Cancer Research AACR Membership  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pajonk, F.
Right arrow Articles by McBride, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pajonk, F.
Right arrow Articles by McBride, W. H.
[Cancer Research 62, 5230-5235, September 15, 2002]
© 2002 American Association for Cancer Research


Experimental Therapeutics

The Human Immunodeficiency Virus (HIV)-1 Protease Inhibitor Saquinavir Inhibits Proteasome Function and Causes Apoptosis and Radiosensitization in Non-HIV-associated Human Cancer Cells1

Frank Pajonk2, Judith Himmelsbach, Katrin Riess, Alfred Sommer and William H. McBride

Department of Radiation Therapy, Radiological University Clinic 79106 Freiburg, Germany [F. P., J. H., K. R., A. S.], and Department of Radiation Oncology, Experimental Division, University of California-Los Angeles School of Medicine, Los Angeles, California [W. H. M.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cancer cells frequently show high constitutive activity of the antiapoptotic transcription factor nuclear factor {kappa}B (NF-{kappa}B), which results in their enhanced survival. Activation of NF-{kappa}B classically depends on degradation of its inhibitor I{kappa}B{alpha} by the 26s proteasome. Specific proteasome inhibitors induce apoptosis in cancer cells and, at nonlethal concentrations, sensitize cells to the cytotoxic effects of ionizing radiation and chemotherapeutic drugs. Recently, the protease coded by the HIV-I virus has been shown to share cleavage activities with the proteasome. For this reason, we investigated whether the HIV-I protease inhibitor saquinavir can inhibit NF-{kappa}B activation, block 26s proteasome activity in prostate cancer cells, and promote their apoptosis. The effect of saquinavir on LPS/IFN-{gamma}-induced activation of NF-{kappa}B was assessed by gel-shift assays and by Western analysis of corresponding I{kappa}B{alpha}-levels. Its effect on 20s and 26s proteasome activity was analyzed with a fluorogenic peptide assay using whole cell lysates from LnCaP, DU-145, and PC-3 prostate cancer cells pretreated with saquinavir for 9 h. Proteasome inhibition in living cells was assessed using ECV 304 cells stably transfected with an expression plasmid for an ubiquitin/green fluorescence protein fusion protein (ECV 304/10). Apoptosis was monitored morphologically and by flow cytometry. Saquinavir treatment prevented LPS/IFN-{gamma}-induced activation of NF-{kappa}B in RAW cells and stabilized expression of I{kappa}B{alpha}. It inhibited 20s and 26s proteasome activity in lysates from LnCaP, DU-145, and PC-3 prostate cancer cells with an IC50 of 10 µM and caused the accumulation of an ubiquitin/green fluorescence protein fusion protein in living ECV 304/10 cells. Incubation of PC-3 and DU-145 prostate cancer, U373 glioblastoma, and K562 and Jurkat leukemia cells with saquinavir caused a concentration-dependent induction of apoptosis. In the case of PC-3 and DU-145, saquinavir sensitized the surviving cells to ionizing radiation. We conclude that saquinavir inhibits proteasome activity in mammalian cells as well as acting on the HIV-I protease. Because saquinavir induced apoptosis in human cancer cells, HIV-I protease inhibitors might become a new class of cytotoxic drugs, alone or in combination with radiation or chemotherapy.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HIV-I encodes for a protease required for the cleavage of the viral gag-pol polyprotein, and its inhibition leads to the release of noninfectious virus particles (1) . The development of specific HIV-I PIs3 has revolutionized HIV therapy. At present, five different HIV-I PIs (ritonavir, saquinavir, nelfinavir, indinavir, and amprenavir) are clinically used (2) . Bioavailability of at least ritonavir, saquinavir, and indinavir is limited by the fact that they are substrates, and in part inhibitors (3) , of the same multidrug resistance gene product (mdr-1), P-glycoprotein (4 , 5) , that is a common cause for failure of chemotherapy in cancer patients.

The cleavage sites of action for HIV-I protease were once thought to be unique and distinct from those of mammalian proteases. However, recently, the 20s proteasome has been shown to cleave the same sites (1) . This led us to investigate whether saquinavir is an inhibitor of the 20s proteasome, as was previously reported for ritonavir (6) . Proteasome inhibition may contribute to some of the effects of PIs that seem to be independent of virus inhibition, such as its immune-modulatory properties in HIV patients and its antitumoral action on HIV-associated Kaposi-sarcoma (6) . We also examined whether saquinavir exhibits antitumoral effects in non-HIV-associated cancer of the prostate.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
Cultures of PC-3, LnCaP, and DU-145 human prostate carcinoma and U373 glioblastoma cells and K562 erythroleukemia and Jurkat T-cell leukemia cells (American Type Culture Collection, Rockville, MD), RAW 264.7 murine macrophages (a gift of Dr. G. Hildebrandt, Department of Radiation Oncology, University Clinic Leipzig, Leipzig, Germany), and ECV 304 human bladder carcinoma cells (DSMZ, Braunschweig) were grown in 75-cm2 flasks (Greiner) at 37°C in a humidified atmosphere of 5% CO2/95% air. DMEM (Cell Concepts, Freiburg, Germany) and RPMI 1640 (Cell Concepts) were supplemented with 10% FCS and 1% penicillin/streptomycin (Life Technologies, Inc.) before use. Saquinavir (a generous gift of Dr. Christiane Moecklinghoff, Hoffmann La-Roche, Grenzach, Germany) was solubilized in ethanol/H2O at a concentration 10 mM and used at concentrations of 0, 20, 50, 60, 80, and 100 µM. Controls received solvent only.

Irradiation.
PC-3 and DU-145 cells were trypsinated, counted, and diluted to a concentration of 106 cells/ml. The cell suspension was immediately irradiated at room temperature using a 137Cs-laboratory irradiator (IBL 637; CIS bio international) at a dose rate of 0.78 Gy/min). Corresponding controls were sham irradiated.

Clonogenic Survival.
Colony-forming assays were performed immediately after irradiation by plating an appropriate number of cells (2 x 103 to 2 x 104) into Petri dishes, in triplicate. After 14-days culture, cells were fixed, stained with crystal violet, and colonies consisting of more than 50 cells were counted. Resulting survival plots were fitted using a linear-quadratic model.

Transfection.
ECV 304 cells were maintained in DMEM (10% FCS, 1% penicillin/streptomycin). Twelve h before transfection, cells were trypsinized and plated at a density of 250,000 cells/well into six-well plates. Cells were transfected with 5 µg of a plasmid (pEGFP-N1; Clontech) coding for an Ub-R-GFP fusion protein under control of a cytomegalovirus promoter (7 ; a kind gift from Dr. M. Masucci, Karolinska Institute, Sweden) using the Superfect transfection kit (Qiagen) and following the manufacturer’s instructions. Transfected cells were maintained in DMEM (10% FSC, 1% penicillin/streptomycin) supplemented with 500 µg/ml G418 (Sigma), and clones were obtained. Expression of Ub-R-GFP was analyzed by flow cytometry (FL1-Hl FACSCalibur, Becton Dickinson) using CellQuest Software before and after treatment with the proteasome inhibitor MG-132 (50 µM, Calbiochem) for 10 h at 37°C. Clone 10 (ECV 304/10), which showed low background and high expression of Ub-R-GFP after MG-132 treatment, was used for inhibition experiments.

Cell Extracts and Electrophoretic Mobility Shift Assays.
Cellular extracts were prepared from normal and saquinavir-treated cells by dislodging the cells mechanically, washing with ice-cold PBS, and lysing them in TOTEX buffer [20 mM HEPES (pH 7.9), 0.35 mM NaCl, 20% glycerol, 1% NP40, 0.5 mM EDTA, 0.1 mM EGTA, 0.5 mM DTT, 50 µM PMSF, and 90 trypsin inhibitor units/ml aprotinin] for 30 min on ice. The lysate was centrifuged at 12.000 x g for 5 min. Protein concentration in the supernatant was determined by the Micro BCA method (Pierce). Fifteen µg of protein were incubated for 25 min at room temperature with 2 µl of BSA (10 µg/µl), 2 µl of dIdC (1 µg/µl), 4 µl of Ficoll buffer (20% Ficoll 400, 100 mM HEPES, 300 mM KCl, 10 mM DTT, and 0.1 mM PMSF), 2 µl of buffer D+ (20 mM HEPES, 20% glycerol, 100 mM KCl, 0.5 mM EDTA, 0.25% NP40, 2 mM DTT, and 0.1 mM PMSF), and 1 µl of the [{gamma}-32P]ATP-labeled oligonucleotide (Promega; NF-{kappa}B, AGTTGAGGGGACTTTCCCAGG). A negative control was prepared for one sample by adding unlabeled oligonucleotide in 50-fold excess. Electrophoresis was carried out in native 4% polyacrylamide/0.5-fold Tris/boric acid/EDTA gels. Dried gels were placed on a phosphor screen for 24 h and analyzed on a phosphorimager (IPR 1500; Fuji).

Proteasome Function Assays.
Proteasome function was measured as described previously (8) with some minor modifications. Briefly, cells were washed with PBS, then with buffer I [50 mM Tris (pH 7.4), 2 mM DTT, 5 mM MgCl2, and 2 mM ATP], and pelleted by centrifugation. Glass beads and homogenization buffer [50 mM Tris (pH 7.4), 1 mM DTT, 5 mM MgCl2, 2 mM ATP, and 250 mM sucrose] were added and cells were vortexed for 1 min. Beads and cell debris were removed by centrifugation at 1,000 x g for 5 min, and the supernatant was further clarified by spinning at 10,000 x g for 20 min. Protein concentration was determined by the Micro BCA protocol (Pierce) with BSA (Sigma) as standard. Twenty µg of protein from each sample was diluted with buffer I to a final volume of 200 µl. To assess 26s function, fluorogenic proteasome substrate SucLLVY-AMC (chymotrypsin-like; Sigma) was dissolved in DMSO and added in a final concentration of 80 µM (in 0.8% DMSO). To assess 20s function, buffer I was replaced by buffer containing SDS [20 mM HEPES (pH 7.8), 0.5 mM EDTA, and 0.03% SDS (9) ]. Proteolytic activity was monitored continuously using a fluorescence plate reader (Spectra Max Gemini XS; Molecular Devices; 37°C) at 380/460 nm by release of the fluorescent group AMC.

Immunoblotting.
Cells were lysed in radioimmunoprecipitation assay buffer [50 mM Tris-HCl (pH 7.2), 150 mM NaCl, 1% NP40, SDS, 10 mM PMSF, aprotinin, and sodium vanadate]. Protein concentrations were determined using the Micro BCA protocol (Pierce) with BSA (Sigma) as standard. Ten µg of protein were separated on SDS gel (0.1% SDS/12% polyacrylamide) and blotted to polyvinylidene difluoride membranes at 4°C. After blocking with Blotto-buffer (Tris-buffered saline, 0.1% Tween 20, and 5% skim milk) for 1 h at room temperature, the membranes were incubated with a polyclonal antibody against I{kappa}B{alpha} (0.5 µg/ml; BD PharMingen) for 1 h at room temperature. A secondary horseradish peroxidase-conjugated antibody and the ECLplus system (Amersham) were used for visualization.

Flow Cytometry.
For assessment of Ub-R-GFP expression, cells were trypsinized, pelleted (5 min, 500 x g) and washed twice in PBS. GFP content was analyzed by flow cytometry using the CellQuest Software (FL1-H, FACSCalibur; Becton Dickinson). The DNA profiles of adherent and nonadherent cells in drug-treated populations were analyzed by flow cytometry using CellQuest Software (FL2-A, FACSCalibur; Becton Dickinson). Cells were washed in PBS and fixed overnight in ice-cold 75% ethanol. The next day, cells were washed in PBS. The cell pellet was incubated with 50 µg/ml RNase A and 1 mg/ml propidium iodide for 10 min and washed in PBS before examination. TUNEL assay was performed using the FlowTACS in situ kit (R&D Systems GmbH, Wiesbaden, Germany) following the manufacturer’s instructions.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Saquinavir Prevents Activation of Transcription Factor NF-{kappa}B.
NF-{kappa}B signaling is normally dependent on proteasomal degradation of the binding inhibitor I{kappa}B{alpha} and is prevented by treatment of cells with proteasome inhibitors (10) . Murine RAW 264.7 macrophages respond strongly with NF-{kappa}B activation to treatment with LPS (0.1 µg/ml) and IFN-{gamma} (100 units/ml) for 6 h. This model was, therefore, used to determine whether simultaneous addition of different concentrations of saquinavir (0, 6.25, 12.5, 25, and 50 µM) affected the activation process. When total cellular lysates were analyzed at 6 h, we found a concentration-dependent inhibitory effect of saquinavir on constitutive and LPS/IFN-{gamma}-induced increase of NF-{kappa}B DNA-binding activity (Fig. 1A)Citation . This inhibition coincided with an accumulation of I{kappa}B{alpha}, which indicated involvement of the classical activation pathway of NF-{kappa}B by proteasome-dependent degradation of I{kappa}B (Fig. 1B)Citation . Similar results were observed for human PC-3 prostate cancer cells using 25-µM concentrations of saquinavir (data not shown).



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Saquinavir inhibits activation of NF-{kappa}B. In A, RAW 264.7 macrophages were stimulated with LPS (0.1 µg/ml) and IFN-{gamma} (100 units/ml) for 6 h in the presence or absence of different concentrations of saquinavir, and cell extracts were analyzed for NF-{kappa}B expression by electrophoretic mobility shift assay. Lane 1, negative control with unlabeled oligonucleotide added in 50-fold molar excess; Lane 2, control nonstimulated cells; Lane 3, cells stimulated with LPS/IFN-{gamma} in the absence of saquinavir; Lanes 4–7, cells stimulated with LPS/IFN-{gamma} in the presence of saquinavir (Lane 4, 50 µM; Lane 5, 25 µM; Lane 6, 12.5 µM; Lane 7, 6.25 µM). B, Western blot analysis for I{kappa}B{alpha} in cell extracts from RAW 264.7 macrophages stimulated with LPS (0.1 µg/ml) and IFN-{gamma} (100 units/ml) for 6 h in the presence or absence of different concentrations of saquinavir (Lane 1, untreated controls; Lane 2, LPS/IFN-{gamma}, 0 µM saquinavir; Lane 3, LPS/IFN-{gamma}, 100 µM saquinavir; Lane 4, LPS/IFN-{gamma}, 50 µM saquinavir; Lane 5, LPS/IFN-{gamma}, 25 µM saquinavir).

 
Saquinavir Is an Inhibitor of the 26s Proteasome.
We have previously shown that prostate cancer cells express high constitutive levels of NF-{kappa}B that can be blocked by treatment with proteasome inhibitors (11) . The ability of saquinavir to inhibit proteasome function was examined by incubating cellular extracts of PC-3, DU-145, and LnCaP prostate cancer cells with different concentrations of the drug (100, 50, 25, 12.5, 6.25, 3.125, 1.6, and 0 µM). Chymotryptic, tryptic, and peptidyl-glytamyl 20s and 26s proteasome activities were continuously monitored for 30 min by the release of AMC from the fluorogenic proteasome substrates SucLLVY-AMC, Z-AAR-AMC, and Z-LLE-AMC. Saquinavir inhibited the function of both chymotryptic 26s (Fig. 2, A, B, and C)Citation and 20s (Fig. 2D)Citation and peptidyl-glutamyl (data not shown) proteasome activity in a concentration-dependent fashion. The IC50 for the chymotryptic 26s proteasome activity was 10 µM, 1.8 µM for the chymotryptic 20s proteasome activity, 5.2 µM for the peptidyl-glutamyl 26s proteasome activity, and 1.6 µM for the peptidyl-glutamyl 20s proteasome activity. We could not show any effect on tryptic 20s or 26s proteasome activity. In contrast, when PC-3 and LnCaP cells were treated with saquinavir supplemented media for 45 min and the extracts were then tested for proteasome activity, the IC50 was about 80 µM (Fig. 2, E and F)Citation . The difference in the ability of saquinavir to inhibit proteasome activity in whole cells and in extracts is probably attributable to its bioavailability, which may be adversely affected by saquinavir being a substrate of the mdr-1 gene product P-glycoprotein, which is expressed at high levels in prostate cancer cells (12) .



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Saquinavir is a 20s proteasome inhibitor. Chymotryptic 26s and 20s proteasome activity in lysates from PC-3, DU-145, and LnCaP human prostate cancer cells. Cleavage activity was monitored for 30 min and expressed as relative fluorescence units (rfu’s) expressed as x-fold activity of untreated controls. Cellular extracts from PC-3 (A), DU-145 (B), and LnCaP (C) cells were incubated with different concentrations of saquinavir. Chymotryptic 26s proteasome activity was assessed using a fluorogenic peptide assay with the specific proteasome substrate SucLLVY-AMC. Release of the fluorogenic compound AMC was monitored continuously in a fluorescence plate reader (excitation, 380 nm; emission, 460 nm). The specificity of the cleavage reaction was demonstrated by the addition of the proteasome inhibitor MG-132 (C, 50 µM). Saquinavir inhibited chymotryptic 26s proteasome activity in all three of the cell lines in a concentration-dependent manner. Saquinavir also inhibited chymotryptic 20s proteasome activity in LNCaP cells (D), indicating an effect on the 20s core unit rather than on the 19s regulatory unit. The inhibitory effect was also observed when cells, rather than extracts, were incubated in growth media supplemented with different concentrations of saquinavir for 45 min (E and F), which indicated that saquinavir enters the cells, although the concentration needed of the drug was higher.

 
To confirm that saquinavir can inhibit proteasome activity in cells, ECV 304 cells, transfected with Ub-R-GFP fusion protein (clone 10), were treated for 12 h with media supplemented with different concentrations of saquinavir and incubated for an additional 9 h. Subsequent flow cytometric analysis revealed a concentration-dependent increase in GFP-positive cells from, initially, 0.38% (0 µM) to 20.9% (80 µM; Fig. 3Citation ).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Saquinavir causes accumulation of the Ub-R-GFP reporter of proteasomal function. Flow cytometric analysis of ECV 304 cells stably transfected with Ub-R-GFP reporter of proteasomal function. Incubation with saquinavir (80 µM) for 9 h caused an accumulation of Ub-R-GFP in cells. Positive cells were detected in the upper right quadrant. Positive, the number of positive cells; Mean FL, their average fluorescence.

 
Saquinavir Induces Apoptosis in Non-HIV-associated Human Cancer Cells.
One of the many consequences of proteasome inhibition is induction of apoptosis (13) . The ability of saquinavir treatment to achieve this end point was, therefore, tested. In PC-3, cells, 100 µM induced apoptosis starting within 60 min (Fig. 4A)Citation . Comparable results were obtained in DU-145 (data not shown), U373 (data not shown), and K562 and Jurkat cells (Fig. 4B)Citation . By 24 h, all of the cell lines showed typical morphological criteria of apoptosis. Most PC-3 cells tolerated up to 50 µM for over 24 h, but 60 µM induced considerable apoptosis by this time point. By 48 h, PC-3 cells showed an increase of the apoptotic (sub-G1) fraction from 10.4% (0 µM) to 48.2% (50 µM), 55.7% (60 µM) and 78.2% (80 µM; Fig. 4CCitation ). The induction of apoptosis was confirmed by TUNEL-staining (Fig. 4D)Citation .



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Saquinavir induces apoptosis in human prostate cancer cells. In A, incubation of PC-3 cells with 100 µM saquinavir caused a rapid induction of apoptosis within hours. Cells showed membrane blebbing and chromatin condensation as early as 3 h after the start of incubation. B, propidium iodide staining. Treatment of K562 and Jurkat leukemia cells with saquinavir caused membrane blebbing and chromatin condensation 24 h after the start of treatment. C, DNA content of PC-3 prostate cancer cells incubated for 48 h with different concentrations of saquinavir as determined by propidium iodide staining of ethanol-fixed cells. Incubation with saquinavir caused concentration-dependent induction of apoptosis. The percentages of apoptotic cells in the pro-G1 peaks are indicated. In D, TUNEL staining of PC-3 cells 24 h after the start of incubation with 0 µM (filled histogram) or 100 µM Saquinavir (open histogram) detected TUNEL-positive cells with a shift in mean fluorescence from 13.5 to 25.

 
Saquinavir Sensitizes PC-3 and DU-145 Prostate Cancer Cells to Ionizing Radiation.
Transient inhibition of proteasome function has been shown to sensitize tumor cells to ionizing radiation (14) . To test a possible effect of saquinavir on the clonogenic survival of PC-3 cells after radiation therapy, clonogenic assays were performed. Two-h pretreatment of PC-3 or 3-h pretreatment of DU-145 cells with 50 µM and 60 µM concentrations of saquinavir did not significantly alter the plating efficiency of PC-3 cells (control cells, 52.1 ± 4.2%; saquinavir-treated cells, 47.3 ± 1.7%) and DU-145 cells (control cells, 23.1 ± 2.5%; saquinavir-treated cells, 26.0 ± 2.6%). However, pretreatment with saquinavir sensitized the surviving cells to ionizing radiation (Fig. 5Citation ; PC-3: control cells, {alpha} = 0.35, ß = 0.045, {alpha}/ß = 7.8; saquinavir-treated cells: {alpha} = 0.334, ß = 0.069, {alpha}/ß = 4.8; DU-145 cells: control cells, {alpha} = 0.35, ß = 0.034, {alpha} = 10.3; saquinavir-treated cells, {alpha} = 0.36, ß = 0.075, {alpha}/ß = 4.8).



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Saquinavir sensitizes human prostate cancer cells to ionizing radiation. (A) PC-3 prostate cancer cells were incubated with 50 µM concentrations and (B) DU145 prostate cancer cells were incubated with 60 µM concentrations of saquinavir for one h. Cells were washed twice with PBS, trypsinized and irradiated with 0, 2, 4, 6 or 8 Gy. Cells were plated into Petri dishes in triplicate. After 14 days cells were fixed with 75% ethanol, stained with crystal violet and colonies that consisted of more than 50 cells were counted. The number of colonies of each dose point was normalized to the number of colonies of the corresponding unirradiated control. Resulting survival curves were fitted using a linear quadratic model. Pretreatment with saquinavir sensitized the surviving cells to ionizing radiation (PC-3: control cells: {alpha} = 0.35, ß = 0.045, {alpha}/ß = 7.8; saquinavir-treated cells: {alpha} = 0.334, ß = 0.069, {alpha}/ß = 4.8; DU145: control cells: {alpha} = 0.35, ß = 0.034, {alpha}/ß = 10.3; saquinavir-treated cells: {alpha} = 0.36, ß = 0.075, {alpha}/ß = 4.8).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Ub/26s proteasome pathway is the major non-lysosomal proteolytic pathway in mammalian cells. It is responsible for the degradation of short-lived (15) , and 70–90% of all long-lived proteins (15 , 16) . Inhibition of proteasome function has been shown to induce apoptosis in cancer cells (11 , 17, 18, 19, 20, 21, 22) , and partial inhibition sensitizes surviving cells to the cytotoxic effects of ionizing radiation and chemotherapeutic drugs (11 , 23) . Proteolysis by the Ub/26s proteasome pathway is an important component of regulation of cellular functions like signal transduction, cell cycle control, and immune responses (24) . Interestingly, the 20s core unit of the proteasome is the only mammalian protease known, thus far, to share specific cleavage action sites with the HIV-I protease, which may be a pathogenic mechanism adopted by the virus. A recent report indicated that the HIV-I PI ritonavir inhibits 20s proteasome function (25) . Here, we investigated the effect of the HIV-I PI saquinavir, which is clinically less toxic (1) , on 20s and 26s proteasome function and the possible physiological consequences of such an inhibition in human cancer cells.

Prostate cancer cells in general show elevated constitutive DNA-binding activity of the antiapoptotic transcription factor NF-{kappa}B (26 , 27) , and we, and others, have demonstrated that the inhibition of NF-{kappa}B induces apoptosis in cancer cells (17 , 20 , 26 , 28) . NF-{kappa}B is a hetero- or homodimer of the subunits p50, p52, p65/RelA, c-Rel, and Rel-B. It is sequestered preformed in the cytosol by inhibitor molecules of the I{kappa}B family. Activation of this pathway is normally achieved by phosphorylation, polyubiquitination, and subsequent degradation by the 26s proteasome of one of its most important inhibitors, I{kappa}B{alpha}. Degradation of I{kappa}B{alpha} frees NF-{kappa}B for translocation to the nucleus and activation of its target genetic programs (reviewed in Ref. 29 ). We have shown that the HIV-I PI saquinavir blocks NF-{kappa}B activation in the murine RAW macrophage and human PC-3 prostate cancer cell lines and stabilizes I{kappa}B{alpha} in a concentration-dependent fashion. Because activation of NF-{kappa}B is an important precondition for replication and persistence of HIV (30) , this suggests a pathway for action of saquinavir that is independent of direct viral protease inhibition.

Saquinavir, like ritonavir, was shown to directly inhibit 20s and 26s proteasome function in vitro. Because the inhibition of both 26s and 20s function showed similar drug concentration dependency, we conclude that it acts on the 20s core unit of the proteasome. Treatment of cells with saquinavir also inhibited proteasome function, although the IC50 was markedly higher, perhaps because saquinavir is a substrate for the multidrug resistance (mdr-1) gene product P-glycoprotein, which is highly expressed in PC-3 human prostate cancer cells (12) . Physiological inhibition of proteasome function by saquinavir was demonstrated by the finding of an accumulation of the Ub-R-GFP reporter of proteasome function (7) in living ECV 304 cells stably transfected with this construct.

A physiological consequence of the saquinavir treatment of PC-3 and DU-145 prostate cancer, U373 glioblastoma, and K562 and Jurkat leukemia cells was apoptosis, which occurred at concentrations that were similar to those needed to inhibit proteasome function. These data are consistent with the hypothesis that saquinavir-induced apoptosis is the result of the inhibition of proteasome function and the blocking of NF-{kappa}B activation. We have previously shown that the inhibition of NF-{kappa}B activation in these cell lines by transduction with an I{kappa}B super-repressor gene also results in apoptosis (11) .

The Ub/26s proteasome has recently been identified as a novel target for cancer therapy (11 , 21 , 31 , 32) . In this study, short-time preincubation with saquinavir clearly sensitized PC-3 and DU-145 prostate cancer cells to ionizing radiation, which resulted in a change of the {alpha}:ß ratio from 7.8 and 10.3, respectively, in control cells to 4.8 in saquinavir-treated cells. The clinical significance of these observations is supported by a recent report showing dramatically improved survival for AIDS patients suffering from HIV-related primary central nervous system lymphoma (PCNSL) treated with highly active antiretroviral therapy (HAART) and cranial irradiation when compared with cranial irradiation or HAART treatment alone (33) . Results from two recent reports indicate that this effect is independent of the recovery of the immune system (34 , 35) . Because the inhibition of proteasome function, in general, sensitizes tumor cells to ionizing radiation (11 , 23) and HIV-I PIs have been shown to inhibit P-glycoprotein-mediated multidrug resistance (3) , HIV-I PIs may become a new class of chemotherapeutic agents in radiochemotherapy. As in HIV therapy, the use of radiation therapy combined with saquinavir and "baby-concentrations" of ritonavir may overcome the problem of low bioavailability of the drug (36) .


    ACKNOWLEDGMENTS
 
We are grateful to Dr. M. Masucci, Karolinska Institute, Sweden, for providing the Ub-R-GFP plasmid, and Dr. Christiane Moecklinghoff, Hoffmann La-Roche (Grenzach, Germany), for providing saquinavir.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 F. P. was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG Pa 723/3-1) and by a research grant from Hoffmann La-Roche, Grenzach, Germany. Back

2 To whom requests for reprints should be addressed, at Department of Radiation Therapy, Radiological University Clinic, Hugstetter Strasse 55, 79106 Freiburg i. Brsg., Germany. Phone: 49-761-270-3862; Fax: 49-761-270-3982; E-mail: pajonk{at}uni-freiburg.de Back

3 The abbreviations used are: PI, protease inhibitor; NF-{kappa}B, nuclear factor {kappa}B; GFP, green fluorescence protein; PMSF, phenylmethylsulfonyl fluoride; AMC, 7-amido-4-methylcoumarin; Ub, ubiquitin; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling. Back

Received 8/28/01. Accepted 7/17/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Flexner C. HIV-protease inhibitors. N. Engl. J. Med., 338: 1281-1292, 1998.[Free Full Text]
  2. Eron J. J., Jr. HIV-1 protease inhibitors. Clin. Infect. Dis., 30 (Suppl 2): S160-S170, 2000.
  3. Drewe J., Gutmann H., Fricker G., Torok M., Beglinger C., Huwyler J. HIV protease inhibitor ritonavir: a more potent inhibitor of P-glycoprotein than the cyclosporine analog SDZ PSC 833. Biochem. Pharmacol., 57: 1147-1152, 1999.[Medline]
  4. Lee C. G., Gottesman M. M., Cardarelli C. O., Ramachandra M., Jeang K. T., Ambudkar S. V., Pastan I., Dey S. HIV-1 protease inhibitors are substrates for the MDR1 multidrug transporter. Biochemistry, 37: 3594-3601, 1998.[Medline]
  5. Srinivas R. V., Middlemas D., Flynn P., Fridland A. Human immunodeficiency virus protease inhibitors serve as substrates for multidrug transporter proteins MDR1 and MRP1 but retain antiviral efficacy in cell lines expressing these transporters. Antimicrob. Agents Chemother., 42: 3157-3162, 1998.[Abstract/Free Full Text]
  6. Lebbe C., Blum L., Pellet C., Blanchard G., Verola O., Morel P., Danne O., Calvo F. Clinical and biological impact of antiretroviral therapy with protease inhibitors on HIV-related Kaposi’s sarcoma. AIDS (Hagerstown), 12: F45-F49, 1998.[Medline]
  7. Dantuma N. P., Lindsten K., Glas R., Jellne M., Masucci M. G. Short-lived green fluorescent proteins for quantifying ubiquitin/proteasome-dependent proteolysis in living cells. Nat. Biotechnol., 18: 538-543, 2000.[Medline]
  8. Glas R., Bogyo M., McMaster J. S., Gaczynska M., Ploegh H. L. A proteolytic system that compensates for loss of proteasome function. Nature (Lond.), 392: 618-622, 1998.[Medline]
  9. Stein R. L., Melandri F., Dick L. Kinetic characterization of the chymotryptic activity of the 20S proteasome. Biochemistry, 35: 3899-3908, 1996.[Medline]
  10. Li N., Karin M. Ionizing radiation and short wavelength UV activate NF-{kappa}B through two distinct mechanisms. Proc. Natl. Acad. Sci. USA, 95: 13012-13017, 1998.[Abstract/Free Full Text]
  11. Pajonk F., Pajonk K., McBride W. Apoptosis and radisensitization of Hodgkin’s cells by proteasome inhibition. Int. J. Radiat. Oncol. Biol., 47: 1025-1032, 2000.[Medline]
  12. Theyer G., Schirmbock M., Thalhammer T., Sherwood E. R., Baumgartner G., Hamilton G. Role of the MDR-1-encoded multiple drug resistance phenotype in prostate cancer cell lines. J. Urol., 150: 1544-1547, 1993.[Medline]
  13. Shinohara K., Tomioka M., Nakano H., Tone S., Ito H., Kawashima S. Apoptosis induction resulting from proteasome inhibition. Biochem. J., 317: 385-388, 1996.
  14. Pajonk F., McBride W. H. The proteasome in cancer biology and treatment. Radiat. Res., 156: 447-459, 2001.[Medline]
  15. Ciechanover A. The ubiquitin-proteasome proteolytic pathway. Cell, 79: 13-21, 1994.[Medline]
  16. Lee D. H., Goldberg A. L. Selective inhibitors of the proteasome-dependent and vacuolar pathways of protein degradation in Saccharomyces cerevisiae. J. Biol. Chem., 271: 27280-27284, 1996.[Abstract/Free Full Text]
  17. Herrmann J. L., Briones F., Jr., Brisbay S., Logothetis C. J., McDonnell T. J. Prostate carcinoma cell death resulting from inhibition of proteasome activity is independent of functional Bcl-2 and p53. Oncogene, 17: 2889-2899, 1998.[Medline]
  18. Zhang X. M., Lin H., Chen C., Chen B. D. Inhibition of ubiquitin-proteasome pathway activates a caspase-3-like protease and induces Bcl-2 cleavage in human M-07e leukaemic cells. Biochem. J., 340: 127-133, 1999.
  19. Kitagawa H., Tani E., Ikemoto H., Ozaki I., Nakano A., Omura S. Proteasome inhibitors induce mitochondria-independent apoptosis in human glioma cells. FEBS Lett., 443: 181-186, 1999.[Medline]
  20. McDade T. P., Perugini R. A., Vittimberga F. J., Jr., Callery M. P. Ubiquitin-proteasome inhibition enhances apoptosis of human pancreatic cancer cells. Surgery, 126: 371-377, 1999.[Medline]
  21. Adams J., Palombella V. J., Sausville E. A., Johnson J., Destree A., Lazarus D. D., Maas J., Pien C. S., Prakash S., Elliott P. J. Proteasome inhibitors: a novel class of potent and effective antitumor agents. Cancer Res., 59: 2615-2622, 1999.[Abstract/Free Full Text]
  22. An B., Goldfarb R. H., Siman R., Dou Q. P. Novel dipeptidyl proteasome inhibitors overcome Bcl-2 protective function and selectively accumulate the cyclin-dependent kinase inhibitor p27 and induce apoptosis in transformed, but not normal, human fibroblasts. Cell Death Differ., 5: 1062-1075, 1998.[Medline]
  23. Russo S. M., Tepper J. E., Baldwin A. S., Jr., Liu R., Adams J., Elliott P., Cusack J. C., Jr. Enhancement of radiosensitivity by proteasome inhibition: implications for a role of NF-{kappa}B. Int. J. Radiat. Oncol. Biol. Phys., 50: 183-193, 2001.[Medline]
  24. Rolfe M., Chiu M. I., Pagano M. The ubiquitin-mediated proteolytic pathway as a therapeutic area. J. Mol. Med., 75: 5-17, 1997.[Medline]
  25. Schmidtke G., Holzhutter H. G., Bogyo M., Kairies N., Groll M., de Giuli R., Emch S., Groettrup M. How an inhibitor of the HIV-I protease modulates proteasome activity. J. Biol. Chem., 274: 35734-35740, 1999.[Abstract/Free Full Text]
  26. Pajonk F., Pajonk K., McBride W. H. Inhibition of NF-{kappa}B, clonogenicity, and radiosensitivity of human cancer cells. J. Natl. Cancer Inst. (Bethesda), 91: 1956-1960, 1999.[Abstract/Free Full Text]
  27. Palayoor S. T., Youmell M. Y., Calderwood S. K., Coleman C. N., Price B. D. Constitutive activation of I{kappa}B kinase {alpha} and NF-{kappa}B in prostate cancer cells is inhibited by ibuprofen. Oncogene, 18: 7389-7394, 1999.[Medline]
  28. Bargou R. C., Emmerich F., Krappmann D., Bommert K., Mapara M. Y., Arnold W., Royer H. D., Grinstein E., Greiner A., Scheidereit C., Dörken B. Constitutive nuclear factor-{kappa}B-RelA activation is required for proliferation and survival of Hodgkin’s disease tumor cells. J. Clin. Investig., 100: 2961-2969, 1997.[Medline]
  29. Baeuerle P. A., Baltimore D. NF-{kappa}B: ten years after. Cell, 87: 13-20, 1996.[Medline]
  30. Jacque J. M., Fernandez B., Arenzana-Seisdedos F., Thomas D., Baleux F., Virelizier J. L., Bachelerie F. Permanent occupancy of the human immunodeficiency virus type 1 enhancer by NF-{kappa}B is needed for persistent viral replication in monocytes. J. Virol., 70: 2930-2938, 1996.[Abstract]
  31. Adams J., Palombella V. J., Elliott P. J. Proteasome inhibition: a new strategy in cancer treatment. Investig. New Drugs, 18: 109-121, 2000.[Medline]
  32. Teicher B. A., Ara G., Herbst R., Palombella V. J., Adams J. The proteasome inhibitor PS-341 in cancer therapy. Clin. Cancer Res, 5: 2638-2645, 1999.[Abstract/Free Full Text]
  33. Hoffmann C., Tabrizian S., Wolf E., Eggers C., Stoehr A., Plettenberg A., Buhk T., Stellbrink H. J., Horst H. A., Jager H., Rosenkranz T. Survival of AIDS patients with primary central nervous system lymphoma is dramatically improved by HAART-induced immune recovery. AIDS (Hagerstown), 15: 2119-2127, 2001.[Medline]
  34. Sgadari C., Barillari G., Toschi E., Carlei D., Bacigalupo I., Baccarini S., Palladino C., Leone P., Bugarini R., Malavasi L., Cafaro A., Falchi M., Valdembri D., Rezza G., Bussolino F., Monini P., Ensoli B. HIV protease inhibitors are potent anti-angiogenic molecules and promote regression of Kaposi sarcoma. Nat. Med., 8: 225-232, 2002.[Medline]
  35. Pati S., Pelser C. B., Dufraine J., Bryant J. L., Reitz M. S., Jr., Weichold F. F. Antitumorigenic effects of HIV protease inhibitor ritonavir: inhibition of Kaposi sarcoma. Blood, 99: 3771-3779, 2002.[Abstract/Free Full Text]
  36. Kurowski M., Muller M., Donath F., Mrozikiewicz M., Mocklinghoff C. Single daily doses of saquinavir achieve HIV-inhibitory concentrations when combined with baby-dose ritonavir. Eur. J. Med. Res., 4: 101-104, 1999.[Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
D. Maksimovic-Ivanic, S. Mijatovic, D. Miljkovic, L. Harhaji-Trajkovic, G. Timotijevic, M. Mojic, D. Dabideen, K. F. Cheng, J. A. McCubrey, K. Mangano, et al.
The antitumor properties of a nontoxic, nitric oxide-modified version of saquinavir are independent of Akt
Mol. Cancer Ther., May 1, 2009; 8(5): 1169 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
O. P. Flint, M. A. Noor, P. W. Hruz, P. B. Hylemon, K. Yarasheski, D. P. Kotler, R. A. Parker, and A. Bellamine
The Role of Protease Inhibitors in the Pathogenesis of HIV-Associated Lipodystrophy: Cellular Mechanisms and Clinical Implications
Toxicol Pathol, January 1, 2009; 37(1): 65 - 77.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Kraus, E. Malenke, J. Gogel, H. Muller, T. Ruckrich, H. Overkleeft, H. Ovaa, E. Koscielniak, J. T. Hartmann, and C. Driessen
Ritonavir induces endoplasmic reticulum stress and sensitizes sarcoma cells toward bortezomib-induced apoptosis
Mol. Cancer Ther., July 1, 2008; 7(7): 1940 - 1948.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. Oehler-Janne, F. Huguet, S. Provencher, B. Seifert, L. Negretti, M.-O. Riener, M. Bonet, A. S. Allal, and I. F. Ciernik
HIV-Specific Differences in Outcome of Squamous Cell Carcinoma of the Anal Canal: A Multicentric Cohort Study of HIV-Positive Patients Receiving Highly Active Antiretroviral Therapy
J. Clin. Oncol., May 20, 2008; 26(15): 2550 - 2557.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Pyrko, A. Kardosh, W. Wang, W. Xiong, A. H. Schonthal, and T. C. Chen
HIV-1 Protease Inhibitors Nelfinavir and Atazanavir Induce Malignant Glioma Death by Triggering Endoplasmic Reticulum Stress
Cancer Res., November 15, 2007; 67(22): 10920 - 10928.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. J. Gills, J. LoPiccolo, J. Tsurutani, R. H. Shoemaker, C. J.M. Best, M. S. Abu-Asab, J. Borojerdi, N. A. Warfel, E. R. Gardner, M. Danish, et al.
Nelfinavir, A Lead HIV Protease Inhibitor, Is a Broad-Spectrum, Anticancer Agent that Induces Endoplasmic Reticulum Stress, Autophagy, and Apoptosis In vitro and In vivo
Clin. Cancer Res., September 1, 2007; 13(17): 5183 - 5194.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. C. Cuneo, T. Tu, L. Geng, A. Fu, D. E. Hallahan, and C. D. Willey
HIV Protease Inhibitors Enhance the Efficacy of Irradiation
Cancer Res., May 15, 2007; 67(10): 4886 - 4893.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. De Barros, A. Zakaroff-Girard, M. Lafontan, J. Galitzky, and V. Bourlier
Inhibition of Human Preadipocyte Proteasomal Activity by HIV Protease Inhibitors or Specific Inhibitor Lactacystin Leads to a Defect in Adipogenesis, Which Involves Matrix Metalloproteinase-9
J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 291 - 299.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Zhou, E. C. Gurley, S. Jarujaron, H. Ding, Y. Fang, Z. Xu, W. M. Pandak Jr., and P. B. Hylemon
HIV protease inhibitors activate the unfolded protein response and disrupt lipid metabolism in primary hepatocytes
Am J Physiol Gastrointest Liver Physiol, December 1, 2006; 291(6): G1071 - G1080.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. K. Gupta, G. J. Cerniglia, R. Mick, W. G. McKenna, and R. J. Muschel
HIV Protease Inhibitors Block Akt Signaling and Radiosensitize Tumor Cells Both In vitro and In vivo
Cancer Res., September 15, 2005; 65(18): 8256 - 8265.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. A. Parker, O. P. Flint, R. Mulvey, C. Elosua, F. Wang, W. Fenderson, S. Wang, W.-P. Yang, and M. A. Noor
Endoplasmic Reticulum Stress Links Dyslipidemia to Inhibition of Proteasome Activity and Glucose Transport by HIV Protease Inhibitors
Mol. Pharmacol., June 1, 2005; 67(6): 1909 - 1919.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
V. Bourlier, A. Zakaroff-Girard, S. De Barros, C. Pizzacalla, V. D. de Saint Front, M. Lafontan, A. Bouloumie, and J. Galitzky
Protease Inhibitor Treatments Reveal Specific Involvement of Matrix Metalloproteinase-9 in Human Adipocyte Differentiation
J. Pharmacol. Exp. Ther., March 1, 2005; 312(3): 1272 - 1279.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
M. F. McCarty
Targeting Multiple Signaling Pathways as a Strategy for Managing Prostate Cancer: Multifocal Signal Modulation Therapy
Integr Cancer Ther, December 1, 2004; 3(4): 349 - 380.
[Abstract] [PDF]


Home page
Cancer Res.Home page
T. Ikezoe, Y. Hisatake, T. Takeuchi, Y. Ohtsuki, Y. Yang, J. W. Said, H. Taguchi, and H. P. Koeffler
HIV-1 Protease Inhibitor, Ritonavir: A Potent Inhibitor of CYP3A4, Enhanced the Anticancer Effects of Docetaxel in Androgen-Independent Prostate Cancer Cells In vitro and In vivo
Cancer Res., October 15, 2004; 64(20): 7426 - 7431.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
O. Equils, A. Shapiro, Z. Madak, C. Liu, and D. Lu
Human Immunodeficiency Virus Type 1 Protease Inhibitors Block Toll-Like Receptor 2 (TLR2)- and TLR4-Induced NF-{kappa}B Activation
Antimicrob. Agents Chemother., October 1, 2004; 48(10): 3905 - 3911.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
T. Ikezoe, T. Saito, K. Bandobashi, Y. Yang, H. P. Koeffler, and H. Taguchi
HIV-1 protease inhibitor induces growth arrest and apoptosis of human multiple myeloma cells via inactivation of signal transducer and activator of transcription 3 and extracellular signal-regulated kinase 1/2
Mol. Cancer Ther., April 1, 2004; 3(4): 473 - 479.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
N. Laurent, S. de Bouard, J.-S. Guillamo, C. Christov, R. Zini, H. Jouault, P. Andre, V. Lotteau, and M. Peschanski
Effects of the proteasome inhibitor ritonavir on glioma growth in vitro and in vivo
Mol. Cancer Ther., February 1, 2004; 3(2): 129 - 136.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Fakruddin and J. Laurence
HIV Envelope gp120-mediated Regulation of Osteoclastogenesis via Receptor Activator of Nuclear Factor {kappa}B Ligand (RANKL) Secretion and Its Modulation by Certain HIV Protease Inhibitors through Interferon-{gamma}/RANKL Cross-talk
J. Biol. Chem., November 28, 2003; 278(48): 48251 - 48258.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pajonk, F.
Right arrow Articles by McBride, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pajonk, F.
Right arrow Articles by McBride, W. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online