| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Laboratory of Cancer Genomics, Hollings Cancer Center, Medical University of South Carolina, Charleston, South Carolina 29403
| ABSTRACT |
|---|
|
|
|---|
Val317) that causes congenital chloride diarrhea and results in a loss of anion transport had no effect on growth suppression, indicating that anion transport and growth suppression are independent functions of DRA. One cell line, adenovirus-transformed HEK293, exhibited significant resistance to DRA-induced growth suppression, whereas the human papillomavirus-transformed cell lines, CaSki and HeLa, did not. E1A is an adenoviral protein required to transform HEK293 cells. DLD-1 cells that stably express 12S E1A are resistant to growth suppression by DRA, similar to HEK293 cells. | INTRODUCTION |
|---|
|
|
|---|
148,000 new cases in 2002 (1)
. Colorectal cancer is the third leading cause of mortality from cancer for both men and women, following only lung and breast or prostate cancers. The average person has a 1 in 18 lifetime chance of contracting colon cancer (2)
. Vogelstein and colleagues (3, 4, 5) have proposed a model outlining the genetic events responsible for colon cancer. Mutations in these genes can be inherited or arise spontaneously through somatic mutations. Among the genes playing a prominent role in colorectal cancer are the tumor suppressor genes APC, p53, and DCC and oncogenes such as K-ras and c-myc. Other types of genes known to play a role in colon cancer are those responsible for DNA repair, such as hMSH2 and hMLH1 (3 , 6) . Although mutations of these genes are often the cause for the development of neoplasms, epigenetic changes such as hypermethylation of genes also occur frequently in colon cancers (2 , 7 , 8) .
We have previously described a gene, DRA,5 that is transcriptionally down-regulated early in the neoplastic process. DRA was found by subtractive hybridization to be underexpressed or absent in colon cancer samples compared with their normal counterparts (9, 10, 11) . Expression of DRA is primarily on the apical surface of the columnar epithelial cells of the normal colon. Other areas of expression include small intestine, intraprostatic seminal vesicle (12) , proximal tubule of the kidney, and eccrine sweat gland (13) .
DRA shares significant homology with a family of sulfate transporters. Functional assays in both Xenopus laevis oocytes and Sf9 insect cells confirmed that DRA is capable of facilitating transport of sulfate, chloride, and oxalate in vitro (14, 15, 16, 17, 18) . Mutations in DRA were found to be responsible for a rare disease known as CLD (19) . This disease presents as early as in utero as voluminous, watery diarrhea with an extremely high chloride content. This pathology is attributable to lack of chloride uptake in the colon, a major site of chloride uptake in the body (20) .
Although the role of DRA in CLD is readily interpreted, its role in colon cancer is not yet clear. The observed underexpression or loss of DRA in colon cancer could be explained by one of two rationales. Down-regulation of DRA could simply be a result of the dedifferentiation process that occurs during cancer progression. Alternatively, down-regulation of DRA might play a role in the stepwise process by which colon cancer progresses. We present data in this report suggesting that loss of DRA does play an active role in colon cancer progression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Colony Suppression Assay.
Transfections were by the Lipofectin, Lipofectamine (Life Technologies, Inc.), or FuGene 6 (Roche, Indianapolis, IN) manufacturers protocols. Typically, 2 µg of DNA were used to transfect one 35-mm well when cells were approximately 5080% confluent. For stable selection, cells were trypsinized and distributed to two 100-mm culture dishes (10 and 90%) 4872 h after transfection. Drug selection in G418 (400 µg/ml for DLD-1, HT29, HCT-15, and SW837; 600 µg/ml for MCF-7; 800 µg/ml for SW480, HeLa, and HEK293; 80 µg/ml for CaSki) continued for 2 weeks. Colony counts were carried out by first washing the plates once with PBS. They were fixed and stained with 0.2% crystal violet/20% methanol and then counted. DLD-1 cells were selected in 200 µg/ml zeocin for stable E1A expression.
Expression Vectors.
The pSGneo vector was constructed by adding the bacterial neomycin resistance gene cassette to the mammalian expression vector, pSG5 (Stratagene, La Jolla, CA).) An AatII-DraIII fragment from pSG5 was removed and replaced with an AatII-DraIII fragment from the pOP13CAT vector that contained the neomycin resistance gene.
The following deletion mutants of DRA cDNA in the pSGneo vector were constructed: (a) Dra
606764 was made by removing an EarI-BglII fragment from the pSGneoDRA construct, filling in the 3' recessed DNA ends with Klenow fragment and blunt religation of the plasmid. This removes the codons for amino acids 606764 (end) and adds 16 amino acids (Ile-Leu-Leu-Lys-Gln-Asn-Leu-Phe-Ile-Ala-Ala-Tyr-Asn-Gly-Tyr-Lys-STOP) encoded by the vector; (b) Dra
V317 was made by mutagenic PCR (21)
using the mutagenic primer pTAAAAACAGGTTTAAAGTGGCTGTGGGGGACATG (5' phosphorylated with T4 polynucleotide kinase; New England BioLabs, Beverly MA), along with the exterior primer pair 5'-CATTTGCTCTGCTGGTCGACATTC (forward) and 5'-CAGTCCCAAGGCTATTAACTCCTG (reverse). PCR was performed with 10 ng of template DNA using a two-step protocol (94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 65°C for 5 min, and then 65°C for 15 min) using Deep Vent DNA polymerase (New England BioLabs, Beverly, MA). The PCR product was digested with PflMI, purified by agarose gel electrophoresis, and cloned into the two PflMI sites within DRA cDNA in the pSGneo vector. The mutation was verified by direct sequence analysis.
For tetracycline-repressible expression (22) in DLD-1 cells, DRA cDNA was cloned into the BglII site of the vector pUHD10-3hygro (pUHD10-3 containing a hygromycin resistance gene) to generate the plasmid pUHD10-3hygroDRA. This construct was transfected into a DLD-1 clone that had previously been stably transfected with the vector pUHD15-1neo (pUHD15-1 containing a neomycin/G418 resistance gene), which constitutively expresses the tetracycline repressor. Stable clones were selected in 200 µg/ml G418 and 200 µg/ml hygromycin and maintained in the presence of 1 µg/ml tetracycline to keep the DRA cDNA from being expressed. Individual clones were tested for DRA mRNA expression upon removal of tetracycline. Most clones showed a dramatic increase in DRA mRNA levels.
E1A in pSGzeo was constructed by first removing the neomycin resistance gene from pSGneo with a RsrII-MluI digest. The zeocin resistance cassette was removed from pcDNA3.1/Zeo (Invitrogen, Carlsbad, CA) with a BstYI digest and isolation of the 556-bp fragment. DNA ends were filled in with Klenow enzyme, and blunt-end ligation was carried out. 12S E1A (a gift from David Kurtz, Medical University of South Carolina) was removed from pBluescriptKS with a HindIII/ApaI digest and inserted into the HindIII/ApaI site of pSGzeo.
Sulfate Transport Assay.
Sulfate transport assays were conducted as described previously with some modifications (23)
. At confluency, cells were rinsed twice with low-ionic strength buffer (1 mM MgCl2, 300 mM sucrose, 10 mM Tris-HEPES, pH 7.5) containing various concentrations of Na2SO4 (0, 50, 100, and 400 µM SO4-2). They were next incubated for 10 min at 37°C in 1 ml of buffer with various levels of unlabeled Na2SO4 as above plus 0.13 µM of carrier-free [35S]sulfate (Amersham Pharmacia, Piscataway, NJ). Cells were then washed twice with 3.5 ml of ice-cold wash solution (100 mM sucrose, 100 mM NaNO3, 1 mM MgCl2, and 10 mM Tris-HEPES, pH 7.5) and lysed in 1 ml of NETN [0.5% NP40, 20 mM Tris (pH 8.0), 100 mM NaCl, and 1 mM EDTA]. Lysates were subjected to scintillation counting, and protein concentration was analyzed by the BCA method (Pierce, Rockford, IL). DIDS sensitivity was assessed using 1 mM DIDS.
Immunofluorescence.
Fluorescence immunohistochemical staining was performed with the polyclonal antibody I20F to the COOH terminus of DRA as described previously (10)
.
Growth Curves.
For growth curve analysis,
300,000 cells were seeded into 35-mm wells in the presence or absence of 1 µg/ml tetracycline. Cells were fed every day. Each day for 7 days, cells were trypsinized and counted. Growth assays were performed in triplicate.
SDS-PAGE and Western Blot.
Twenty µg of total cell protein/lane were resolved by SDS-PAGE on 10 or 12% polyacrylamide gels. Proteins were then transferred to polyvinylidene difluoride or nitrocellulose membrane. Membranes were blocked in 5% milk in TBS with 0.1% Tween 20 (TBST) for 30 min. Incubation with DRA and E1A (Transduction Laboratories, Lexington, KY) primary antibodies diluted to 1 µg/ml in blocking solution was carried out at room temperature for 1 h, followed by three 5-min washes with TBST. Secondary antibodies (goat-antimouse-horseradish peroxidase for E1A and goat-antirabbit-horseradish peroxidase for DRA; DAKO Corp., Carpinteria, CA) were diluted 1:1000 in blocking buffer and incubated with membranes for 1 h at room temperature. Detection with ECL Plus (Amersham Pharmacia), followed according to the manufacturers protocol.
| RESULTS |
|---|
|
|
|---|
|
|
606764 removes the last 158 amino acids from the protein. The mutant DRA
V317 is a disease-causing mutation in CLD that has been shown to prevent anion transport (16
, 19) . The growth-suppression capabilities of these mutants were assessed in a colony-suppression assay using DLD-1 cells as described for Fig. 1
606764 mutant gave colony counts similar to those for vector control, as did the mutant containing only the COOH-terminal amino acids 606764. This suggests that the COOH-terminal tail of DRA is required but not sufficient for growth suppression. In contrast, the DRA
V317 mutant gave colony counts similar to those obtained for full-length DRA, suggesting that the growth control and anion transport functions of DRA are independent. Similar results were obtained when the transfections were performed in NIH3T3 cells (data not shown).
|
|
60% in HEK293 cells versus 1030% in other cell lines). Therefore, partial abrogation of growth suppression by DRA was observed in HEK293 cells and suggested that one or both of the adenovirus-transforming proteins (E1A and E1B) may be involved.
|
50% in Fig. 6B
|
| DISCUSSION |
|---|
|
|
|---|
Inducible expression of DRA provided further evidence that it is a growth suppressor. Upon DRA induction (by tetracycline removal) in a stable transfectant, its growth rate was dramatically decreased as seen by cell counts over a 7-day period (see Fig. 2
). This could conceivably be attributed to cell death rather than growth arrest. However, there were no obvious signs of cell toxicity or apoptosis. No increased amount of cell debris or floating cells indicative of cell death was observed. Also, no obvious signs of apoptosis, such as membrane blebbing, were observed. Furthermore, the cells survived several rounds of growth in tetracycline, followed by growth cessation in the absence of the tetracycline (data not shown.) This indicates that cell death was not a major factor contributing to the flat growth curve during DRA protein expression. Importantly, the observed growth suppression by DRA is precisely consistent with our previous report showing that the only cells in the colonic mucosa to express DRA are those that have already withdrawn from the cell cycle (10)
.
We designed several deletion mutants to map the functional regions of DRA.
V317 is a disease-causing mutation in CLD (19)
confirmed to be defective in both chloride and sulfate transport (16)
. Results from the colony-suppression assay show that
V317 is still capable of inhibiting colony formation. This suggests that the anion transport and growth-suppression functions of DRA are independent. However, it does not rule out indirect effects on neoplasia attributable to loss of anion transport function. Indeed, patients with CLD attributable to the
V317 mutation appear to be more likely to develop colorectal cancer than the general population (24)
. One possible mechanism for this may be attributable to lower levels of sulfation of heparan sulfate proteoglycans. Heparan sulfate proteoglycans modulate a number of receptor tyrosine kinase signaling pathways (including those pathways involving the ligands FGF, transforming growth factor ß, Wnt/Wingless, and Hedgehog), the aberrant regulation of which contributes to neoplasia (reviewed in Ref. 25
). A Drosophila mutant, sulfateless (sfl), which completely lacks sulfated disaccharides from heparan sulfate (26)
, is defective in its FGF signaling but can be rescued by a constitutively active form of an FGF receptor (27)
. This suggests that proper sulfation is obligatory for FGF signaling at the ligand/receptor level. In human colon cancer cell lines, altered patterns of sulfation and decreased overall sulfation levels of heparan sulfate occur in carcinoma versus adenoma (28)
. These changes result in a 10-fold decrease in the affinity of carcinoma-derived heparan sulfate for basic FGF and correlate with a reduced biological response to basic FGF in the carcinoma cells (29)
.
The mutant that removes the COOH terminus of DRA (
606764) failed to suppress growth in the colony-suppression assay. The current structural model of DRA indicates that this mutation removes at least one transmembrane domain from DRA as well as the entire cytoplasmic tail. This may indicate that the COOH terminus of DRA contains one or more functional region(s) required for growth suppression. A construct containing only the amino acids removed in this mutant (DRA606764) was tested in a colony-suppression assay. The COOH terminus alone did not suppress growth (see Fig. 3
). This indicates that, although the COOH terminus is necessary to facilitate growth control, it is not sufficient to do so. It suggests that interaction with other parts of the DRA protein may also be required for growth suppression, perhaps involving some of the transmembrane architecture. Indeed, the transmembrane architecture of pendrin, a protein most closely related to DRA, cannot substitute for DRA in a colony-suppression assay.6
While some of the experiments described here were in progress, an intriguing report appeared describing the stable expression of mouse Dra in HEK293 cells (17)
. We were able to repeat this result using our human DRA cDNA. Both DRA protein expression and DRA protein function could be demonstrated in stably transfected HEK293 cells (see Fig. 4
). Immunofluorescence of one of these clones (see Fig. 4
) revealed strong staining in the Golgi in addition to the membrane where DRA is normally expressed. The Golgi localization is consistent with earlier transient transfections performed in COS-1 cells (10)
and most likely represents the nascent polypeptide undergoing glycosylation. However, the demonstration of sulfate transport indicates that the DRA localized to the membrane was functionally active. We conclude that the observed reduction in DRA-induced growth suppression is not likely attributable to misexpression or a nonfunctional protein.
The demonstration of stable DRA expression in HEK293 cells causes us to consider possible explanations for the partial abrogation of growth suppression. HEK293 cells are human embryonic kidney cells that were transformed by introduction of adenovirus type 5 DNA. Specifically, this cell line expresses two transforming proteins, E1A and E1B. To determine whether the reduction of DRA-induced growth suppression was attributable to viral transformation, we transfected DRA into two other virally transformed cell lines, CaSki and HeLa. CaSki and HeLa cells are transformed by the HPV types 16 and 18, respectively. Both cell lines express two HPV-transforming proteins, E7 and E6. Although these proteins transform cells by a mechanism similar to E1A and E1B, respectively, we did not observe a reduction in DRA-induced growth suppression in CaSki and HeLa cells. It is unclear whether the failure to partially abrogate DRA-induced growth suppression in CaSki and HeLa cells is attributable to subtle differences in the mechanisms of the transforming proteins involved or may be attributable to cell line differences independent of the transforming proteins. However, we could demonstrate that the partial abrogation of DRA-induced colony suppression by E1A could be duplicated in DLD-1 cells, a cell line susceptible to growth control by DRA. This indicates that the 243-amino acid 12S E1A product is capable of mediating the abrogation.
There are numerous E1A-mediated effects resulting in cellular transformation (reviewed in Ref. 30 ). Because E1A is an early viral gene product, it is responsible for trans-activation of later viral genes, as well as controlling host cell growth upon infection. The latter is accomplished by targeted disruption of the host cells growth control machinery. This involves activation of positive growth regulators and inactivation of negative regulators. The most notable effect of E1A expression is the binding and effective inactivation of the retinoblastoma tumor suppressor protein, pRb. pRb negatively regulates cell growth by binding to the transcription factor E2F, which is responsible for transcription of genes involved in cell cycle progression (31) . E1A disrupts this interaction by direct binding to pRb, thus freeing E2F and leading to unchecked cell cycle progression. Although one might speculate that DRA controls growth through an Rb pathway, this begs the question of why abrogation was not observed in CaSki and HeLa cells, where E7 ostensibly blocks pRb function in a manner similar to E1A. Furthermore, if DRA failed to suppress growth in HEK293 cells because of E1As disruption of pRb function, it would follow that cell lines that do undergo DRA-induced growth suppression might maintain functional (hypophosphorylated) pRb. However, at least for some cell lines, this is not the case. For example, DLD-1 and SW480 cells have been reported to lack the hypophosphorylated form of pRb (32) . Presumably, with no hypophosphorylated pRb, E2F is constitutively unbound and free to transactivate positive cell cycle regulators. In addition, DLD-1, SW480, and HT-29 cell lines lack p16 expression and exhibit high levels of type D cyclins (32) . These conditions result in cyclin-dependent kinase 4-mediated phosphorylation of Rb, thus inactivating it. Therefore, a role for pRb is unclear at this time.
It has been reported that the other Rb family members, p130/Rb2 and p107, have an aberrant phosphorylation pattern in HEK293 cells. This is a direct result of E1A expression (33) . E1A disrupts the interaction between p130 or p107 and their respective E2F family members while preventing their hyperphosphorylation. The phosphorylation of pRb, however, is not blocked by E1A expression. For this reason, it is believed that p130/Rb2 and p107 may have roles in addition to those defined for pRb. There is some evidence that p130/Rb2 can act as a cyclin-dependent kinase inhibitor (34) . One could envision a scenario wherein DRA depends on p130/Rb2 function as a cyclin-dependent kinase inhibitor to effectively inhibit growth. If E1A expression in DLD-1 cells interferes with this function of p130/Rb2, then a reduction in DRA-induced growth suppression might be expected. However, this explanation for the observed reduction is confounded by an important observation; E1A blockage of p130/Rb2 hyperphosphorylation occurs in HeLa cells (33) , a cell line that we confirmed to be susceptible to DRA-induced growth suppression. Therefore, an E1A abrogation mechanism mediated through a pathway involving Rb family members is either a much more complicated matter or does not apply to DRA-induced growth suppression.
Other E1A-mediated events with widespread effects on the cell cycle exist. This leaves more avenues to be investigated to uncover the explanation for the observed reduction in DRA-induced growth suppression observed in HEK293 cells and in DLD-1 cells expressing E1A. Direct interaction between DRA and E1A is unlikely because DRA is a membrane protein and E1A functions in the nucleus. This would rule out E1A possibly binding to and masking functional regions of the COOH terminus of DRA. Alternatively, E1A might inhibit expression of a downstream effector of DRA through its trans-activation region. This could be assessed by mutation or deletion of this region in an E1A construct, followed by expression in DLD-1 cells and "challenge" by DRA transfection. If DRA-induced growth suppression was restored in the absence of E1A trans-activation, then proteins induced or inhibited by E1A expression would be candidates for members of the pathway by which DRA controls cell growth. Although the E1A-mediated abrogation of DRA-induced growth suppression cannot yet be definitively explained, it will hopefully provide clues to the mechanism of this protein with such diverse roles as anion transporter and growth suppressor.
| FOOTNOTES |
|---|
1 Supported by Grant RPG-96-098-03-CSM from the American Cancer Society and Department of Defense Contract N00014-96-1-1298 (to C. W. S.). ![]()
2 Present address: Department of Pharmacology, Medical University of South Carolina, 171 Ashley Avenue, Charleston, SC 29425. ![]()
3 Present address: Department of Rheumatology and Immunology, Medical University of South Carolina, 96 Jonathan Lucas Street, Charleston, SC 29425. ![]()
4 To whom requests for reprints should be addressed, at Laboratory of Cancer Genomics, Hollings Cancer Center, Medical University of South Carolina, 86 Jonathan Lucas Street, Charleston, SC 29403. E-mail: schweicw{at}musc.edu ![]()
5 The abbreviations used are: DRA, down-regulated in adenoma; CLD, congenital chloride diarrhea; DIDS, 4,4'-diisothiocyano-2,2'-disulfonic acid stilbene; HPV, human papillomavirus; FGF, fibroblast growth factor; pRb, retinoblastoma protein. ![]()
6 J. M. Chapman and C. W. Schweinfest, unpublished results. ![]()
Received 3/18/02. Accepted 6/27/02.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Hayashi, K. Suruga, and Y. Yamashita Regulation of intestinal Cl-/HCO3- exchanger SLC26A3 by intracellular pH Am J Physiol Cell Physiol, June 1, 2009; 296(6): C1279 - C1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Dorwart, N. Shcheynikov, J. M. R. Baker, J. D. Forman-Kay, S. Muallem, and P. J. Thomas Congenital Chloride-losing Diarrhea Causing Mutations in the STAS Domain Result in Misfolding and Mistrafficking of SLC26A3 J. Biol. Chem., March 28, 2008; 283(13): 8711 - 8722. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Schweinfest, D. D. Spyropoulos, K. W. Henderson, J.-H. Kim, J. M. Chapman, S. Barone, R. T. Worrell, Z. Wang, and M. Soleimani slc26a3 (dra)-deficient Mice Display Chloride-losing Diarrhea, Enhanced Colonic Proliferation, and Distinct Up-regulation of Ion Transporters in the Colon J. Biol. Chem., December 8, 2006; 281(49): 37962 - 37971. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |