| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrinology |
and ß1
Institut National de la Santé et de la Recherche Médicale U553, IFR 105 Institut dHématologie Paris 7, Hôpital Saint Louis, 75475 Paris Cedex 10, France [H. B-L., M. A., M. P-A.]; U327, Faculté de Médecine Xavier Bichat, 75870 Paris Cedex 18, France [B. L.]; and CNRS-UMR 6543, Centre de Biochimie, Université de Nice, 06108 Nice, France [J. M.]
| ABSTRACT |
|---|
|
|
|---|
. However, molecular mechanisms of VEGF regulation mediated by the two ER subtypes and the potential role of ERß in the control of breast cancer angiogenesis have not yet been investigated. In transient transfection assays using the VEGF(-2275/+54) promoter-luciferase construct, E2 (1 nM) increased transcription activity in MCF-7 cells (either untransfected or cotransfected with ER
) and it increased transcription activity in MDA-MB-231 cells cotransfected with ER
or ERß (1.8- and 2-fold induction, respectively). The positive effect was abolished when MCF-7 cells were treated with pure antiestrogen ICI 182,780 or the agonist/antagonist tamoxifen (1 µM). To identify response elements involved in this transcriptional regulation, MCF-7 or MDA-MB-231 cells were transfected with several deletion constructs of the VEGF promoter. Deletion of 1.22.3 kb upstream to the transcription start in the VEGF promoter abrogated E2-dependent transcription in these cells. This region contains an imperfect estrogen-responsive element (ERE), ERE1520, and one activator protein 1 site. Transfection of MCF-7 cells (ER
) with the ERE1520-luciferase construct conferred transcriptional activity with 1 nM E2 (1.9-fold induction). Also, the imperfect ERE formed a complex with ER
or ERß proteins in gel shift assay using MCF-7 or MDA-MB-231 nuclear extracts. In contrast to ER
, ERß could transactivate VEGF reporter construct in MDA-MB-231 cells, in the presence of E2 or tamoxifen, suggesting different transactivational mechanisms between ER
and ERß in the presence of tamoxifen. Interestingly, E2 inhibited VEGF transcription in MCF-7 cells transfected with ERß or MDA-MB-231 cells cotransfected with ER
and ERß, suggesting that heterodimerization of ER
/ERß has the ability to inhibit E2-induced VEGF expression in breast cancer cells. These results demonstrate that VEGF is a target gene for ER
and ERß in breast cancer cells; it remains to be determined whether ER
and ERß expression in breast biopsies correlates with VEGF expression and vascular density. | INTRODUCTION |
|---|
|
|
|---|
The mechanism of the estrogenic effect in breast tumors has been reevaluated based on the recent discovery of a second ER, ERß (21)
, expressed in various human tissues including mammary gland and breast cancer (22
, 23)
. Based on studies performed in ER
knockout mice, the presence of ER
, but not ERß, seems to be required to mediate E2-dependent growth and development of the gland (24
, 25)
. Recent results have highlighted the fact that ERß may be important in human breast tumorigenesis, but the significant involvement of ERß has been controversial because it has been suggested to be of good (26
, 27)
or bad (28
, 29)
prognostic value. Recent results have also suggested a protective effect of ERß against the mitogenic activity of E2 in mammary premalignant lesion (30)
. Thus far, a possible link between angiogenesis mediated by VEGF and ER status during breast tumorigenesis in vivo and in vitro has not been investigated.
Functional studies have described the regulation of VEGF expression in response to various stimuli: hypoxia (31) ; growth factors through Sp1/AP2 or AP1 transcription factors (32, 33, 34) ; and E2 in endometrial cells through an imperfect ERE present in the VEGF promoter (20 , 35) .
Here we have investigated E2-induced VEGF expression according to the ER subtype expressed in two breast cancer cell lines, MCF-7 and MDA-MB-231, using various approaches. Our results suggest that E2 regulation of VEGF at the transcriptional level in MCF-7 cells is mainly mediated by a specific ERE. Moreover, tamoxifen has agonist or antagonist activity on VEGF transcription, depending on the nature of the ER, ER
and/or ERß, and possibly involves complex interplay with other sequences in the VEGF promoter.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture.
MCF-7 and MDA-MB-231 cells (a gift from Dr. D. Chalbos; Montpellier, France) were initially obtained from the American Type Culture Collection. They were routinely maintained in DMEM/Hams nutrient mixture F12 (Life Technologies, Inc., Grand Island, NY) and DMEM, respectively, supplemented with 10% FBS, 100 units/ml penicillin, 100 µg/ml streptomycin, and 250 µg/ml amphotericin B (Life Technologies, Inc.) at 37°C and 5% CO2.
Plasmids and Cloning.
The human VEGF promoter gene (3.5 kb) cloned in pUC8 vector was kindly provided by Dr. J. Abraham (Scios Nova Inc., Sunnyvale, CA; Ref. 35
). The VEGF promoter deleted of a 0.7-kb fragment in 3' was subcloned upstream of LUC cDNA in a pGL3 basic reporter plasmid (pGL3b; Promega) [VEGF(-2275/+54)-LUC; a gift of Dr. J. Plouet; Toulouse, France]. Different constructions containing VEGF promoter fragments (-1176/+54, -88/+54, and -66/+54) cloned in pGL2 basic vector are shown in Fig. 4
and were described previously (33)
. The 0.7-kb VEGF fragment (+54/+749) 5'-untranslated region containing an AP1 and half ERE sites was prepared from the full-length VEGF promoter using the Nhe I restriction enzyme and subcloned into the corresponding restriction site of the pGL3b reporter plasmid. The vector (ERE1520)-LUC, containing one copy of the variant ERE of the VEGF promoter (aatcagactgact at position -1520 from the transcription start), was flanked of XhoI and MluI restriction sites and inserted in the corresponding sites of pGL3 promoter vector (Promega). The vector (TRE)6-LUC, containing six copies of TRE elements upstream of the LUC gene, was kindly given by Dr. D. Guédin (Roussel-Uclaf, Romainville, France). All constructs were verified by sequencing. Expression vectors (pSG5) for hER
(HE0) and hERß were generously provided by Prof. P. Chambon (Strasbourg, France; Ref. 36
); data presented in this paper were obtained with the HE0 plasmid. A CMV-GAL reporter corresponding to the ß-galactosidase gene under the control of the CMV promoter was used as a control of transfection efficiency.
|
Human VEGF Immunoassay.
VEGF levels were measured in cell culture media using a Quantikine kit from R&D Diagnostics (Abingdon, United Kingdom). VEGF levels were normalized to the total protein concentration in each dish, as determined by the method of Bradford, and compared statistically.
RNA Extraction and RT-PCR Analysis.
Total RNA was isolated from cultured cells using the Trizol method (Life Technologies, Inc.) according to the manufacturers procedure and stored at -20°C until use. RT-PCR analysis was carried out using total RNA (1 µg) as described previously (19)
.
Semiquantitative RT-PCR Analysis of VEGF mRNA.
Human VEGF primers sequences (Eurogentec) were as follows: sense (5'-CCATGAACTTTCTGCTGTCTTGG-3') and antisense (5'-CTCACCGCCTCGGCTTGTCAC-3') oligonucleotides. Semiquantitative RT-PCR was performed with an annealing at 59°C and a total of 28 cycles for VEGF and an annealing at 56°C for GAPDH, as described previously (19)
. [
-33P]dATP (0.5 µCi; Amersham) was added to the assay mixture (50 µl, final volume). After PCR, the amplified DNA sequence was electrophoresed on 8% (w/v) acrylamide gels (PAGE). Radioactivity in each band was quantified using Instant-Imager analysis (Packard) and the associated software. Results were expressed as band intensity in each lane relative to that of GAPDH and compared statistically using Students t test.
RT-PCR of ERs.
PCR amplification was performed using primers chosen at 598623 and 13921416 positions in hER
cDNA (36)
and primers chosen at 124146 and 498519 positions in hERß cDNA (21)
, as described previously (38)
. GAPDH was used as an invariant housekeeping gene control.
Preparation of Cell Extract and EMSAs.
MCF-7 and MDA-MB-231 transfected cells were stimulated in serum-free medium with 1 nM E2 at 37°C for 1 h, and nuclear extracts were prepared as described previously (39)
. Double-stranded oligonucleotides containing the putative ERE located in the fragment of the VEGF promoter (-1570 to -1176) were synthesized (aatcagactgactggcctcagagccc) and end-labeled by 5' phosphorylation with T4 polynucleotide kinase and [
-32P]ATP (NEN Perkin-Elmer). EMSAs were carried out as described previously (40)
, with minor modifications. Briefly, 32P-labeled ERE (4 x 105 cpm/reaction) was combined with 515 µg of nuclear protein extracts and poly-dIdC (Sigma) used as nonspecific carrier DNA in 20 µl of buffer [15 mM Tris-HCl (pH 7.9) containing 75 mM KCl, 0.2 mM EDTA, and 0.4 mM DTT]; the mixture was placed on ice for 15 min. Protein-DNA complexes were separated from the free probe by nondenaturing 5% PAGE at 150 V with running buffer consisting of 25 mM Tris/25 mM borate/1 mM EDTA. Gels were dried, and the radioactivity associated with ERE and ER-ERE complexes was quantified. Binding competition was performed by adding unlabeled probes at 100-fold excess.
Statistical Analysis.
Students t test was used to determine the significance between treatments and untreated controls, and P < 0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
transcripts (Fig. 1)
protein was clearly detected compared with ERß, which was not detected in MCF-7 cells using immunocytochemistry (data not shown; Ref. 41
).
|
|
.
|
or hERß. The basal transcription level was unchanged, regardless of whether MCF-7 cells were transfected with ER
plasmid or not (data not shown). E2 treatment (1 nM) of MCF-7 cells transfected with ER
resulted in a significant increase in LUC activity (1.72 ± 0.02; P < 0.01) as compared with untreated cells, and similar to that obtained with untransfected cells (Fig. 3)
Transcriptional Up-Regulation of VEGF by E2 Is Dependent on a Distal Region of the Promoter (-2275/-1176) in Breast Cancer Cells.
To identify response elements implicated in the transcriptional regulation of VEGF by E2, we next examined transcriptional activities of constructs containing several deletions of the 2.3-kb VEGF promoter (Fig. 4A)
. In MCF-7 cells containing endogenous ER
(Fig. 4B
, pSG5), E2 induced a significant increase of VEGF(-2275/+54)-LUC activity, but it had no effect on cells transfected with deleted vectors (-1176/+54, -88/+54, -66/+54, or +54/+749). Similar results were observed using MCF-7 cells cotransfected with the ER
expression vector (Fig. 4B
, hER
). This induction was blocked by cotreatment with ICI 182,780, confirming that ER
is responsible for E2-induced reporter activity (data not shown). In contrast, no effect was observed when MCF-7 cells were transfected with an ERß expression plasmid and VEGF promoter (2.3-kb or deleted fragments)-LUC constructs (Fig. 4B
, hERß).
We next used MDA-MB-231 cells as a recipient cell to test the effect of E2 on VEGF transcriptional activity in a receptor isoform-dependent assay (Fig. 5)
. E2 did not induce VEGF transcription unless cells were cotransfected with ER (Fig. 5A)
, in agreement with the absence of VEGF protein release in E2-treated cells (Fig. 2C)
. In contrast, E2 treatment (1 nM) of cells transfected with either ER
or ERß expression vector resulted in a significant increase in LUC activity (2x and 1.6x, respectively; P < 0.001), as compared with untreated cells (Fig. 5A)
. No induction of LUC activity was observed when cells were transfected with p(-1176/+54) or p(+54/+749) (Fig. 5B)
.
|
in MCF-7 cells.
ERE1520 Is Necessary for E2-induced VEGF Transcription in MCF-7 Cells.
The presence of an imperfect palindromic ERE has been identified in the VEGF promoter, about 1.5 kb upstream of the transcription start (20)
. To examine whether this ERE-like sequence functions as an authentic ERE and mediates E2 regulation of the VEGF promoter in breast cancer cells, we next performed gene transfer studies using the ERE1520-LUC plasmid (ERE1520-LUC) in the presence of ER (Fig. 6)
. As shown in Fig. 6A
, incubation of MCF-7 cells with 1 nM E2 resulted in the stimulation of LUC activity (1.9x), similar to that obtained with cells transfected with the 2.3-kb VEGF promoter (see Figs. 3
and 4
). No induction was observed when MCF-7 cells were transfected with the ERE1520-LUC and hERß plasmid (Fig. 6B)
or in cells treated with E2 + ICI 182,780 or E2 + OH-TAM or ICI 182,780, OH-TAM, or RAL alone (Fig. 6, A and B)
. Taken together, these findings suggest that ERE1520 is clearly involved in E2-induced VEGF gene transcriptional regulation in MCF-7 cells that express ER
or overexpress this receptor (transfected cells). Unexpectedly in contrast to the full-length plasmid (see Fig. 5
), E2 did not induce LUC activity in MDA-MB-231 cells transfected with ER
and ERE1520-LUC plasmid (Fig. 6C)
.
|
|
-transfected cells.
|
The ERE1520 Sequence Present in VEGF Promoter Binds ER
and ERß.
EMSA with a labeled oligonucleotide containing the putative ERE1520 sequence and MCF-7 or ER
-transfected MDA-MB-231 cell nuclear extracts demonstrated an efficient and similar pattern of protein binding to labeled oligonucleotides (Fig. 9)
. The binding was competed by adding a 100-fold excess of unlabeled ERE probe, but not with the probe mutated on a 1/2 ERE (ERE1520*), confirming that the identified ERE element binds ER specifically. Similar experiments conducted in MDA-MB-231 cells (ERß+) also demonstrated efficient binding of the nucleotide (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
and ERß in human breast cancer cells and that the response depends on the nature of the ER and the ligand.
Estrogens induce VEGF expression at the transcriptional level in different breast cancer cell lines, in agreement with previous studies in endometrial cells (12
, 13
, 20)
. The similar induction of VEGF levels (mRNA expression and protein secretion) and transcriptional activity observed in E2-treated cells (2-fold induction; P < 0.01) suggest that the up-regulation of VEGF mRNA by E2 is primarily caused by gene transcription under our conditions. However, an effect of E2 on VEGF mRNA stability is not excluded (18)
. Our results also demonstrate that VEGF induction is mediated by the activation of ER
in the MCF-7 cells: (a) the estrogenic effect is inhibited by treatment with the pure antiestrogen ICI 182,780; and (b) a similar E2 increase in VEGF activation is observed in MCF-7 cells or MDA-MB-231 cells overexpressing ER
in transfection experiments. Interestingly, we show that expressed ERß can regulate VEGF transcription in MDA-MB-231 cells, with a slightly weaker activity as compared with that of ER
shown in this study (ratio, 0.8) and reported previously in endometrial cells (ratio, 0.7; Ref. 20
) or with ERE response elements (46
, 47)
. Thus, VEGF is a target gene for ER
and ERß in breast cancer cells, in addition to pS2, transforming growth factor
, or the cyclin kinase inhibitor p21 (47)
.
Our data using a series of deletion constructs indicate that the imperfect ERE1520 sequence, which has 70% homology to the consensus ERE sequence, is likely to play an important role in the estrogenic regulation of VEGF production in MCF-7 cells, as deduced by the similar transcriptional activity of (-2275/+54)-LUC and ERE1520-LUC in transfection experiments. These results extend previous findings obtained in endometrial tumor cells (20) . In contrast, the 0.7-kb fragment of human VEGF promoter (+54/+749), which possesses one sequence with 80% homology to the consensus ERE and is capable of ER binding in gel shift experiments (48) , does not confer E2 inducibility in our LUC assay, in agreement with other results obtained in HeLa cells (48) . Our study, however, does not exclude the possibility that other ER-binding sites, such as the ERE present in the 3'-flanking region of the VEGF gene, could participate in the E2-induced VEGF expression (48) ; the possibility of multifactorial control and synergy between E2 and additional regulatory factors also remains to be investigated.
Our in vitro observations further indicate that selective responses to E2 agonists/antagonists depend on the expression and relative levels of each ER subtype. The small but consistent and significant induction of VEGF by OH-TAM in cancer cells expressing ERß or ERß/ER
(i.e., MDA-MB-231 or MCF-7 cells transfected with ERß, respectively), but not in cells expressing ER
, indicates that E2/OH-TAM-liganded ERß has different transcriptional activities than E2/OH-TAM-liganded ER
at VEGF promoter; this finding may be related to the tamoxifen-associated agonist effects reported previously (19
, 49)
, especially in vascular smooth muscle and uterine cells that express a significant amount of ERß in the presence of ER
(19
, 38)
. The agonistic effect of tamoxifen has been reported previously on the ERE-LUC construct depending on ER subtype (42)
or on the AP1-LUC construct with ERß (43
, 44)
, suggesting the possibility that the distinct mechanism between ER
and ERß could involve different activation functions (AF-1 and AF-2). Whereas tamoxifen appears to have no effect on ERE1520 (VEGF) or AP1 activity alone in either MCF-7 or in MDA-MB-231 cells transfected with ER
(Ref. 43
and this study), an agonistic effect of tamoxifen on VEGF expression was observed in breast cancer cells expressing ERß; this finding suggests that E2 inhibition and OH-TAM activation of VEGF expression through ERß are not ERE mediated but could involve other sequence(s) within the same region of the promoter, as suggested previously (50)
.
The inhibition of VEGF transcription with E2 in the presence of both ER
and ERß, in contrast with the induction observed when each receptor is expressed alone, could be explained by the formation of homo- or heterodimers. The heterodimerization between ER
and ERß was demonstrated previously (51
, 52) , but the consequence on estrogen signaling has not fully been determined. Our observations suggest that the transactivational mechanisms of ER
/ER
, ERß/ERß, or ER
/ERß are distinct in breast cancer cells, in agreement with a previous report (53)
. Our observations could also have functional significance. Numerous studies have shown that the ERß:ER
ratio is decreased in cancerous tissues compared with normal tissue, as observed in breast (26
, 30)
and ovarian cancers (54)
, suggesting that ERß could play a negative role on tumorigenesis. Other studies have suggested that ERß is a major inhibitor of proliferation and invasion of breast cancer cells (47)
. Whether modifications of ER
/ERß in breast cancer could modulate angiogenesis in vivo is still unknown.
Regulation of angiogenesis by steroid hormones is now documented. E2 has been shown to induce VEGF expression in several cell types including endometrial cells, as well as in the uterus (11, 12, 13 , 16 , 20 , 49) and in the rodent mammary gland (45 , 55) . Up-regulation of VEGF has also been demonstrated with progesterone and progestins in some breast cancer cells (17) . Taken together, these findings raise the possibility that E2 and progesterone may regulate the growth of breast cancer in part by stimulating VEGF production and thus increasing the density of the microvasculature, as in 7,12-dimethylbenz(a)anthracene-induced rat mammary cancer (45) . Tamoxifen itself modulates VEGF expression in several cells (19 , 49) , including breast cancer cells, suggesting a paracrine effect on endothelial cells; tamoxifen may also have a direct antiproliferative activity on VEGF-stimulated endothelial cell growth (56) . In vivo, a significant reduction or an increase in vessel density was observed in responsive or nonresponsive breast tumors, respectively, after tamoxifen administration (57 , 58) . This is consistent with previous observations reporting that angiogenesis and ER status are to be considered in predicting response to tamoxifen, with patients having the best prognosis characterized by low vascularity and ER positivity, in addition to few lymph nodes and small low-grade tumors (57) . Also, the decrease of vessel density with tamoxifen is associated with a decreased VEGF expression in breast tumors (10) . However, it is still unknown whether tamoxifen stimulates endothelial cell growth in some breast tumors (tamoxifen-resistant, ERß+ tumors; Ref. 59 ).
In summary, this study demonstrates that E2 and its agonists/antagonists induce VEGF expression in different breast cancer cells through transcriptional effects of ER
and ERß, depending on the nature of ER subtype and the ligand. Our findings raise the possibility that estrogens can directly stimulate the production of this key angiogenic factor in hormone-responsive tumors. It will be of interest to determine whether ER
and ERß analysis in breast biopsies correlates with VEGF expression and vascular density and adds further prognostic information with regard to tamoxifen response in angiogenesis.
| ACKNOWLEDGMENTS |
|---|
(HE0) and hERß cDNAs, Dr. J. Pouysségur (Nice, France) for providing constructs containing VEGF promoter fragments, and A. Bringuier (CNRS 6543, Paris, France) for technical assistance in EMSA studies. We thank Dr. C. Legrand for helpful discussions. | FOOTNOTES |
|---|
1 Supported by the Institut National de la Santé et de la Recherche Médicale, the Centre National de la Recherche Scientifique, and the Association pour la Recherche sur le Cancer. ![]()
2 To whom requests for reprints should be addressed, at INSERM U553, Hôpital Saint Louis, Bâtiment INSERM, 1 Avenue Claude Vellefaux, 75475 Paris Cedex 10, France. Phone/Fax: 33-1-53724029; E-mail: applanat{at}chu-stlouis.fr ![]()
3 The abbreviations used are: VEGF, vascular endothelial growth factor; E2, 17ß-estradiol; ER, estrogen receptor; hER, human estrogen receptor; ERE, estrogen-responsive element; OH-TAM, 4-hydroxy-tamoxifen; RAL, raloxifene hydrochloride; LUC, luciferase; AP, activator protein; RT-PCR, reverse transcription-PCR; FBS, fetal bovine serum; CMV, cytomegalovirus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. ![]()
Received 1/28/02. Accepted 7/ 5/02.
| REFERENCES |
|---|
|
|
|---|
and ß. Proc. Natl. Acad. Sci. USA, 97: 10972-10977, 2000.
and ß. Endocrinology, 138: 863-870, 1997.
and ß messenger RNA expression during human breast tumorigenesis. Cancer Res., 58: 3197-3201, 1998.
and PR and associated with nodal status, grade, and proliferation rate in breast cancer. Am. J. Pathol., 156: 29-35, 2000.
and ß: poor prognostic factors in human breast cancer?. Cancer Res., 59: 525-528, 1999.
-induced transcriptional activation of the vascular permeability factor (VPF/VEGF) gene requires AP-2 dependent DNA binding and transactivation. EMBO J., 16: 750-759, 1997.[Medline]
and ß. Biochem. Biophys. Res. Commun., 236: 140-145, 1997.[Medline]
and ERß at AP-1 sites. Science (Wash. DC), 277: 1508-1510, 1997.
and ER ß. J. Steroid Biochem. Mol. Biol., 69: 165-175, 1999.[Medline]
and ß form heterodimers on DNA. J. Biol. Chem., 272: 19858-19862, 1997.
. Mol. Endocrinol., 11: 1486-1496, 1997.
and ß messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res., 58: 5367-5373, 1998.This article has been cited by other articles:
![]() |
C. Atsriku, D. J. Britton, J. M. Held, B. Schilling, G. K. Scott, B. W. Gibson, C. C. Benz, and M. A. Baldwin Systematic Mapping of Posttranslational Modifications in Human Estrogen Receptor-{alpha} with Emphasis on Novel Phosphorylation Sites Mol. Cell. Proteomics, March 1, 2009; 8(3): 467 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Taylor, Jie Yu, P. B. Torres, A. C. Schickedanz, J. K. Park, M. D. Mueller, and N. Sidell Mechanistic and Therapeutic Implications of Angiogenesis in Endometriosis Reproductive Sciences, February 1, 2009; 16(2): 140 - 146. [Abstract] [PDF] |
||||
![]() |
K. Guo, V. Gokhale, L. H. Hurley, and D. Sun Intramolecularly folded G-quadruplex and i-motif structures in the proximal promoter of the vascular endothelial growth factor gene Nucleic Acids Res., August 1, 2008; 36(14): 4598 - 4608. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Holmes, J. C. Huang, T. R. Pace, A. B. Howard, and H. B. Muss Tamoxifen and Aromatase Inhibitors Differentially Affect Vascular Endothelial Growth Factor and Endostatin Levels in Women with Breast Cancer Clin. Cancer Res., May 15, 2008; 14(10): 3070 - 3076. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Banerjee, S. Pancholi, R. A'Hern, Z. Ghazoui, I. E. Smith, M. Dowsett, and L.-A. Martin The Effects of Neoadjuvant Anastrozole and Tamoxifen on Circulating Vascular Endothelial Growth Factor and Soluble Vascular Endothelial Growth Factor Receptor 1 in Breast Cancer Clin. Cancer Res., May 1, 2008; 14(9): 2656 - 2663. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Buteau-Lozano, G. Velasco, M. Cristofari, P. Balaguer, and M. Perrot-Applanat Xenoestrogens modulate vascular endothelial growth factor secretion in breast cancer cells through an estrogen receptor-dependent mechanism J. Endocrinol., February 1, 2008; 196(2): 399 - 412. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-A. Herve, H. Buteau-Lozano, R. Vassy, I. Bieche, G. Velasco, M. Pla, G. Perret, S. Mourah, and M. Perrot-Applanat Overexpression of Vascular Endothelial Growth Factor 189 in Breast Cancer Cells Leads to Delayed Tumor Uptake with Dilated Intratumoral Vessels Am. J. Pathol., January 1, 2008; 172(1): 167 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hartman, K. Lindberg, A. Morani, J. Inzunza, A. Strom, and J.-A. Gustafsson Estrogen Receptor {beta} Inhibits Angiogenesis and Growth of T47D Breast Cancer Xenografts Cancer Res., December 1, 2006; 66(23): 11207 - 11213. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hamada, M. K. Kim, A. Iwakura, M. Ii, T. Thorne, G. Qin, J. Asai, Y. Tsutsumi, H. Sekiguchi, M. Silver, et al. Estrogen Receptors {alpha} and {beta} Mediate Contribution of Bone Marrow-Derived Endothelial Progenitor Cells to Functional Recovery After Myocardial Infarction Circulation, November 21, 2006; 114(21): 2261 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
S M Hyder Sex-steroid regulation of vascular endothelial growth factor in breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 667 - 687. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kim, M. Kaneko, K. Arihiro, M. Emi, K. Tanabe, S. Murakami, A. Osaki, and K. Inai Extranuclear expression of hormone receptors in primary breast cancer Ann. Onc., August 1, 2006; 17(8): 1213 - 1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Higgins, S. Liu, M. Abdelrahim, K. Yoon, K. Vanderlaag, W. Porter, R. P. Metz, and S. Safe Vascular Endothelial Growth Factor Receptor-2 Expression Is Induced by 17{beta}-Estradiol in ZR-75 Breast Cancer Cells by Estrogen Receptor {alpha}/Sp Proteins Endocrinology, July 1, 2006; 147(7): 3285 - 3295. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cherradi, C. Lejczak, A. Desroches-Castan, and J.-J. Feige Antagonistic Functions of Tetradecanoyl Phorbol Acetate-Inducible-Sequence 11b and HuR in the Hormonal Regulation of Vascular Endothelial Growth Factor Messenger Ribonucleic Acid Stability by Adrenocorticotropin Mol. Endocrinol., April 1, 2006; 20(4): 916 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Kazi, J. M. Jones, and R. D. Koos Chromatin Immunoprecipitation Analysis of Gene Expression in the Rat Uterus in Vivo: Estrogen-Induced Recruitment of Both Estrogen Receptor {alpha} and Hypoxia-Inducible Factor 1 to the Vascular Endothelial Growth Factor Promoter Mol. Endocrinol., August 1, 2005; 19(8): 2006 - 2019. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Wood, K. Bove, S. You, A. Chambers, and W. J.M. Hrushesky Cancer growth and spread are saltatory and phase-locked to the reproductive cycle through mediators of angiogenesis Mol. Cancer Ther., July 1, 2005; 4(7): 1065 - 1075. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pages and J. Pouyssegur Transcriptional regulation of the Vascular Endothelial Growth Factor gene-a concert of activating factors Cardiovasc Res, February 15, 2005; 65(3): 564 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, N. Wakisaka, C. C Tomlinson, S. M DeWire, S. Krall, J. S Pagano, and B. Damania The Kaposi's Sarcoma-Associated Herpesvirus (KSHV/HHV-8) K1 Protein Induces Expression of Angiogenic and Invasion Factors Cancer Res., April 15, 2004; 64(8): 2774 - 2781. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, J. Richer, K. B. Horwitz, and S. M. Hyder Progestin-Dependent Induction of Vascular Endothelial Growth Factor in Human Breast Cancer Cells: Preferential Regulation by Progesterone Receptor B Cancer Res., March 15, 2004; 64(6): 2238 - 2244. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Tangkeangsirisin, J. Hayashi, and G. Serrero PC Cell-Derived Growth Factor Mediates Tamoxifen Resistance and Promotes Tumor Growth of Human Breast Cancer Cells Cancer Res., March 1, 2004; 64(5): 1737 - 1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu, R. J. Traystman, P. D. Hurn, and M. M. Wang Membrane Restraint of Estrogen Receptor {alpha} Enhances Estrogen-Dependent Nuclear Localization and Genomic Function Mol. Endocrinol., January 1, 2004; 18(1): 86 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cui and A. V. Lee Regulatory Nodes That Integrate and Coordinate Signaling as Potential Targets for Breast Cancer Therapy Clin. Cancer Res., January 1, 2004; 10(1): 396S - 401S. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Guo, Q. Fang, H.-Q. Tao, C. A. Schafer, B. M. Fenton, I. Ding, B. Hu, and S.-Y. Cheng Overexpression of Vascular Endothelial Growth Factor by MCF-7 Breast Cancer Cells Promotes Estrogen-independent Tumor Growth in Vivo Cancer Res., August 1, 2003; 63(15): 4684 - 4691. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |