| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Department of Radiation Therapy, Radiological University Clinic 79106 Freiburg, Germany [F. P., J. H., K. R., A. S.], and Department of Radiation Oncology, Experimental Division, University of California-Los Angeles School of Medicine, Los Angeles, California [W. H. M.]
| ABSTRACT |
|---|
|
|
|---|
B (NF-
B), which results in their enhanced survival. Activation of NF-
B classically depends on degradation of its inhibitor I
B
by the 26s proteasome. Specific proteasome inhibitors induce apoptosis in cancer cells and, at nonlethal concentrations, sensitize cells to the cytotoxic effects of ionizing radiation and chemotherapeutic drugs. Recently, the protease coded by the HIV-I virus has been shown to share cleavage activities with the proteasome. For this reason, we investigated whether the HIV-I protease inhibitor saquinavir can inhibit NF-
B activation, block 26s proteasome activity in prostate cancer cells, and promote their apoptosis. The effect of saquinavir on LPS/IFN-
-induced activation of NF-
B was assessed by gel-shift assays and by Western analysis of corresponding I
B
-levels. Its effect on 20s and 26s proteasome activity was analyzed with a fluorogenic peptide assay using whole cell lysates from LnCaP, DU-145, and PC-3 prostate cancer cells pretreated with saquinavir for 9 h. Proteasome inhibition in living cells was assessed using ECV 304 cells stably transfected with an expression plasmid for an ubiquitin/green fluorescence protein fusion protein (ECV 304/10). Apoptosis was monitored morphologically and by flow cytometry. Saquinavir treatment prevented LPS/IFN-
-induced activation of NF-
B in RAW cells and stabilized expression of I
B
. It inhibited 20s and 26s proteasome activity in lysates from LnCaP, DU-145, and PC-3 prostate cancer cells with an IC50 of 10 µM and caused the accumulation of an ubiquitin/green fluorescence protein fusion protein in living ECV 304/10 cells. Incubation of PC-3 and DU-145 prostate cancer, U373 glioblastoma, and K562 and Jurkat leukemia cells with saquinavir caused a concentration-dependent induction of apoptosis. In the case of PC-3 and DU-145, saquinavir sensitized the surviving cells to ionizing radiation. We conclude that saquinavir inhibits proteasome activity in mammalian cells as well as acting on the HIV-I protease. Because saquinavir induced apoptosis in human cancer cells, HIV-I protease inhibitors might become a new class of cytotoxic drugs, alone or in combination with radiation or chemotherapy. | INTRODUCTION |
|---|
|
|
|---|
The cleavage sites of action for HIV-I protease were once thought to be unique and distinct from those of mammalian proteases. However, recently, the 20s proteasome has been shown to cleave the same sites (1) . This led us to investigate whether saquinavir is an inhibitor of the 20s proteasome, as was previously reported for ritonavir (6) . Proteasome inhibition may contribute to some of the effects of PIs that seem to be independent of virus inhibition, such as its immune-modulatory properties in HIV patients and its antitumoral action on HIV-associated Kaposi-sarcoma (6) . We also examined whether saquinavir exhibits antitumoral effects in non-HIV-associated cancer of the prostate.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Irradiation.
PC-3 and DU-145 cells were trypsinated, counted, and diluted to a concentration of 106 cells/ml. The cell suspension was immediately irradiated at room temperature using a 137Cs-laboratory irradiator (IBL 637; CIS bio international) at a dose rate of 0.78 Gy/min). Corresponding controls were sham irradiated.
Clonogenic Survival.
Colony-forming assays were performed immediately after irradiation by plating an appropriate number of cells (2 x 103 to 2 x 104) into Petri dishes, in triplicate. After 14-days culture, cells were fixed, stained with crystal violet, and colonies consisting of more than 50 cells were counted. Resulting survival plots were fitted using a linear-quadratic model.
Transfection.
