Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium  09 AM Call for Abstracts
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buteau-Lozano, H.
Right arrow Articles by Perrot-Applanat, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buteau-Lozano, H.
Right arrow Articles by Perrot-Applanat, M.
[Cancer Research 62, 4977-4984, September 1, 2002]
© 2002 American Association for Cancer Research


Endocrinology

Transcriptional Regulation of Vascular Endothelial Growth Factor by Estradiol and Tamoxifen in Breast Cancer Cells

A Complex Interplay between Estrogen Receptors {alpha} and ß1

Hélène Buteau-Lozano, Magali Ancelin, Bernard Lardeux, Julie Milanini and Martine Perrot-Applanat2

Institut National de la Santé et de la Recherche Médicale U553, IFR 105 Institut d’Hématologie Paris 7, Hôpital Saint Louis, 75475 Paris Cedex 10, France [H. B-L., M. A., M. P-A.]; U327, Faculté de Médecine Xavier Bichat, 75870 Paris Cedex 18, France [B. L.]; and CNRS-UMR 6543, Centre de Biochimie, Université de Nice, 06108 Nice, France [J. M.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vascular endothelial growth factor (VEGF) is a potent angiogenic and prognostic factor for many tumors, including those of endocrine-responsive tissues such as the breast and uterus. Recent studies indicate that 17ß-estradiol (E2) modulates VEGF expression in breast and uterine cells, involving transcriptional activation through estrogen receptor (ER) {alpha}. However, molecular mechanisms of VEGF regulation mediated by the two ER subtypes and the potential role of ERß in the control of breast cancer angiogenesis have not yet been investigated. In transient transfection assays using the VEGF(-2275/+54) promoter-luciferase construct, E2 (1 nM) increased transcription activity in MCF-7 cells (either untransfected or cotransfected with ER{alpha}) and it increased transcription activity in MDA-MB-231 cells cotransfected with ER{alpha} or ERß (1.8- and 2-fold induction, respectively). The positive effect was abolished when MCF-7 cells were treated with pure antiestrogen ICI 182,780 or the agonist/antagonist tamoxifen (1 µM). To identify response elements involved in this transcriptional regulation, MCF-7 or MDA-MB-231 cells were transfected with several deletion constructs of the VEGF promoter. Deletion of 1.2–2.3 kb upstream to the transcription start in the VEGF promoter abrogated E2-dependent transcription in these cells. This region contains an imperfect estrogen-responsive element (ERE), ERE1520, and one activator protein 1 site. Transfection of MCF-7 cells (ER{alpha}) with the ERE1520-luciferase construct conferred transcriptional activity with 1 nM E2 (1.9-fold induction). Also, the imperfect ERE formed a complex with ER{alpha} or ERß proteins in gel shift assay using MCF-7 or MDA-MB-231 nuclear extracts. In contrast to ER{alpha}, ERß could transactivate VEGF reporter construct in MDA-MB-231 cells, in the presence of E2 or tamoxifen, suggesting different transactivational mechanisms between ER{alpha} and ERß in the presence of tamoxifen. Interestingly, E2 inhibited VEGF transcription in MCF-7 cells transfected with ERß or MDA-MB-231 cells cotransfected with ER{alpha} and ERß, suggesting that heterodimerization of ER{alpha}/ERß has the ability to inhibit E2-induced VEGF expression in breast cancer cells. These results demonstrate that VEGF is a target gene for ER{alpha} and ERß in breast cancer cells; it remains to be determined whether ER{alpha} and ERß expression in breast biopsies correlates with VEGF expression and vascular density.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Angiogenesis has received much attention over the last few years as a multistep process essential for tumor growth and metastasis, including breast cancer (1 , 2) . This process requires the combined and coordinated actions of angiogenic factors, extracellular matrix components, and proteases (3) . One of the most selective and potent angiogenic factors known is VEGF,3 also known as vascular permeability factor (4) . In vivo studies have shown that suppression of VEGF inhibits tumor growth, and anti-VEGF antibodies or VEGF inhibitors also decrease the metastasis of human tumors implanted in nude mice (5) . Also, VEGF transcript levels are elevated in human tumors, including those responsive to steroid hormones such as breast and endometrial tumors (6, 7, 8, 9, 10) , in association with angiogenesis. VEGF is the major inducer of neovascularization occurring in the normal endometrium, ovary, prostate, and mammary gland (11, 12, 13, 14, 15) . Recently, up-regulation of VEGF has been demonstrated in vitro with E2 and progestins in normal and cancer cells (12 , 13 , 16, 17, 18, 19, 20) . Pharmacological studies on MCF-7 cells have shown that E2 modulates VEGF expression (18) , increasing gene transcription and mRNA stability. However, the molecular mechanisms of action on VEGF expression in breast cancer cells via ER have not been elucidated.

The mechanism of the estrogenic effect in breast tumors has been reevaluated based on the recent discovery of a second ER, ERß (21) , expressed in various human tissues including mammary gland and breast cancer (22 , 23) . Based on studies performed in ER{alpha} knockout mice, the presence of ER{alpha}, but not ERß, seems to be required to mediate E2-dependent growth and development of the gland (24 , 25) . Recent results have highlighted the fact that ERß may be important in human breast tumorigenesis, but the significant involvement of ERß has been controversial because it has been suggested to be of good (26 , 27) or bad (28 , 29) prognostic value. Recent results have also suggested a protective effect of ERß against the mitogenic activity of E2 in mammary premalignant lesion (30) . Thus far, a possible link between angiogenesis mediated by VEGF and ER status during breast tumorigenesis in vivo and in vitro has not been investigated.

Functional studies have described the regulation of VEGF expression in response to various stimuli: hypoxia (31) ; growth factors through Sp1/AP2 or AP1 transcription factors (32, 33, 34) ; and E2 in endometrial cells through an imperfect ERE present in the VEGF promoter (20 , 35) .

Here we have investigated E2-induced VEGF expression according to the ER subtype expressed in two breast cancer cell lines, MCF-7 and MDA-MB-231, using various approaches. Our results suggest that E2 regulation of VEGF at the transcriptional level in MCF-7 cells is mainly mediated by a specific ERE. Moreover, tamoxifen has agonist or antagonist activity on VEGF transcription, depending on the nature of the ER, ER{alpha} and/or ERß, and possibly involves complex interplay with other sequences in the VEGF promoter.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hormones and Chemicals.
E2, OH-TAM, and other biochemicals were purchased from Sigma (Saint Quentin, France) unless otherwise stated. ICI 182,780 was a gift from Dr. A. E. Wakeling (AstraZeneca, Macclesfield, United Kingdom), and RAL was a gift from Lilly Company (Indianapolis, IN).

Cell Culture.
MCF-7 and MDA-MB-231 cells (a gift from Dr. D. Chalbos; Montpellier, France) were initially obtained from the American Type Culture Collection. They were routinely maintained in DMEM/Ham’s nutrient mixture F12 (Life Technologies, Inc., Grand Island, NY) and DMEM, respectively, supplemented with 10% FBS, 100 units/ml penicillin, 100 µg/ml streptomycin, and 250 µg/ml amphotericin B (Life Technologies, Inc.) at 37°C and 5% CO2.

Plasmids and Cloning.
The human VEGF promoter gene (3.5 kb) cloned in pUC8 vector was kindly provided by Dr. J. Abraham (Scios Nova Inc., Sunnyvale, CA; Ref. 35 ). The VEGF promoter deleted of a 0.7-kb fragment in 3' was subcloned upstream of LUC cDNA in a pGL3 basic reporter plasmid (pGL3b; Promega) [VEGF(-2275/+54)-LUC; a gift of Dr. J. Plouet; Toulouse, France]. Different constructions containing VEGF promoter fragments (-1176/+54, -88/+54, and -66/+54) cloned in pGL2 basic vector are shown in Fig. 4Citation and were described previously (33) . The 0.7-kb VEGF fragment (+54/+749) 5'-untranslated region containing an AP1 and half ERE sites was prepared from the full-length VEGF promoter using the Nhe I restriction enzyme and subcloned into the corresponding restriction site of the pGL3b reporter plasmid. The vector (ERE1520)-LUC, containing one copy of the variant ERE of the VEGF promoter (aatcagactgact at position -1520 from the transcription start), was flanked of XhoI and MluI restriction sites and inserted in the corresponding sites of pGL3 promoter vector (Promega). The vector (TRE)6-LUC, containing six copies of TRE elements upstream of the LUC gene, was kindly given by Dr. D. Guédin (Roussel-Uclaf, Romainville, France). All constructs were verified by sequencing. Expression vectors (pSG5) for hER{alpha} (HE0) and hERß were generously provided by Prof. P. Chambon (Strasbourg, France; Ref. 36 ); data presented in this paper were obtained with the HE0 plasmid. A CMV-GAL reporter corresponding to the ß-galactosidase gene under the control of the CMV promoter was used as a control of transfection efficiency.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. Transcriptional activity of different VEGF constructs in MCF-7 cells treated with E2. A, deletion constructs of the VEGF promoter. B, cells were cotransfected with VEGF(-2275/+54)-LUC or deletion mutants, CMV-GAL plasmid, and ER{alpha} or ERß expression plasmids in pSG5 vector. Cells were treated with E2, and results are expressed as described in the Fig. 3Citation legend. Values represent the means ± SE of four separate experiments. *, P < 0.01.

 
Transient Transfections and LUC Assays.
Cells seeded onto 12-well plates in DMEM/Ham’s nutrient mixture F12 or DMEM were maintained for 1 week in phenol-red-free medium supplemented with 5% charcoal-stripped FBS. Transient transfection was carried out using the standard protocol for FuGENE reagent (Roche Diagnostics Corp., Indianapolis, IN). Briefly, a mixture of the VEGF reporter gene (1 µg/well), hER expression plasmid (0.25 µg/well), and CMV-GAL (0.5 µg/well) was added to 50 µl of serum-free medium containing 5 µl of FuGENE reagent. In each series of experiments, control cells were transfected with pGL3b plasmid, which only contains the LUC gene. After incubation of cells with DNA-FuGENE complexes for 18 h, the medium was replaced with phenol-red-free medium containing 2% charcoal-stripped FBS. Hormones (E2 at 1 nM; the agonist/antagonist OH-TAM, RAL, and the pure antagonist ICI 182,780, all at 1 µM) or vehicle alone (0.1% ethanol) was added for 24 h at 37°C. Cells were then washed with PBS and lysed with reporter lysis buffer, and LUC activities (in relative light units) were determined using the Luciferase Reporter Assay system (Promega). These values were normalized to the ß-galactosidase activity to correct for differences in transfection efficiency. Fold induction (ratio of treated:untreated cells) was further normalized to the pGL3b LUC response, which was arbitrarily set to 1, as described previously (33 , 37) . Data are presented as the means ± SE of three to eight independent experiments performed in triplicate.

Human VEGF Immunoassay.
VEGF levels were measured in cell culture media using a Quantikine kit from R&D Diagnostics (Abingdon, United Kingdom). VEGF levels were normalized to the total protein concentration in each dish, as determined by the method of Bradford, and compared statistically.

RNA Extraction and RT-PCR Analysis.
Total RNA was isolated from cultured cells using the Trizol method (Life Technologies, Inc.) according to the manufacturer’s procedure and stored at -20°C until use. RT-PCR analysis was carried out using total RNA (1 µg) as described previously (19) .

Semiquantitative RT-PCR Analysis of VEGF mRNA.
Human VEGF primers sequences (Eurogentec) were as follows: sense (5'-CCATGAACTTTCTGCTGTCTTGG-3') and antisense (5'-CTCACCGCCTCGGCTTGTCAC-3') oligonucleotides. Semiquantitative RT-PCR was performed with an annealing at 59°C and a total of 28 cycles for VEGF and an annealing at 56°C for GAPDH, as described previously (19) . [{alpha}-33P]dATP (0.5 µCi; Amersham) was added to the assay mixture (50 µl, final volume). After PCR, the amplified DNA sequence was electrophoresed on 8% (w/v) acrylamide gels (PAGE). Radioactivity in each band was quantified using Instant-Imager analysis (Packard) and the associated software. Results were expressed as band intensity in each lane relative to that of GAPDH and compared statistically using Student’s t test.

RT-PCR of ERs.
PCR amplification was performed using primers chosen at 598–623 and 1392–1416 positions in hER{alpha} cDNA (36) and primers chosen at 124–146 and 498–519 positions in hERß cDNA (21) , as described previously (38) . GAPDH was used as an invariant housekeeping gene control.

Preparation of Cell Extract and EMSAs.
MCF-7 and MDA-MB-231 transfected cells were stimulated in serum-free medium with 1 nM E2 at 37°C for 1 h, and nuclear extracts were prepared as described previously (39) . Double-stranded oligonucleotides containing the putative ERE located in the fragment of the VEGF promoter (-1570 to -1176) were synthesized (aatcagactgactggcctcagagccc) and end-labeled by 5' phosphorylation with T4 polynucleotide kinase and [{gamma}-32P]ATP (NEN Perkin-Elmer). EMSAs were carried out as described previously (40) , with minor modifications. Briefly, 32P-labeled ERE (4 x 105 cpm/reaction) was combined with 5–15 µg of nuclear protein extracts and poly-dIdC (Sigma) used as nonspecific carrier DNA in 20 µl of buffer [15 mM Tris-HCl (pH 7.9) containing 75 mM KCl, 0.2 mM EDTA, and 0.4 mM DTT]; the mixture was placed on ice for 15 min. Protein-DNA complexes were separated from the free probe by nondenaturing 5% PAGE at 150 V with running buffer consisting of 25 mM Tris/25 mM borate/1 mM EDTA. Gels were dried, and the radioactivity associated with ERE and ER-ERE complexes was quantified. Binding competition was performed by adding unlabeled probes at 100-fold excess.

Statistical Analysis.
Student’s t test was used to determine the significance between treatments and untreated controls, and P < 0.05 was considered significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MCF-7 and MDA-MB-231 breast cancer cell lines were chosen to study the molecular mechanisms of VEGF regulation with regard to ER status. Using RT-PCR analysis, MCF-7 cells express high levels of ER{alpha} transcripts (Fig. 1)Citation , as described previously (22) ; they also express low levels of ERß. In MDA-MB-231 cells, only the ERß transcript was detected. However, ER{alpha} protein was clearly detected compared with ERß, which was not detected in MCF-7 cells using immunocytochemistry (data not shown; Ref. 41 ).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1. ER{alpha} and ERß in MCF-7 and MDA-MB-231 cells. Expression of ER{alpha} and ERß transcripts was qualitatively analyzed by RT-PCR using primers specific to hER{alpha} or hERß cDNA (see "Materials and Methods"). Staining intensity of transcripts is unrelated to the expression level of the protein (data not shown).

 
Induction of VEGF mRNA and Protein Expression by E2 in MCF-7 Cells.
We first studied the regulation of VEGF mRNA expression in MCF-7 cells stimulated by E2 using semiquantitative RT-PCR (see "Materials and Methods" and Ref. 13 ; Fig. 2, A and BCitation ). As shown in Fig. 2BCitation , the response to E2 (1 nM) occurred in a time-dependent manner; the level of VEGF transcripts significantly increased within 3 h and reached a maximum at 6 h (a 1.6-fold increase; P < 0.05). Dose-dependent experiments indicated that the maximum level was obtained at 1–10 nM (data not shown). VEGF protein significantly increased in the conditioned medium of cells after 12 h of treatment with 1 and 10 nM E2, compared with untreated cells (1.7-fold; P < 0.01; Fig. 2CCitation ). No further increase of secreted VEGF was seen at longer incubation times and higher E2 concentrations (data not shown). In contrast, E2 has no effect on VEGF released by MDA-MB-231 cells (Fig. 2C)Citation , suggesting that endogenous ERß (see Fig. 1Citation ) does not support E2-induced VEGF production.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Induction of VEGF expression by E2 in MCF-7 cells. Cells were cultured as described in "Materials and Methods" and treated with E2 for various periods. A shows a representative agarose gel analyzing RT-PCR products for VEGF (312, 240, and 108 bp corresponding, respectively, to the 189, 165, and 121 protein isoforms, top gel) or GAPDH (bottom gel). L, molecular weight standard. B, the amount of VEGF mRNA was quantified by RT-PCR analysis (19) . The values are presented as the mean VEGF:GAPDH mRNA ratio ±SE in a representative experiment (n = 3). C, MCF-7 (open symbols) and MDA-MB-231 (closed symbols) cells were incubated with 1 and 10 nM E2. The amount of VEGF was determined by ELISA assay in the cell-conditioned medium (triplicate samples). Values are normalized relative to the protein concentrations. A representative result of three experiments is shown. *, statistically significant versus untreated control (P < 0.05 and P < 0.01 in B and C, respectively).

 
E2 Modulates VEGF Gene Transcription in MCF-7 Cells through ER{alpha}.
Previous studies have suggested an effect of E2 on VEGF expression at the transcriptional level in different cells (13 , 18 , 20) , as well as at the posttranscriptional level (18) . To determine the molecular mechanisms of transcriptional regulation by E2 in breast cancer cells, MCF-7 cells were transiently transfected with a plasmid containing 2.3 kb of the 5'-flanking region of the VEGF promoter linked to the LUC reporter gene, VEGF(-2275/+54)-LUC or pGL3b, and further treated with E2 for 24 h, as described in "Materials and Methods." As shown in Fig. 3Citation , this promoter region of the VEGF gene conferred significant hormonal inducibility by 1 nM E2 (1.8- and 2-fold increase, respectively, as compared with untreated cells; P < 0.001). As a positive control, 12-O-tetradecanoylphorbol-13-acetate induced a 3.9- and 15-fold increase of the LUC activity associated with the VEGF gene promoter or the (TRE)6-LUC construct, respectively (see "Materials and Methods"; data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. ER{alpha} activates the transcription of VEGF in MCF-7 cells. Cells were transiently transfected with the pGL3b or VEGF(-2275/+54)-LUC construct and CMV-GAL plasmid in the presence or absence of ER{alpha} or ERß expression vectors (see "Materials and Methods"). After overnight recovery, cells were treated with 1 nM E2 or vehicle alone for 24 h. Results are expressed as fold induction of LUC activity between treated and untreated cells and normalization to the pGL3b response; data represent the mean ± SE of four to eight separate experiments. *, P < 0.01.

 
Parallel experiments were performed in MCF-7 cells transiently transfected with VEGF(-2275/+54)-LUC together with an expression plasmid for hER{alpha} or hERß. The basal transcription level was unchanged, regardless of whether MCF-7 cells were transfected with ER{alpha} plasmid or not (data not shown). E2 treatment (1 nM) of MCF-7 cells transfected with ER{alpha} resulted in a significant increase in LUC activity (1.72 ± 0.02; P < 0.01) as compared with untreated cells, and similar to that obtained with untransfected cells (Fig. 3)Citation . In contrast, no activation was observed in cells transfected with ERß under similar conditions (Fig. 3)Citation .

Transcriptional Up-Regulation of VEGF by E2 Is Dependent on a Distal Region of the Promoter (-2275/-1176) in Breast Cancer Cells.
To identify response elements implicated in the transcriptional regulation of VEGF by E2, we next examined transcriptional activities of constructs containing several deletions of the 2.3-kb VEGF promoter (Fig. 4A)Citation . In MCF-7 cells containing endogenous ER{alpha} (Fig. 4BCitation , pSG5), E2 induced a significant increase of VEGF(-2275/+54)-LUC activity, but it had no effect on cells transfected with deleted vectors (-1176/+54, -88/+54, -66/+54, or +54/+749). Similar results were observed using MCF-7 cells cotransfected with the ER{alpha} expression vector (Fig. 4BCitation , hER{alpha}). This induction was blocked by cotreatment with ICI 182,780, confirming that ER{alpha} is responsible for E2-induced reporter activity (data not shown). In contrast, no effect was observed when MCF-7 cells were transfected with an ERß expression plasmid and VEGF promoter (2.3-kb or deleted fragments)-LUC constructs (Fig. 4BCitation , hERß).

We next used MDA-MB-231 cells as a recipient cell to test the effect of E2 on VEGF transcriptional activity in a receptor isoform-dependent assay (Fig. 5)Citation . E2 did not induce VEGF transcription unless cells were cotransfected with ER (Fig. 5A)Citation , in agreement with the absence of VEGF protein release in E2-treated cells (Fig. 2C)Citation . In contrast, E2 treatment (1 nM) of cells transfected with either ER{alpha} or ERß expression vector resulted in a significant increase in LUC activity (2x and 1.6x, respectively; P < 0.001), as compared with untreated cells (Fig. 5A)Citation . No induction of LUC activity was observed when cells were transfected with p(-1176/+54) or p(+54/+749) (Fig. 5B)Citation .



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5. ER{alpha} and ERß activate the transcription of VEGF in MDA-MB-231 cells. A, cells were transfected with the VEGF(-2275/+54)-LUC construct (A) or deleted mutants (-1176/+54 and +54/+749; B) and CMV-GAL plasmid in the presence of hER{alpha} or hERß expression vectors. Cells were treated with E2, and results are expressed as described in the Fig. 3Citation legend. Results represent the mean ± SE of five experiments. *, P < 0.01.

 
Taken together, these observations indicate that the (-2275/-1176) 5'-flanking region of VEGF promoter contains cis-active elements to mediate E2-induced activation and that the phenomenon is mediated by ER{alpha} in MCF-7 cells.

ERE1520 Is Necessary for E2-induced VEGF Transcription in MCF-7 Cells.
The presence of an imperfect palindromic ERE has been identified in the VEGF promoter, about 1.5 kb upstream of the transcription start (20) . To examine whether this ERE-like sequence functions as an authentic ERE and mediates E2 regulation of the VEGF promoter in breast cancer cells, we next performed gene transfer studies using the ERE1520-LUC plasmid (ERE1520-LUC) in the presence of ER (Fig. 6)Citation . As shown in Fig. 6ACitation , incubation of MCF-7 cells with 1 nM E2 resulted in the stimulation of LUC activity (1.9x), similar to that obtained with cells transfected with the 2.3-kb VEGF promoter (see Figs. 3Citation and 4Citation ). No induction was observed when MCF-7 cells were transfected with the ERE1520-LUC and hERß plasmid (Fig. 6B)Citation or in cells treated with E2 + ICI 182,780 or E2 + OH-TAM or ICI 182,780, OH-TAM, or RAL alone (Fig. 6, A and B)Citation . Taken together, these findings suggest that ERE1520 is clearly involved in E2-induced VEGF gene transcriptional regulation in MCF-7 cells that express ER{alpha} or overexpress this receptor (transfected cells). Unexpectedly in contrast to the full-length plasmid (see Fig. 5Citation ), E2 did not induce LUC activity in MDA-MB-231 cells transfected with ER{alpha} and ERE1520-LUC plasmid (Fig. 6C)Citation .



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6. Transcriptional activity mediated by ERE1520 in breast cancer cells. A and B, MCF-7 cells were cotransfected with ERE1520-LUC vector and CMV-GAL plasmid in the absence (A) or presence (B) of hERß. C, MDA-MB-231 cells were transfected with ERE1520-LUC plasmid and hRE{alpha} or hREß. Transfected cells were treated with E2 (1 nM), ICI 182,780, OH-TAM, or RAL alone (all at 1 µM) or with both E2 and OH-TAM or ICI 182,780. Results represent the mean ± SE of three experiments. *, P < 0.01.

 
VEGF Transcriptional Up-Regulation by E2 and Tamoxifen through ERß in MDA-MB-231 Cells.
Treatments of MDA-MB-231 cells with different hormones allowed further analysis of the regulation of VEGF expression depending on the ER subtype. Whereas E2 did not induce VEGF transcription in MCF-7 cells cotransfected with both ERß plasmid and the 2.3-kb VEGF promoter, ICI 182,780, OH-TAM, and RAL (1 µM) alone consistently induced LUC activity in these cells (P < 0.01; Fig. 7Citation ), suggesting that these agonists/antagonists could modulate VEGF transcription through ERß.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 7. Effects of E2 agonists/antagonists on VEGF expression in MCF-7 cells. Cells were transfected with VEGF(-2275/+54)-LUC, CMV-GAL, and hER{alpha} or hERß expression plasmids. Transfected cells were treated with E2 (1 nM), ICI 182,780 (1 µM), OH-TAM (1 µM), or both E2 and OH-TAM. Results represent the mean ± SE of three experiments. *, P < 0.01.

 
We next analyzed the regulation of VEGF transcription in MDA-MB-231 cells transfected with ERß plasmid (Fig. 8)Citation . Basal transcription level was unchanged in these cells as compared with recipient cells (data not shown); moreover, transcriptional effect was not observed in untransfected cells (endogenous ERß). As mentioned previously (Figs. 5ACitation and 6CCitation ), E2 (1 nM) resulted in a significant increase in LUC activity in MDA-MB-231 cells transfected with ERß expression and the 2.3-kb VEGF promoter vector but in no induction when cells were transfected with ERE1520-LUC. Unexpectedly, the transcriptional activation persisted with ERß-transfected cells cotreated with E2 + OH-TAM or with OH-TAM alone (1.6-fold induction for each treatment; P < 0.05), which was in contrast to the inhibitory effect of OH-TAM on ER{alpha}-transfected cells.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 8. Effects of E2 and agonist/antagonists on VEGF expression in MDA-MB-231 cells. Cells were transfected with VEGF(-2275/+54)-LUC and CMV-GAL plasmid in the presence of hER{alpha} or hERß. The cells were treated with E2 (1 nM), ICI 182,780 (1 µM), OH-TAM (1 µM), or both E2 and OH-TAM. Results represent the mean ± SE of three experiments. *, P < 0.05.

 
The agonistic effect of tamoxifen has been reported previously on ERE-LUC or AP1-LUC constructs depending on ER subtype (42, 43, 44) . To analyze the mechanism of OH-TAM-positive regulation of VEGF in ERß-transfected cells, another reporter gene analysis was performed using a construct containing either the ERE1520 or the AP1 sequence located downstream of ERE1520 in the regulatory region (-2275/-1176) (35) . As observed for ERE1520 with E2, no increase in LUC activity was observed when cells were treated with OH-TAM or E2 (data not shown), indicating that these elements alone do not represent a potential mechanism for OH-TAM-positive regulation of VEGF via ERß in MDA-MB-231 cells.

The ERE1520 Sequence Present in VEGF Promoter Binds ER{alpha} and ERß.
EMSA with a labeled oligonucleotide containing the putative ERE1520 sequence and MCF-7 or ER{alpha}-transfected MDA-MB-231 cell nuclear extracts demonstrated an efficient and similar pattern of protein binding to labeled oligonucleotides (Fig. 9)Citation . The binding was competed by adding a 100-fold excess of unlabeled ERE probe, but not with the probe mutated on a 1/2 ERE (ERE1520*), confirming that the identified ERE element binds ER specifically. Similar experiments conducted in MDA-MB-231 cells (ERß+) also demonstrated efficient binding of the nucleotide (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 9. Binding of proteins corresponding to ER{alpha} and ERß in EMSA with oligonucleotides containing ERE1520. Gel shift analysis was performed on MCF-7 (left panel) or MDA-MB-231 (right panel) nuclear extracts using the 32P-labeled oligonucleotide corresponding to ERE1520 as the probe (Refs. 20 and 35 ; see "Materials and Methods"). Binding competition was performed by adding unlabeled probe at 100-fold excess or mutated ERE oligonucleotide ERE*. The bottom band corresponds to nonspecific binding because it was not competed by excess unlabeled oligonucleotide.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hormone regulation of growth factors is thought to be largely mediated by autocrine and paracrine factors in breast cancers, but little is known of the possible role of the angiogenic factor VEGF in steroid regulation of breast cancer growth (18 , 45) . In this study, we show that VEGF is a target gene for ER{alpha} and ERß in human breast cancer cells and that the response depends on the nature of the ER and the ligand.

Estrogens induce VEGF expression at the transcriptional level in different breast cancer cell lines, in agreement with previous studies in endometrial cells (12 , 13 , 20) . The similar induction of VEGF levels (mRNA expression and protein secretion) and transcriptional activity observed in E2-treated cells (2-fold induction; P < 0.01) suggest that the up-regulation of VEGF mRNA by E2 is primarily caused by gene transcription under our conditions. However, an effect of E2 on VEGF mRNA stability is not excluded (18) . Our results also demonstrate that VEGF induction is mediated by the activation of ER{alpha} in the MCF-7 cells: (a) the estrogenic effect is inhibited by treatment with the pure antiestrogen ICI 182,780; and (b) a similar E2 increase in VEGF activation is observed in MCF-7 cells or MDA-MB-231 cells overexpressing ER{alpha} in transfection experiments. Interestingly, we show that expressed ERß can regulate VEGF transcription in MDA-MB-231 cells, with a slightly weaker activity as compared with that of ER{alpha} shown in this study (ratio, 0.8) and reported previously in endometrial cells (ratio, 0.7; Ref. 20 ) or with ERE response elements (46 , 47) . Thus, VEGF is a target gene for ER{alpha} and ERß in breast cancer cells, in addition to pS2, transforming growth factor {alpha}, or the cyclin kinase inhibitor p21 (47) .

Our data using a series of deletion constructs indicate that the imperfect ERE1520 sequence, which has 70% homology to the consensus ERE sequence, is likely to play an important role in the estrogenic regulation of VEGF production in MCF-7 cells, as deduced by the similar transcriptional activity of (-2275/+54)-LUC and ERE1520-LUC in transfection experiments. These results extend previous findings obtained in endometrial tumor cells (20) . In contrast, the 0.7-kb fragment of human VEGF promoter (+54/+749), which possesses one sequence with 80% homology to the consensus ERE and is capable of ER binding in gel shift experiments (48) , does not confer E2 inducibility in our LUC assay, in agreement with other results obtained in HeLa cells (48) . Our study, however, does not exclude the possibility that other ER-binding sites, such as the ERE present in the 3'-flanking region of the VEGF gene, could participate in the E2-induced VEGF expression (48) ; the possibility of multifactorial control and synergy between E2 and additional regulatory factors also remains to be investigated.

Our in vitro observations further indicate that selective responses to E2 agonists/antagonists depend on the expression and relative levels of each ER subtype. The small but consistent and significant induction of VEGF by OH-TAM in cancer cells expressing ERß or ERß/ER{alpha} (i.e., MDA-MB-231 or MCF-7 cells transfected with ERß, respectively), but not in cells expressing ER{alpha}, indicates that E2/OH-TAM-liganded ERß has different transcriptional activities than E2/OH-TAM-liganded ER{alpha} at VEGF promoter; this finding may be related to the tamoxifen-associated agonist effects reported previously (19 , 49) , especially in vascular smooth muscle and uterine cells that express a significant amount of ERß in the presence of ER{alpha} (19 , 38) . The agonistic effect of tamoxifen has been reported previously on the ERE-LUC construct depending on ER subtype (42) or on the AP1-LUC construct with ERß (43 , 44) , suggesting the possibility that the distinct mechanism between ER{alpha} and ERß could involve different activation functions (AF-1 and AF-2). Whereas tamoxifen appears to have no effect on ERE1520 (VEGF) or AP1 activity alone in either MCF-7 or in MDA-MB-231 cells transfected with ER{alpha} (Ref. 43 and this study), an agonistic effect of tamoxifen on VEGF expression was observed in breast cancer cells expressing ERß; this finding suggests that E2 inhibition and OH-TAM activation of VEGF expression through ERß are not ERE mediated but could involve other sequence(s) within the same region of the promoter, as suggested previously (50) .

The inhibition of VEGF transcription with E2 in the presence of both ER{alpha} and ERß, in contrast with the induction observed when each receptor is expressed alone, could be explained by the formation of homo- or heterodimers. The heterodimerization between ER{alpha} and ERß was demonstrated previously (51 , 52) , but the consequence on estrogen signaling has not fully been determined. Our observations suggest that the transactivational mechanisms of ER{alpha}/ER{alpha}, ERß/ERß, or ER{alpha}/ERß are distinct in breast cancer cells, in agreement with a previous report (53) . Our observations could also have functional significance. Numerous studies have shown that the ERß:ER{alpha} ratio is decreased in cancerous tissues compared with normal tissue, as observed in breast (26 , 30) and ovarian cancers (54) , suggesting that ERß could play a negative role on tumorigenesis. Other studies have suggested that ERß is a major inhibitor of proliferation and invasion of breast cancer cells (47) . Whether modifications of ER{alpha}/ERß in breast cancer could modulate angiogenesis in vivo is still unknown.

Regulation of angiogenesis by steroid hormones is now documented. E2 has been shown to induce VEGF expression in several cell types including endometrial cells, as well as in the uterus (11, 12, 13 , 16 , 20 , 49) and in the rodent mammary gland (45 , 55) . Up-regulation of VEGF has also been demonstrated with progesterone and progestins in some breast cancer cells (17) . Taken together, these findings raise the possibility that E2 and progesterone may regulate the growth of breast cancer in part by stimulating VEGF production and thus increasing the density of the microvasculature, as in 7,12-dimethylbenz(a)anthracene-induced rat mammary cancer (45) . Tamoxifen itself modulates VEGF expression in several cells (19 , 49) , including breast cancer cells, suggesting a paracrine effect on endothelial cells; tamoxifen may also have a direct antiproliferative activity on VEGF-stimulated endothelial cell growth (56) . In vivo, a significant reduction or an increase in vessel density was observed in responsive or nonresponsive breast tumors, respectively, after tamoxifen administration (57 , 58) . This is consistent with previous observations reporting that angiogenesis and ER status are to be considered in predicting response to tamoxifen, with patients having the best prognosis characterized by low vascularity and ER positivity, in addition to few lymph nodes and small low-grade tumors (57) . Also, the decrease of vessel density with tamoxifen is associated with a decreased VEGF expression in breast tumors (10) . However, it is still unknown whether tamoxifen stimulates endothelial cell growth in some breast tumors (tamoxifen-resistant, ERß+ tumors; Ref. 59 ).

In summary, this study demonstrates that E2 and its agonists/antagonists induce VEGF expression in different breast cancer cells through transcriptional effects of ER{alpha} and ERß, depending on the nature of ER subtype and the ligand. Our findings raise the possibility that estrogens can directly stimulate the production of this key angiogenic factor in hormone-responsive tumors. It will be of interest to determine whether ER{alpha} and ERß analysis in breast biopsies correlates with VEGF expression and vascular density and adds further prognostic information with regard to tamoxifen response in angiogenesis.


    ACKNOWLEDGMENTS
 
We thank Prof. P. Chambon for providing plasmids hER{alpha} (HE0) and hERß cDNAs, Dr. J. Pouysségur (Nice, France) for providing constructs containing VEGF promoter fragments, and A. Bringuier (CNRS 6543, Paris, France) for technical assistance in EMSA studies. We thank Dr. C. Legrand for helpful discussions.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Institut National de la Santé et de la Recherche Médicale, the Centre National de la Recherche Scientifique, and the Association pour la Recherche sur le Cancer. Back

2 To whom requests for reprints should be addressed, at INSERM U553, Hôpital Saint Louis, Bâtiment INSERM, 1 Avenue Claude Vellefaux, 75475 Paris Cedex 10, France. Phone/Fax: 33-1-53724029; E-mail: applanat{at}chu-stlouis.fr Back

3 The abbreviations used are: VEGF, vascular endothelial growth factor; E2, 17ß-estradiol; ER, estrogen receptor; hER, human estrogen receptor; ERE, estrogen-responsive element; OH-TAM, 4-hydroxy-tamoxifen; RAL, raloxifene hydrochloride; LUC, luciferase; AP, activator protein; RT-PCR, reverse transcription-PCR; FBS, fetal bovine serum; CMV, cytomegalovirus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back

Received 1/28/02. Accepted 7/ 5/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Weidner N., Semple J. P., Welch W. R., Folkman J. Tumor angiogenesis and metastasis: correlation in invasive breast carcinoma. N. Engl. J. Med., 324: 1-8, 1991.[Abstract]
  2. Folkman J. Angiogenesis in cancer, vascular, rheumatoid, and other disease. Nat. Med., 1: 27-31, 1995.[Medline]
  3. Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat. Med., 6: 389-395, 2000.[Medline]
  4. Ferrara N., Davis-Smith T. The biology of vascular endothelial growth factor. Endocr. Rev., 18: 4-25, 1997.[Abstract/Free Full Text]
  5. Ferrara N., Alitalo K. Clinical applications of angiogenic growth factors and their inhibitors. Nat. Med., 5: 1359-1564, 1999.[Medline]
  6. Brown L. F., Berse B., Jackman R. W., Guidi A. J., Dvorak H. F., Senger D. R., Connolly J. L., Schnitt S. J. Expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in breast cancer. Hum. Pathol., 26: 86-91, 1995.[Medline]
  7. Guidi A. J., Abu-Jawdeh G., Tognazzi K., Dvorak H. F., Brown L. F. Expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in endometrial carcinoma. Cancer (Phila.), 78: 454-460, 1996.[Medline]
  8. Gasparini G., Toi M., Gion M., Verderio P., Dittadi R., Hanatani M., Matsubara I., Vinante O., Bonoldi E., Boracchi P., Gatti C., Suzuki H., Tominaga T. Prognostic significance of vascular endothelial growth factor protein in node-negative breast carcinoma. J. Natl. Cancer Inst. (Bethesda), 89: 139-147, 1997.[Abstract/Free Full Text]
  9. Obermair A., Kucera E., Mayerhofer K., Speiser P., Seifert M., Czerwenka K., Kaider A., Leodolter S., Kainz C., Zeillinger R. Vascular endothelial growth factor (VEGF) in human breast cancer: correlation with disease-free survival. Int. J. Cancer, 74: 455-458, 1997.[Medline]
  10. Adams J., Carder P. J., Downey S., Forbes M. A., MacLennan K., Allgar V., Kaufman S., Hallam S., Bicknell R., Walker J. J., Cairnduff F., Selby P. J., Perren T. J., Lansdown M., Banks R. E. Vascular endothelial growth factor (VEGF) in breast cancer: comparison of plasma, serum, and tissues VEGF and microvessel density and effects of tamoxifen. Cancer Res., 60: 2898-2905, 2000.[Abstract/Free Full Text]
  11. Cullinan-Bove K., Koos R. Vascular endothelial growth factor/vascular permeability factor expression on the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permeability and growth. Endocrinology, 133: 829-837, 1993.[Abstract]
  12. Shifren J. L., Tseng J., Zaloudek C., Ryan I. P., Meng Y. G., Ferrara N., Jaffa R. B., Taylor R. N. Ovarian steroid regulation of vascular endothelial growth factor in human endometrium: implications for angiogenesis during the menstrual cycle and in the pathogenesis of endometriosis. J. Clin. Endocrinol. Metab., 81: 3112-3118, 1996.[Abstract]
  13. Bausero P., Cavaillé F., Meduri G., Freitas S., Perrot-Applanat M. Paracrine action of vascular endothelial growth factor in the human endometrium: production and target sites, and hormonal regulation. Angiogenesis, 2: 167-182, 1998.[Medline]
  14. Ferrara N., Chen H., Davis-Smyth T., Gerber H., Nguyen T., Peers D., Chisholm V., Hillan K. J., Schwall R. H. Vascular endothelial growth factor is essential for corpus luteum angiogenesis. Nat. Med., 4: 336-340, 1998.[Medline]
  15. Nakamura J., Lu Q., Aberdeen G., Albrecht E., Brodie A. The effect of estrogen on aromatase and vascular endothelial growth factor messenger ribonucleic acid in the normal non-human primate mammary gland. J. Clin. Endocrinol. Metab., 84: 1432-1437, 1999.[Abstract/Free Full Text]
  16. Charnock-Jones D. S., Sharkey A. M., Rajput-Williams J., Burch D., Schofield J. P., Fountain S. A., Boocock C. A., Smith S. K. Identification and localization of alternately spliced mRNAs for vascular endothelial growth factor in human uterus and estrogen regulation in endometrial carcinoma cell lines. Biol. Reprod., 48: 1120-1128, 1993.[Abstract]
  17. Hyder S. M., Murthy L., Stancel G. M. Progestin regulation of vascular endothelial growth factor in human breast cancer cells. Cancer Res., 58: 392-395, 1998.[Abstract/Free Full Text]
  18. Ruohola J. K., Valve E. M., Karkkainen M. J., Joukov V., Alitalo K., Härkönen P. L. Vascular endothelial growth factors are differentially regulated by steroid hormones and antiestrogens in breast cancer cells. Mol. Cell. Endocrinol., 149: 29-40, 1999.[Medline]
  19. Bausero P., Ben-Mahdi M. H., Mazucatelli J. P., Bloy C., Perrot-Applanat M. Estradiol, tamoxifen and hypoxia modulate vascular endothelial growth factor in human vascular smooth muscle cells. Am. J. Physiol., 279: H2033-H2042, 2000.[Abstract/Free Full Text]
  20. Mueller M. D., Vigne J-L., Minchenko A., Lebovic D. I., Leitman D. C., Taylor R. N. Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors {alpha} and ß. Proc. Natl. Acad. Sci. USA, 97: 10972-10977, 2000.[Abstract/Free Full Text]
  21. Kuiper G. G. J. M., Enmark E., Huikko M. P. Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA, 93: 5925-5930, 1996.[Abstract/Free Full Text]
  22. Kuiper G. G. J. M., Carlson B., Grandien K. A. J., Enmark E., Haggblad J., Nilsson S., Gustafsson J-A. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors {alpha} and ß. Endocrinology, 138: 863-870, 1997.[Abstract/Free Full Text]
  23. Taylor A. H., Al-Aawizz F. Immunolocalisation of estrogen receptor ß in human tissues. J. Mol. Endocrinol., 24: 145-155, 2000.[Abstract]
  24. Korach K. S. Insights from the study of animals lacking functional estrogen receptor. Science (Wash. DC), 266: 1524-1527, 1994.[Abstract/Free Full Text]
  25. Krege J. H., Hodgin J. B., Couse J. F., Enmark E., Warner M., Mahler J. F., Sar M., Korach K. S., Gustafsson J-A., Smithies O. Generation and reproductive phenotypes of mice lacking estrogen receptor ß. Proc. Natl. Acad. Sci. USA, 95: 15677-15682, 1998.[Abstract/Free Full Text]
  26. Leygue E., Dotzlaw H., Watson P. H., Murphy L. C. Altered estrogen receptor {alpha} and ß messenger RNA expression during human breast tumorigenesis. Cancer Res., 58: 3197-3201, 1998.[Abstract/Free Full Text]
  27. Järvinen T. A. H., Pelto-Huikko M., Holli K., Isola J. Estrogen receptor ß is coexpressed with ER{alpha} and PR and associated with nodal status, grade, and proliferation rate in breast cancer. Am. J. Pathol., 156: 29-35, 2000.[Abstract/Free Full Text]
  28. Dotzlaw H., Leygue E., Watson P. H., Murphy L. C. Estrogen receptor-ß messenger RNA expression in human breast tumor biopsies: relationship to steroid receptor status and regulation by progestins. Cancer Res., 59: 529-532, 1999.[Abstract/Free Full Text]
  29. Speirs V., Parkes A. T., Kerin M. J., Walton D. S., Carleton P. J., Fox J. N., Atkin S. L. Coexpression of estrogen receptor {alpha} and ß: poor prognostic factors in human breast cancer?. Cancer Res., 59: 525-528, 1999.[Abstract/Free Full Text]
  30. Roger P., Sahla M. E., Mäkelä S., Gustafsson J-A., Baldet P., Rochefort H. Decreased expression of estrogen receptor ß protein in proliferative preinvasive mammary tumor. Cancer Res., 61: 2537-2541, 2001.[Abstract/Free Full Text]
  31. Levy A. P., Levy N. S., Wegner S., Goldberg M. A. Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J. Biol. Chem., 270: 13333-13340, 1995.[Abstract/Free Full Text]
  32. Gille J., Swerlick R. A., Caughman S. W. Transforming growth factor-{alpha}-induced transcriptional activation of the vascular permeability factor (VPF/VEGF) gene requires AP-2 dependent DNA binding and transactivation. EMBO J., 16: 750-759, 1997.[Medline]
  33. Milanini J., Vinals F., Pouysségur J., Pagès G. p42/p44 MAP kinase module plays a key role in the transcriptional regulation of the vascular endothelial growth factor gene in fibroblasts. J. Biol. Chem., 273: 18165-18172, 1998.[Abstract/Free Full Text]
  34. Diaz B. V., Lenoir M-C., Ladoux A., Frelin C., Démarchez M., Michel S. Regulation of vascular endothelial growth factor expression in human keratinocytes by retinoids. J. Biol. Chem., 275: 642-650, 2000.[Abstract/Free Full Text]
  35. Tisher E., Mitchell R., Hartman T., Silva M., Gospodarowicz D., Fiddes J. C., Abraham J. A. The human gene for vascular endothelial growth factor. J. Biol. Chem., 266: 11947-11954, 1991.[Abstract/Free Full Text]
  36. Green S., Walter P., Kumar V., Krust A., Bornet J. M., Argos P., Chambon P. Human estrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature (Lond.), 320: 134-139, 1986.[Medline]
  37. Perrot-Applanat M., Guallilo O., Pezet A., Vincent V., Edery M., Kelly P. A. Dominant negative and cooperative effects of mutant forms of prolactin receptor. Mol. Endocrinol., 11: 1020-1032, 1997.[Abstract/Free Full Text]
  38. Lecce G., Meduri G., Ancelin M., Bergeron C., Perrot-Applanat M. Presence of estrogen receptor ß in the human endometrium through the cycle: expression in glandular, stromal, and vascular cells. J. Clin. Endocrinol. Metab., 86: 1379-1386, 2001.[Abstract/Free Full Text]
  39. Sadowski H. B., Gilman M. Z. Cell-free activation of a DNA-binding protein by epidermal growth factor. Nature (Lond.), 362: 79-83, 1993.[Medline]
  40. Nadori F., Lardeux B., Rahmani M., Bringuier A., Durand-Schneider A. M., Bernuau D. Presence of AP-1 dimers in normal and transformed rat hepatocytes under basal conditions and after epidermal growth factor stimulation. Hepatology, 26: 1477-1483, 1997.[Medline]
  41. Perrot-Applanat M., Guiochon-Mantel A., Milgrom E. Immunolocalization of steroid hormone receptors in normal and tumour cells. Mechanisms of their cellular traffic. Cancer Surv., 14: 5-30, 1992.[Medline]
  42. Watanabe T., Inoue S., Ogawa S., Ishii Y., Hiroi H., Ikeda K., Orimo A., Muramatsu M. Agonistic effect of tamoxifen is dependent on cell type, ERE-promoter context, and estrogen receptor subtype: functional difference between receptors {alpha} and ß. Biochem. Biophys. Res. Commun., 236: 140-145, 1997.[Medline]
  43. Webb P., Lopez G. N., Uht R. M., Kushner P. J. Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol. Endocrinol., 9: 443-456, 1995.[Abstract]
  44. Paech K., Webb P., Kuiper G. G. J. M., Nilsson S., Gustafsson J-A., Kushner P. J., Scanlan T. S. Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP-1 sites. Science (Wash. DC), 277: 1508-1510, 1997.[Abstract/Free Full Text]
  45. Nakamura J., Savinov A., Lu Q., Brodie A. Estrogen regulated vascular endothelial growth/permeability factor expression in 7,12-dimethylbenz(a)anthracene-induced rat mammary tumors. Endocrinology, 137: 5589-5596, 1996.[Abstract]
  46. Cowley S. M., Parker M. G. A comparison of transcriptional activation by ER {alpha} and ER ß. J. Steroid Biochem. Mol. Biol., 69: 165-175, 1999.[Medline]
  47. Lazenec G., Bresson D., Lucas A., Chauveau C., Vignon F. ERß inhibits proliferation and invasion of breast cancer cells. Endocrinology, 142: 4120-4130, 2001.[Abstract/Free Full Text]
  48. Hyder S. M., Nawaz Z., Chiappetta C., Stancel G. M. Identification of functional estrogen response elements in the gene coding for the potent angiogenic factor vascular endothelial growth factor. Cancer Res., 60: 3183-3190, 2000.[Abstract/Free Full Text]
  49. Hyder S. M., Stancel G. M., Chiappetta C., Murthy L., Boettger-Tong H. L., Makela S. Uterine expression of vascular endothelial growth factor is increased by estradiol and tamoxifen. Cancer Res., 56: 3954-3960, 1996.[Abstract/Free Full Text]
  50. Kushner P. J., Agard D. A., Greene G. L., Scanlan T. S., Shiau A. K., Uht R. M., Webb P. Estrogen receptor pathways to AP-1. J. Steroid Biochem. Mol. Biol., 74: 311-317, 2000.[Medline]
  51. Cowley S. M., Hoare S., Mosselman S., Parker M. G. Estrogen receptors {alpha} and ß form heterodimers on DNA. J. Biol. Chem., 272: 19858-19862, 1997.[Abstract/Free Full Text]
  52. Pettersson K., Grandien K., Kuiper G. G., Gustafsson J-A. Mouse estrogen receptor ß forms estrogen response element-binding heterodimers with estrogen receptor {alpha}. Mol. Endocrinol., 11: 1486-1496, 1997.[Abstract/Free Full Text]
  53. Pettersson K., Delaunay F., Gustafsson J-A. Estrogen receptor ß acts as a dominant regulator of estrogen signaling. Oncogene, 19: 4970-4978, 2000.[Medline]
  54. Pujol P., Rey J. M., Nirde P., Roger P., Gastaldi M., Laffargue F., Rochefort H., Maudelonde T. Differential expression of estrogen receptor {alpha} and ß messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res., 58: 5367-5373, 1998.[Abstract/Free Full Text]
  55. Kirma N., Gill K., Mandava U., Tekmal R. R. Overexpression of aromatase leads to hyperplasia and changes in the expression of genes involved in apoptosis, cell cycle, growth, and tumor suppressor functions in the mammary glands of transgenic mice. Cancer Res., 61: 1910-1918, 2001.[Abstract/Free Full Text]
  56. Gagliardi A. R., Hennig B., Collins D. C. Antiestrogens inhibit endothelial cell growth stimulated by angiogenic-growth factors. Anticancer Res., 16: 1101-1106, 1994.
  57. Gasparini G., Fox S. B., Verderio P., Bonoldi E., Bevilacqua P., Boracchi P., Dante S., Marubini E., Harris A. L. Determination of angiogenesis adds information to estrogen receptor status in predicting the efficacy of adjuvant tamoxifen in node-positive breast cancer patients. Clin. Cancer Res., 2: 1191-1198, 1996.[Abstract]
  58. Marson L. P., Kurian K. M., Miller W. R., Dixon J. M. The effect of tamoxifen on breast tumor vascularity. Breast Cancer Res. Treat., 66: 9-15, 2001.[Medline]
  59. Speirs V., Malone C., Walton D. S., Kerin M. J., Atkin S. L. Increased expression of estrogen receptor ß mRNA in tamoxifen-resistant breast cancer patients. Cancer Res., 59: 5421-5424, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
K. Guo, V. Gokhale, L. H. Hurley, and D. Sun
Intramolecularly folded G-quadruplex and i-motif structures in the proximal promoter of the vascular endothelial growth factor gene
Nucleic Acids Res., August 1, 2008; 36(14): 4598 - 4608.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. E. Holmes, J. C. Huang, T. R. Pace, A. B. Howard, and H. B. Muss
Tamoxifen and Aromatase Inhibitors Differentially Affect Vascular Endothelial Growth Factor and Endostatin Levels in Women with Breast Cancer
Clin. Cancer Res., May 15, 2008; 14(10): 3070 - 3076.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Banerjee, S. Pancholi, R. A'Hern, Z. Ghazoui, I. E. Smith, M. Dowsett, and L.-A. Martin
The Effects of Neoadjuvant Anastrozole and Tamoxifen on Circulating Vascular Endothelial Growth Factor and Soluble Vascular Endothelial Growth Factor Receptor 1 in Breast Cancer
Clin. Cancer Res., May 1, 2008; 14(9): 2656 - 2663.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
H. Buteau-Lozano, G. Velasco, M. Cristofari, P. Balaguer, and M. Perrot-Applanat
Xenoestrogens modulate vascular endothelial growth factor secretion in breast cancer cells through an estrogen receptor-dependent mechanism
J. Endocrinol., February 1, 2008; 196(2): 399 - 412.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M.-A. Herve, H. Buteau-Lozano, R. Vassy, I. Bieche, G. Velasco, M. Pla, G. Perret, S. Mourah, and M. Perrot-Applanat
Overexpression of Vascular Endothelial Growth Factor 189 in Breast Cancer Cells Leads to Delayed Tumor Uptake with Dilated Intratumoral Vessels
Am. J. Pathol., January 1, 2008; 172(1): 167 - 178.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Hartman, K. Lindberg, A. Morani, J. Inzunza, A. Strom, and J.-A. Gustafsson
Estrogen Receptor {beta} Inhibits Angiogenesis and Growth of T47D Breast Cancer Xenografts
Cancer Res., December 1, 2006; 66(23): 11207 - 11213.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Hamada, M. K. Kim, A. Iwakura, M. Ii, T. Thorne, G. Qin, J. Asai, Y. Tsutsumi, H. Sekiguchi, M. Silver, et al.
Estrogen Receptors {alpha} and {beta} Mediate Contribution of Bone Ma