulation, RT-PCR was performed as described previously (10)
. To insure there was no DNA contamination, each sample for reverse transcription was prepared in duplicate, with the duplicate preparation lacking reverse transcriptase (14)
. The cDNA samples were amplified using the Perkin-Elmer GeneAmp kit. The hTERT primers used were hTERT-S (CGGAAGAGTGTCTGGAGCCAA) and hTERT-AS (GGATGAAGCGGAG TCTGGA) oligonucleotides (Sigma Genosys, The Woodlands, TX) with ß-actin primers Actin-S (CAGGTCATCACCATTGGCAATGAGC) and Actin-AS (GATGTCCACGT CACACTTCATGA) for an internal control. The amplified products were then separated by electrophoresis on a 9% polyacrylamide gel, stained with 1x SyberGreen (FMC Bioproducts, Rockland, ME), and analyzed with the Kodak EDAS 120 Digital Analysis System. Net hTERT mRNA intensities from treated samples were normalized to their corresponding ß-actin mRNA levels and were expressed as a percentage of the control samples that were similarly normalized to their corresponding ß-actin mRNA levels.
Luciferase Assay.
The hTERT promoter-luciferase construct called pGL3-1375 (15)
was used to measure hTERT transcriptional activity in the FHIOSE 118 cell line. pGL3-1375 contains a 1375-bp promoter fragment of hTERT fused to the luciferase reporter gene in pBluescript (Stratagene, La Jolla, CA). Transient cotransfections were performed as mentioned above. FHIOSE 118 cells were transfected using Lipofectamine (Life Sciences Technologies) with the indicated amounts of JNK or JIP cDNA. The total amount of transfected DNA was kept constant in each experiment by adding vector-only plasmid. A plasmid expressing the bacterial ß-galactosidase gene was also cotransfected in each experiment to serve as an internal control for transfection efficiency. Cells were collected at 48 h, and transcriptional activity was measured as a function of luciferase activity using the Luciferase Assay System (Promega Corp., Madison, WI) according to the manufacturers instructions and as described previously (16)
. At the time of collection, cells were observed microscopically to ensure that cells were viable and that there were no signs of apoptosis. Transcriptional activity was expressed as relative luciferase activity ± SE, after normalization with ß-galactosidase activity. Each transfection was performed in triplicate.
Statistical Analysis.
Samples for telomerase PCR-ELISA and luciferase assay were run in triplicate, and the data were subjected to the Students t test analysis for determination of statistical significance.
 |
Results
|
|---|
Akt Is Not Involved in Telomerase Regulation in OSE Cells.
To determine whether Akt, the primary target of PI 3-kinase, was the downstream target of PI 3-kinase in the regulation of telomerase, several telomerase-positive cancer cell lines and telomerase-negative normal cell lines were surveyed for telomerase activity (Fig. 1A)
. Parallel cultures were assayed by immunoprecipitation and Western immunoblotting for phospho-Akt as well as Akt. Working within the linear rage for AKT phosphorylation, we found an inverse correlation between telomerase activity and Akt activation. Telomerase-negative cell lines demonstrated higher levels of phosphorylated Akt than the telomerase-positive cell lines. Densitometric analysis confirmed this finding. When normalized to total Akt levels, endogenous phosphorylated Akt levels in telomerase-negative cells were 1.8-fold greater than in telomerase-positive cells, as determined by using ImageQuant software. In addition, transfection of activated AA into the telomerase-negative FHIOSE 118 cells did not induce telomerase activity (Fig. 1B)
. Western blot analysis using anti-HA confirmed successful transfection of AA.

View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Akt does not regulate telomerase activity in OSE cells. A, ovarian cancer cell lines and nontumorigenic OSE cell lines were assayed for telomerase activity. In parallel cultures, phospho-Akt levels were examined using Western blot analysis. Akt levels are indicated as a loading control. B, FHIOSE 118 cells were transfected with HA-tagged AA and GFP as a control. Cells were collected at 24 h and then assayed for telomerase activity. Successful transfection was confirmed by Western blot analysis. For all samples, telomerase levels are expressed as fold increase; bars, SE.
|
|
Anisomycin Induces Telomerase Activity.
Because JNK is also a downstream target of PI 3-kinase, SW626 and FHIOSE 118 cells were treated with anisomycin, a known stimulator of JNK, and then assayed for telomerase activity (Fig. 2)
. Treatment with anisomycin resulted in a 3- and 3.5-fold increase in telomerase activity in SW626 cells by 8 and 24 h, respectively (Fig. 2A)
. After anisomycin treatment, RT-PCR revealed de novo transcription of hTERT mRNA in FHIOSE 118 cells, indicating that JNK can both increase endogenous telomerase activity in telomerase-positive cells as well as induce de novo telomerase activity in telomerase-negative FHIOSE 118 cells (Fig. 2B)
. Similarly, treatment with anisomycin resulted in a 3-fold induction of de novo telomerase activity in FHIOSE 118 cells by 24 h (Fig. 2C)
, demonstrating that JNK can both increase endogenous as well as induce de novo telomerase activity. Anisomycin treatment did not affect cell viability, as determined by a cell proliferation assay (Fig. 2D)
.

View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Anisomycin induces telomerase activity as well as de novo transcription of hTERT. A, telomerase-positive SW626 cells were treated with 40 µM anisomycin. Cells were collected at 8 and 24 h and then assayed for telomerase activity. *, P 0.02. B, parallel cultures of FHIOSE 118 cells were treated with 40 µM anisomycin, and RNA was collected at 4 and 16 h, before maximal induction of telomerase activity. RT-PCR revealed de novo transcription of the hTERT component by 16 h. ß-actin was used as a control. C, telomerase-negative FHIOSE 118 cells were treated with 40 µM anisomycin, collected at 24 h, and assayed for telomerase activity. *, P 0.006. Telomerase levels are expressed as fold increase; bars, SE. D, anisomycin treatment did not affect cell viability as determined by a cell proliferation assay (Fig. 2D)
. *, P = 0.74.
|
|
Endogenous JNK Activity Is Increased in Telomerase-positive Cells.
Telomerase-negative FHIOSE 118 and telomerase-positive SW626 cells were compared for endogenous levels of members of the JNK signaling pathway (Fig. 3A)
. After immunoprecipitation, cell lysates were probed with anti-phospho-SEK1, anti-phospho-JNK, and anti-phospho-c-Jun. Western blot analysis revealed that of the JNK signaling cascade proteins examined, FHIOSE 118 cells did not have elevated levels of phosphorylated proteins. In contrast, SW626 cells were found to have high levels of phosphorylated SEK1, JNK, and c-Jun. ß-actin was used as a loading control. Several telomerase-positive ovarian cancer cells and telomerase-negative, nontumorigenic ovarian cell lines were also surveyed for endogenous levels of JNK, phosphorylated JNK, and telomerase activity. We found that telomerase-positive cell lines have elevated endogenous phospho-JNK levels when compared with telomerase-negative cell lines (Fig. 3B)
.

View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Endogenous phospho-JNK is elevated in telomerase-positive ovarian cancer cells. A, FHIOSE 118 and SW626 cells were collected and lysed as described previously. Using Western blot analysis, membranes were probed with phospho-SEK1, phospho-JNK, and phospho-c-Jun. ß-actin was used as a loading control. B, telomerase-positive and -negative cells were examined for endogenous levels of phospho-JNK using Western blot analysis. JNK was used as a loading control. Parallel cultures were examined for telomerase levels.
|
|
JNK Plays a Role in Telomerase Regulation.
To confirm a role for JNK in telomerase regulation, the telomerase-negative FHIOSE 118, NFHIOSE 80, and FHIOSE 1816-575 cells were transfected with GFP or JNK, whereas the highly telomerase-positive CaOV3 ovarian cancer cells were transfected with GFP and JIP (Fig. 4)
. The FHIOSE 118 cells were also cotransfected with JNK and the JNK inhibitor protein, JIP. FHIOSE 118 cells transfected with JNK exhibited an 8-fold induction of de novo telomerase activity, whereas transfection with GFP or JNK + JIP did not induce detectable telomerase activity (Fig. 4A)
. Furthermore, JIP was able to suppress JNK-induced telomerase activity in the FHIOSE 118 cells (Fig. 4A)
. Successful transfections were confirmed by Western blot analysis (Fig. 4B
, inset), and transfection efficiency in FHIOSE 118 cells was
70% as visualized compared with GFP controls. To confirm the effect of JNK, two additional telomerase-negative cell lines, NFHIOSE 80 and FHIOSE 1816-575 cells, were also transfected with JNK (Fig. 4A)
. Twenty-four h after transfection with JNK, NFHIOSE 80 cells exhibited a 5.75-fold increase in telomerase activity, and the FHIOSE 1816-575 cells showed a 3-fold increase. For NFHIOSE 80 and FHIOSE 1816-575 cells, transfection efficiencies were approximately 55 and 30%, respectively, as visualized compared with GFP controls. Transfection of JIP into CaOV3 cells resulted in a 10-fold decrease in telomerase activity (Fig. 4B)
, confirming the role of JNK in the regulation of telomerase. For CaOV3 cells, transfection efficiency was
35% as visualized compared with GFP controls. GFP did not affect telomerase activity (data not shown). Successful transfections were confirmed by Western blot analysis (Fig. 4B
, inset).

View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. JNK is capable of inducing telomerase activity by driving the hTERT promoter. A, the telomerase-negative FHIOSE 118, NFHIOSE 80, and FHIOSE 1816575 cells were transfected with JNK or GFP as a control, and the FHIOSE 118 cells were also cotransfected with JNK + JIP. Cells were collected 24 h after transfection and assayed for telomerase activity. Telomerase levels are expressed as fold increase; bars, SE. *, P 0.02; **, P 0.005; ***, P 0.002. Successful transfection in FHIOSE 118 cells was confirmed by Western blot analysis (B, inset). B, the telomerase-positive CaOV3 cells were transfected with JIP or GFP, as a control. Cells were collected 24 h after transfection and assayed for telomerase activity. Telomerase levels are expressed as fold increase; bars, SE. *, P 0.008. Successful transfection was confirmed by Western blot analysis (inset). C, FHIOSE 118 cells were transfected with the hTERT promoter fused to a luciferase reporter gene alone or in combination with JNK ± JIP. Samples were collected 48 h after transfection and assayed for luciferase activity. Transfection efficiencies for all samples were normalized with ß-galactosidase. Samples are expressed as fold increase; bars, SE. *, P 0.008; **, P 0.05; ***, P 0.003.
|
|
JNK Is Capable of Activating the hTERT Promoter, and This Activation Can Be Inhibited by JIP.
To clearly demonstrate the role of JNK in telomerase regulation, it was necessary to determine whether JNK was capable of activating transcription of a reporter gene fused to the hTERT promoter sequence (Fig. 4C)
. Telomerase-negative FHIOSE 118 cells were transfected with either the hTERT promoter reporter construct ± JNK, ± JIP. Samples were collected 48 h after transfection, and luciferase activity was measured (Fig. 4C)
. The hTERT promoter reporter was activated by as little as 0.05 µg of JNK, resulting in a 3.5-fold increase in reporter gene activity. In addition, JIP was able to abolish reporter activity when cotransfected with JNK, but alone, JIP did not induce reporter activity.
 |
Discussion
|
|---|
Our study is the first to identify JNK as a regulator of telomerase. These data are in agreement with previous studies that suggested a connection between the PI 3-kinase pathway and telomerase activity. Although hTERT may have a consensus sequence for the Akt kinase, our attempts to induce telomerase activity in the OSE cell system with activated Akt were unsuccessful. This would suggest that Akt, the primary downstream target of PI 3-kinase, does not contribute to telomerase regulation in OSE cells. Instead, we showed that JNK, also a target of PI 3-kinase, is involved in telomerase regulation.
Although the hTERT promoter has been shown to respond to c-myc, many binding sites have been identified for several different transcription factors within the promoter region (17)
. This would suggest a complex mechanism for telomerase regulation that is probably cell type or tissue specific. However, we revealed that JNK alone was capable of activating transcription of the luciferase gene fused to the hTERT promoter sequence in our OSE cell system. Although it is not known precisely how JNK activates the hTERT promoter, it is possible that JNK-mediated phosphorylation and activation of c-Jun can lead to c-Jun binding to any of several AP1 sites present throughout the hTERT promoter (18)
. In support of this idea, Satoru and Inoue have demonstrated that loss of the AP1 site in the hTERT promoter significantly reduces hTERT expression and consequently, telomerase activity.
In summary, our study is the first to indicate that JNK can induce telomerase activity by transcriptional activation of hTERT. The initial extracellular signal may stimulate PI 3-kinase and cascade through SEK1, then JNK. JNK, in turn, could activate c-Jun, causing transcription of hTERT and subsequent activation of telomerase. Certainly, additional studies are warranted to completely delineate the signaling pathway for JNK-mediated telomerase regulation. These data will have a significant impact on the development of chemotherapeutic agents to target telomerase.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Nancy Lowell for critical review of the manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by the United States Army Department of Defense New Investigator Award DAMD17-00-1-0565 (to P. A. K.). 
2 To whom requests for reprints should be addressed, at Department of Pathology, MDC 11, University of South Florida, College of Medicine, 12901 Bruce B. Downs Boulevard, Tampa, FL 33612. Phone: (813) 974-0548; Fax: (813) 974-5536; E-mail: pkruk{at}hsc.usf.edu 
3 The abbreviations used are: hTERT, human telomerase reverse transcriptase; PI 3-kinase, phosphatidylinositol 3-kinase; OSE, ovarian surface epithelial; JNK, c-Jun NH2-terminal kinase; RT-PCR, reverse transcription-PCR; HA, hemagglutinin; AA, activated Akt; GFP, green fluorescent protein. 
Received 4/ 3/02.
Accepted 6/25/02.
 |
REFERENCES
|
|---|
- Shay J. W., Bacchetti S. A survey of telomerase activity in human cancer. Eur. J. Cancer, 33: 787-791, 1997.
- Kim N. W. Clinical implications of telomerase in cancer. Eur. J. Cancer, 33: 781-786, 1997.
- Villa R., Porta C. D., Folini M., Daidone M. G., Zaffaroni N. Possible regulation of telomerase activity by transcription and alternative splicing of telomerase reverse transcriptase in human melanoma. Soc. Investig. Dermatol., 116: 867-873, 2001.
- Takakura M., Kyo S., Sowa Y., Wang Z., Yatabe N., Maida Y., Tanaka M., Inoue M. Telomerase activation by histone deacetylase inhibitor in normal cells. Nucleic Acids Res., 29: 3006-3011, 2001.[Abstract/Free Full Text]
- Wu K. J., Grandori C., Amacker M., Simon-Vermont N., Polack A., Lingner J., Dalla-Favera R. Direct activation of TERT transcription by c-Myc. Nat. Genet., 21: 220-224, 1999.[Medline]
- Li H., Zhao L, Yang Z., Funder J. W., Liu J. P. Telomerase is controlled by protein kinase C-
in human breast cancer cells. J. Biol. Chem., 273: 33436-33442, 1998.[Abstract/Free Full Text]
- Bestilny L. J., Brown C. B., Miura Y., Robertson L. D. Selective inhibition of telomerase activity during terminal differentiation of immortal cell lines. Cancer Res., 56: 3796-3802, 1996.[Abstract/Free Full Text]
- Alfonso-De Matte M. Y., Moses-Soto H., Kruk P. A. Calcium-mediated telomerase activity in ovarian epithelial cells. Arch. Biochem. Biophys., 399: 239-244, 2002.[Medline]
- Nemoto K., Kondo Y., Himeno S., Suzuki Y., Hara S., Akimoto M., Imura N. Modulation of telomerase activity by zinc in human prostatic and renal cancer cells. Biochem. Pharmacol., 59: 401-405, 2000.[Medline]
- Alfonso-De Matte M. Y., Cheng J. Q., Kruk P. A. Ultraviolet irradiation- and dimethyl sulfoxide-induced telomerase activity in ovarian epithelial cell lines. Exp. Cell Res., 267: 13-27, 2001.[Medline]
- Kang S. S., Kwon T., Kwon D. Y., Do S. I. Akt protein kinase enhances human telomerase activity through phosphorylation of telomerase reverse transcriptase subunit. J. Biol. Chem., 274: 13085-13090, 1999.[Abstract/Free Full Text]
- Maines-Bandiera S. L., Kruk P. A., Auersperg N. Simian virus 40-transformed human ovarian surface epithelial cells escape normal growth controls but retain morphogenetic responses to extracellular matrix. Am. J. Obstet. Gynecol., 167: 729-735, 1992.[Medline]
- Kruk P. A., Godwin A. K., Hamilton T. C., Auersperg N. Telomeric instability and reduced proliferative potential in ovarian surface epithelial cells from women with a family history of ovarian cancer. Gynecol. Oncol., 73: 229-236, 1999.[Medline]
- Ambion. . The Truth: Your RNA is contaminated! How do you know if your RNA is contaminated with DNA! Technotes, Ed. 1 1-3, Ambion, Inc. Austin, TX 1998.
- Takakura M., Kyo S., Kanaya T., Hirano H., Takeda J., Yutsudo M., Inoue M. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res., 59: 551-557, 2000.[Abstract/Free Full Text]
- Sambrook J., Fritsch E. F., Maniatis T. . Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Cold Spring Harbor, NY 1989.
- Satoru K., Inoue M. Complex regulatory mechanisms of telomerase activity in normal and cancer cells: how can we apply them for cancer therapy?. Oncogene, 21: 688-697, 2002.[Medline]
- Chin L., Artandi S. E., Shen Q., Tam A., Lee S. L., Gottlieb G. J., Greider C. W., DePinho R. A. p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis. Cell, 97: 527-538, 1999.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Edson, A. K. Nagaraja, and M. M. Matzuk
The Mammalian Ovary from Genesis to Revelation
Endocr. Rev.,
October 1, 2009;
30(6):
624 - 712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bellon and C. Nicot
Regulation of Telomerase and Telomeres: Human Tumor Viruses Take Control
J Natl Cancer Inst,
January 16, 2008;
100(2):
98 - 108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Beyne-Rauzy, N. Prade-Houdellier, C. Demur, C. Recher, J. Ayel, G. Laurent, and V. Mansat-De Mas
Tumor necrosis factor-{alpha} inhibits hTERT gene expression in human myeloid normal and leukemic cells
Blood,
November 1, 2005;
106(9):
3200 - 3205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Takakura, S. Kyo, M. Inoue, W. E. Wright, and J. W. Shay
Function of AP-1 in Transcription of the Telomerase Reverse Transcriptase Gene (TERT) in Human and Mouse Cells
Mol. Cell. Biol.,
September 15, 2005;
25(18):
8037 - 8043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yang, C. C. Ou, R. I. Feldman, S. V. Nicosia, P. A. Kruk, and J. Q. Cheng
Aurora-A Kinase Regulates Telomerase Activity through c-Myc in Human Ovarian and Breast Epithelial Cells
Cancer Res.,
January 15, 2004;
64(2):
463 - 467.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Y. Alfonso-De Matte and P. A. Kruk
Phosphatidylinositol Triphosphate Kinase-dependent and c-Jun NH2-Terminal Kinase-dependent Induction of Telomerase by Calcium Requires Pyk2
Cancer Res.,
January 1, 2004;
64(1):
23 - 26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Horikawa and J. C. Barrett
Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms
Carcinogenesis,
July 1, 2003;
24(7):
1167 - 1176.
[Abstract]
[Full Text]
[PDF]
|
 |
|