ECV 304 cells were maintained in DMEM (10% FCS, 1% penicillin/streptomycin). Twelve h before transfection, cells were trypsinized and plated at a density of 250,000 cells/well into six-well plates. Cells were transfected with 5 µg of a plasmid (pEGFP-N1; Clontech) coding for an Ub-R-GFP fusion protein under control of a cytomegalovirus promoter (7
; a kind gift from Dr. M. Masucci, Karolinska Institute, Sweden) using the Superfect transfection kit (Qiagen) and following the manufacturers instructions. Transfected cells were maintained in DMEM (10% FSC, 1% penicillin/streptomycin) supplemented with 500 µg/ml G418 (Sigma), and clones were obtained. Expression of Ub-R-GFP was analyzed by flow cytometry (FL1-Hl FACSCalibur, Becton Dickinson) using CellQuest Software before and after treatment with the proteasome inhibitor MG-132 (50 µM, Calbiochem) for 10 h at 37°C. Clone 10 (ECV 304/10), which showed low background and high expression of Ub-R-GFP after MG-132 treatment, was used for inhibition experiments.
Cell Extracts and Electrophoretic Mobility Shift Assays.
Cellular extracts were prepared from normal and saquinavir-treated cells by dislodging the cells mechanically, washing with ice-cold PBS, and lysing them in TOTEX buffer [20 mM HEPES (pH 7.9), 0.35 mM NaCl, 20% glycerol, 1% NP40, 0.5 mM EDTA, 0.1 mM EGTA, 0.5 mM DTT, 50 µM PMSF, and 90 trypsin inhibitor units/ml aprotinin] for 30 min on ice. The lysate was centrifuged at 12.000 x g for 5 min. Protein concentration in the supernatant was determined by the Micro BCA method (Pierce). Fifteen µg of protein were incubated for 25 min at room temperature with 2 µl of BSA (10 µg/µl), 2 µl of dIdC (1 µg/µl), 4 µl of Ficoll buffer (20% Ficoll 400, 100 mM HEPES, 300 mM KCl, 10 mM DTT, and 0.1 mM PMSF), 2 µl of buffer D+ (20 mM HEPES, 20% glycerol, 100 mM KCl, 0.5 mM EDTA, 0.25% NP40, 2 mM DTT, and 0.1 mM PMSF), and 1 µl of the [
-32P]ATP-labeled oligonucleotide (Promega; NF-
B, AGTTGAGGGGACTTTCCCAGG). A negative control was prepared for one sample by adding unlabeled oligonucleotide in 50-fold excess. Electrophoresis was carried out in native 4% polyacrylamide/0.5-fold Tris/boric acid/EDTA gels. Dried gels were placed on a phosphor screen for 24 h and analyzed on a phosphorimager (IPR 1500; Fuji).
Proteasome Function Assays.
Proteasome function was measured as described previously (8)
with some minor modifications. Briefly, cells were washed with PBS, then with buffer I [50 mM Tris (pH 7.4), 2 mM DTT, 5 mM MgCl2, and 2 mM ATP], and pelleted by centrifugation. Glass beads and homogenization buffer [50 mM Tris (pH 7.4), 1 mM DTT, 5 mM MgCl2, 2 mM ATP, and 250 mM sucrose] were added and cells were vortexed for 1 min. Beads and cell debris were removed by centrifugation at 1,000 x g for 5 min, and the supernatant was further clarified by spinning at 10,000 x g for 20 min. Protein concentration was determined by the Micro BCA protocol (Pierce) with BSA (Sigma) as standard. Twenty µg of protein from each sample was diluted with buffer I to a final volume of 200 µl. To assess 26s function, fluorogenic proteasome substrate SucLLVY-AMC (chymotrypsin-like; Sigma) was dissolved in DMSO and added in a final concentration of 80 µM (in 0.8% DMSO). To assess 20s function, buffer I was replaced by buffer containing SDS [20 mM HEPES (pH 7.8), 0.5 mM EDTA, and 0.03% SDS (9)
]. Proteolytic activity was monitored continuously using a fluorescence plate reader (Spectra Max Gemini XS; Molecular Devices; 37°C) at 380/460 nm by release of the fluorescent group AMC.
Immunoblotting.
Cells were lysed in radioimmunoprecipitation assay buffer [50 mM Tris-HCl (pH 7.2), 150 mM NaCl, 1% NP40, SDS, 10 mM PMSF, aprotinin, and sodium vanadate]. Protein concentrations were determined using the Micro BCA protocol (Pierce) with BSA (Sigma) as standard. Ten µg of protein were separated on SDS gel (0.1% SDS/12% polyacrylamide) and blotted to polyvinylidene difluoride membranes at 4°C. After blocking with Blotto-buffer (Tris-buffered saline, 0.1% Tween 20, and 5% skim milk) for 1 h at room temperature, the membranes were incubated with a polyclonal antibody against I
B
(0.5 µg/ml; BD PharMingen) for 1 h at room temperature. A secondary horseradish peroxidase-conjugated antibody and the ECLplus system (Amersham) were used for visualization.
Flow Cytometry.
For assessment of Ub-R-GFP expression, cells were trypsinized, pelleted (5 min, 500 x g) and washed twice in PBS. GFP content was analyzed by flow cytometry using the CellQuest Software (FL1-H, FACSCalibur; Becton Dickinson). The DNA profiles of adherent and nonadherent cells in drug-treated populations were analyzed by flow cytometry using CellQuest Software (FL2-A, FACSCalibur; Becton Dickinson). Cells were washed in PBS and fixed overnight in ice-cold 75% ethanol. The next day, cells were washed in PBS. The cell pellet was incubated with 50 µg/ml RNase A and 1 mg/ml propidium iodide for 10 min and washed in PBS before examination. TUNEL assay was performed using the FlowTACS in situ kit (R&D Systems GmbH, Wiesbaden, Germany) following the manufacturers instructions.
| RESULTS |
|---|
|
|
|---|
B.
B signaling is normally dependent on proteasomal degradation of the binding inhibitor I
B
and is prevented by treatment of cells with proteasome inhibitors (10)
. Murine RAW 264.7 macrophages respond strongly with NF-
B activation to treatment with LPS (0.1 µg/ml) and IFN-
(100 units/ml) for 6 h. This model was, therefore, used to determine whether simultaneous addition of different concentrations of saquinavir (0, 6.25, 12.5, 25, and 50 µM) affected the activation process. When total cellular lysates were analyzed at 6 h, we found a concentration-dependent inhibitory effect of saquinavir on constitutive and LPS/IFN-
-induced increase of NF-
B DNA-binding activity (Fig. 1A)
B
, which indicated involvement of the classical activation pathway of NF-
B by proteasome-dependent degradation of I
B (Fig. 1B)
|
B that can be blocked by treatment with proteasome inhibitors (11)
. The ability of saquinavir to inhibit proteasome function was examined by incubating cellular extracts of PC-3, DU-145, and LnCaP prostate cancer cells with different concentrations of the drug (100, 50, 25, 12.5, 6.25, 3.125, 1.6, and 0 µM). Chymotryptic, tryptic, and peptidyl-glytamyl 20s and 26s proteasome activities were continuously monitored for 30 min by the release of AMC from the fluorogenic proteasome substrates SucLLVY-AMC, Z-AAR-AMC, and Z-LLE-AMC. Saquinavir inhibited the function of both chymotryptic 26s (Fig. 2, A, B, and C)
|
|
|
= 0.35, ß = 0.045,
/ß = 7.8; saquinavir-treated cells:
= 0.334, ß = 0.069,
/ß = 4.8; DU-145 cells: control cells,
= 0.35, ß = 0.034,
/ß = 10.3; saquinavir-treated cells,
= 0.36, ß = 0.075,
/ß = 4.8).
|
| DISCUSSION |
|---|
|
|
|---|
Prostate cancer cells in general show elevated constitutive DNA-binding activity of the antiapoptotic transcription factor NF-
B (26
, 27)
, and we, and others, have demonstrated that the inhibition of NF-
B induces apoptosis in cancer cells (17
, 20 , 26
, 28)
. NF-
B is a hetero- or homodimer of the subunits p50, p52, p65/RelA, c-Rel, and Rel-B. It is sequestered preformed in the cytosol by inhibitor molecules of the I
B family. Activation of this pathway is normally achieved by phosphorylation, polyubiquitination, and subsequent degradation by the 26s proteasome of one of its most important inhibitors, I
B
. Degradation of I
B
frees NF-
B for translocation to the nucleus and activation of its target genetic programs (reviewed in Ref. 29
). We have shown that the HIV-I PI saquinavir blocks NF-
B activation in the murine RAW macrophage and human PC-3 prostate cancer cell lines and stabilizes I
B
in a concentration-dependent fashion. Because activation of NF-
B is an important precondition for replication and persistence of HIV (30)
, this suggests a pathway for action of saquinavir that is independent of direct viral protease inhibition.
Saquinavir, like ritonavir, was shown to directly inhibit 20s and 26s proteasome function in vitro. Because the inhibition of both 26s and 20s function showed similar drug concentration dependency, we conclude that it acts on the 20s core unit of the proteasome. Treatment of cells with saquinavir also inhibited proteasome function, although the IC50 was markedly higher, perhaps because saquinavir is a substrate for the multidrug resistance (mdr-1) gene product P-glycoprotein, which is highly expressed in PC-3 human prostate cancer cells (12) . Physiological inhibition of proteasome function by saquinavir was demonstrated by the finding of an accumulation of the Ub-R-GFP reporter of proteasome function (7) in living ECV 304 cells stably transfected with this construct.
A physiological consequence of the saquinavir treatment of PC-3 and DU-145 prostate cancer, U373 glioblastoma, and K562 and Jurkat leukemia cells was apoptosis, which occurred at concentrations that were similar to those needed to inhibit proteasome function. These data are consistent with the hypothesis that saquinavir-induced apoptosis is the result of the inhibition of proteasome function and the blocking of NF-
B activation. We have previously shown that the inhibition of NF-
B activation in these cell lines by transduction with an I
B super-repressor gene also results in apoptosis (11)
.
The Ub/26s proteasome has recently been identified as a novel target for cancer therapy (11
, 21
, 31
, 32)
. In this study, short-time preincubation with saquinavir clearly sensitized PC-3 and DU-145 prostate cancer cells to ionizing radiation, which resulted in a change of the
:ß ratio from 7.8 and 10.3, respectively, in control cells to 4.8 in saquinavir-treated cells. The clinical significance of these observations is supported by a recent report showing dramatically improved survival for AIDS patients suffering from HIV-related primary central nervous system lymphoma (PCNSL) treated with highly active antiretroviral therapy (HAART) and cranial irradiation when compared with cranial irradiation or HAART treatment alone (33)
. Results from two recent reports indicate that this effect is independent of the recovery of the immune system (34
, 35)
. Because the inhibition of proteasome function, in general, sensitizes tumor cells to ionizing radiation (11
, 23)
and HIV-I PIs have been shown to inhibit P-glycoprotein-mediated multidrug resistance (3)
, HIV-I PIs may become a new class of chemotherapeutic agents in radiochemotherapy. As in HIV therapy, the use of radiation therapy combined with saquinavir and "baby-concentrations" of ritonavir may overcome the problem of low bioavailability of the drug (36)
.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 F. P. was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG Pa 723/3-1) and by a research grant from Hoffmann La-Roche, Grenzach, Germany. ![]()
2 To whom requests for reprints should be addressed, at Department of Radiation Therapy, Radiological University Clinic, Hugstetter Strasse 55, 79106 Freiburg i. Brsg., Germany. Phone: 49-761-270-3862; Fax: 49-761-270-3982; E-mail: pajonk{at}uni-freiburg.de ![]()
3 The abbreviations used are: PI, protease inhibitor; NF-
B, nuclear factor
B; GFP, green fluorescence protein; PMSF, phenylmethylsulfonyl fluoride; AMC, 7-amido-4-methylcoumarin; Ub, ubiquitin; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling. ![]()
Received 8/28/01. Accepted 7/17/02.
| REFERENCES |
|---|
|
|
|---|
B through two distinct mechanisms. Proc. Natl. Acad. Sci. USA, 95: 13012-13017, 1998.
B. Int. J. Radiat. Oncol. Biol. Phys., 50: 183-193, 2001.[Medline]
B, clonogenicity, and radiosensitivity of human cancer cells. J. Natl. Cancer Inst. (Bethesda), 91: 1956-1960, 1999.
B kinase
and NF-
B in prostate cancer cells is inhibited by ibuprofen. Oncogene, 18: 7389-7394, 1999.[Medline]
B-RelA activation is required for proliferation and survival of Hodgkins disease tumor cells. J. Clin. Investig., 100: 2961-2969, 1997.[Medline]
B: ten years after. Cell, 87: 13-20, 1996.[Medline]
B is needed for persistent viral replication in monocytes. J. Virol., 70: 2930-2938, 1996.[Abstract]
This article has been cited by other articles:
![]() |
D. Maksimovic-Ivanic, S. Mijatovic, D. Miljkovic, L. Harhaji-Trajkovic, G. Timotijevic, M. Mojic, D. Dabideen, K. F. Cheng, J. A. McCubrey, K. Mangano, et al. The antitumor properties of a nontoxic, nitric oxide-modified version of saquinavir are independent of Akt Mol. Cancer Ther., May 1, 2009; 8(5): 1169 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. P. Flint, M. A. Noor, P. W. Hruz, P. B. Hylemon, K. Yarasheski, D. P. Kotler, R. A. Parker, and A. Bellamine The Role of Protease Inhibitors in the Pathogenesis of HIV-Associated Lipodystrophy: Cellular Mechanisms and Clinical Implications Toxicol Pathol, January 1, 2009; 37(1): 65 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kraus, E. Malenke, J. Gogel, H. Muller, T. Ruckrich, H. Overkleeft, H. Ovaa, E. Koscielniak, J. T. Hartmann, and C. Driessen Ritonavir induces endoplasmic reticulum stress and sensitizes sarcoma cells toward bortezomib-induced apoptosis Mol. Cancer Ther., July 1, 2008; 7(7): 1940 - 1948. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Oehler-Janne, F. Huguet, S. Provencher, B. Seifert, L. Negretti, M.-O. Riener, M. Bonet, A. S. Allal, and I. F. Ciernik HIV-Specific Differences in Outcome of Squamous Cell Carcinoma of the Anal Canal: A Multicentric Cohort Study of HIV-Positive Patients Receiving Highly Active Antiretroviral Therapy J. Clin. Oncol., May 20, 2008; 26(15): 2550 - 2557. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pyrko, A. Kardosh, W. Wang, W. Xiong, A. H. Schonthal, and T. C. Chen HIV-1 Protease Inhibitors Nelfinavir and Atazanavir Induce Malignant Glioma Death by Triggering Endoplasmic Reticulum Stress Cancer Res., November 15, 2007; 67(22): 10920 - 10928. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Gills, J. LoPiccolo, J. Tsurutani, R. H. Shoemaker, C. J.M. Best, M. S. Abu-Asab, J. Borojerdi, N. A. Warfel, E. R. Gardner, M. Danish, et al. Nelfinavir, A Lead HIV Protease Inhibitor, Is a Broad-Spectrum, Anticancer Agent that Induces Endoplasmic Reticulum Stress, Autophagy, and Apoptosis In vitro and In vivo Clin. Cancer Res., September 1, 2007; 13(17): 5183 - 5194. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Cuneo, T. Tu, L. Geng, A. Fu, D. E. Hallahan, and C. D. Willey HIV Protease Inhibitors Enhance the Efficacy of Irradiation Cancer Res., May 15, 2007; 67(10): 4886 - 4893. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. De Barros, A. Zakaroff-Girard, M. Lafontan, J. Galitzky, and V. Bourlier Inhibition of Human Preadipocyte Proteasomal Activity by HIV Protease Inhibitors or Specific Inhibitor Lactacystin Leads to a Defect in Adipogenesis, Which Involves Matrix Metalloproteinase-9 J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 291 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhou, E. C. Gurley, S. Jarujaron, H. Ding, Y. Fang, Z. Xu, W. M. Pandak Jr., and P. B. Hylemon HIV protease inhibitors activate the unfolded protein response and disrupt lipid metabolism in primary hepatocytes Am J Physiol Gastrointest Liver Physiol, December 1, 2006; 291(6): G1071 - G1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Gupta, G. J. Cerniglia, R. Mick, W. G. McKenna, and R. J. Muschel HIV Protease Inhibitors Block Akt Signaling and Radiosensitize Tumor Cells Both In vitro and In vivo Cancer Res., September 15, 2005; 65(18): 8256 - 8265. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Parker, O. P. Flint, R. Mulvey, C. Elosua, F. Wang, W. Fenderson, S. Wang, W.-P. Yang, and M. A. Noor Endoplasmic Reticulum Stress Links Dyslipidemia to Inhibition of Proteasome Activity and Glucose Transport by HIV Protease Inhibitors Mol. Pharmacol., June 1, 2005; 67(6): 1909 - 1919. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bourlier, A. Zakaroff-Girard, S. De Barros, C. Pizzacalla, V. D. de Saint Front, M. Lafontan, A. Bouloumie, and J. Galitzky Protease Inhibitor Treatments Reveal Specific Involvement of Matrix Metalloproteinase-9 in Human Adipocyte Differentiation J. Pharmacol. Exp. Ther., March 1, 2005; 312(3): 1272 - 1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. McCarty Targeting Multiple Signaling Pathways as a Strategy for Managing Prostate Cancer: Multifocal Signal Modulation Therapy Integr Cancer Ther, December 1, 2004; 3(4): 349 - 380. [Abstract] [PDF] |
||||
![]() |
T. Ikezoe, Y. Hisatake, T. Takeuchi, Y. Ohtsuki, Y. Yang, J. W. Said, H. Taguchi, and H. P. Koeffler HIV-1 Protease Inhibitor, Ritonavir: A Potent Inhibitor of CYP3A4, Enhanced the Anticancer Effects of Docetaxel in Androgen-Independent Prostate Cancer Cells In vitro and In vivo Cancer Res., October 15, 2004; 64(20): 7426 - 7431. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Equils, A. Shapiro, Z. Madak, C. Liu, and D. Lu Human Immunodeficiency Virus Type 1 Protease Inhibitors Block Toll-Like Receptor 2 (TLR2)- and TLR4-Induced NF-{kappa}B Activation Antimicrob. Agents Chemother., October 1, 2004; 48(10): 3905 - 3911. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ikezoe, T. Saito, K. Bandobashi, Y. Yang, H. P. Koeffler, and H. Taguchi HIV-1 protease inhibitor induces growth arrest and apoptosis of human multiple myeloma cells via inactivation of signal transducer and activator of transcription 3 and extracellular signal-regulated kinase 1/2 Mol. Cancer Ther., April 1, 2004; 3(4): 473 - 479. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Laurent, S. de Bouard, J.-S. Guillamo, C. Christov, R. Zini, H. Jouault, P. Andre, V. Lotteau, and M. Peschanski Effects of the proteasome inhibitor ritonavir on glioma growth in vitro and in vivo Mol. Cancer Ther., February 1, 2004; 3(2): 129 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Fakruddin and J. Laurence HIV Envelope gp120-mediated Regulation of Osteoclastogenesis via Receptor Activator of Nuclear Factor {kappa}B Ligand (RANKL) Secretion and Its Modulation by Certain HIV Protease Inhibitors through Interferon-{gamma}/RANKL Cross-talk J. Biol. Chem., November 28, 2003; 278(48): 48251 - 48258. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |