| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Gene, HNF3
(FOXA1), on Chromosome Band 14q13 Is Amplified and Overexpressed in Esophageal and Lung Adenocarcinomas1
Section of General Thoracic Surgery, Departments of Surgery [L. L., C. T. M., J. I. C., M. S. P., J. Y., M. B. O., D. G. B.], Human Genetics [S. L. D., T. W. G.], Pathology [R. W.], and Pediatrics [D. E. M., S. M. H., T. W. G.], University of Michigan Medical School, Ann Arbor, Michigan 48109
| ABSTRACT |
|---|
|
|
|---|
(FOXA1)4
gene, a forkhead gene family member, was overexpressed in all of the amplified esophageal tumors. HNF3
amplification was confirmed by Southern blot and interphase fluorescence in situ hybridization analyses, and the results of real-time RT-PCR were consistent with that of the regular quantitative RT-PCR. Increased immunohistochemical nuclear staining of the HNF3
protein was detected in all of the tumors containing 14q13 amplification. Affymetrix oligonucleotide microarrays of 86 lung adenocarcinomas demonstrated that expression of the HNF3
mRNA was elevated (
2.5-fold of mean expression in normal lung) in 37% (32 of 86) of the tumors analyzed. Gene amplification of HNF3
was detected in 2 of the 5 overexpressed lung tumors examined. This is the first report of HNF3
amplification, and overexpression in esophageal and lung adenocarcinomas. Amplification of HNF3
in esophageal and lung tumors may suggest a potential oncogenic role for this gene in tumorigenesis. | INTRODUCTION |
|---|
|
|
|---|
Genomic amplification is commonly observed in many types of human malignancies, including esophageal adenocarcinoma. An amplified DNA segment is selected because it contains gene(s), in most cases an oncogene, that when amplified and overexpressed confers a growth advantage for cells. In humans, genomic amplification is exclusively restricted to tumor cells and is a major mechanism for the activation of dominant-acting oncogenes during tumorigenesis. Amplification of the erbB2, EGFR, and K-ras oncogenes has been identified in esophageal adenocarcinomas (5 , 6) . Genomic amplification on chromosomes 8p, 15q, and 20q has also been reported in this tumor type using comparative genomic hybridization (7) . We have previously identified and characterized a novel amplicon on 8p22 in esophageal adenocarcinomas (8) . The results suggested that two genes, cysteine protease cathepsin B and transcription factor GATA-4, were the selected targets of the 8p2223 amplification (8 , 9) . Using the RLGS5 two-dimensional gel and STS-amplification mapping (9) approaches, we also identified and characterized an amplicon at 19q12, and the cyclin E gene was found to be the best candidate gene for selection of this amplicon (10) .
In the present study, three NotI/DpnII DNA restriction fragments identified in an esophageal adenocarcinoma (P16) demonstrated increased intensity using the RLGS two-dimensional gel approach. STS-amplification mapping was applied to the DNA from 75 normal-tumor paired esophageal samples using STS markers in the chromosomal vicinity of the three cloned restriction fragments to define the frequency and extent of amplification. We found that the core-amplified domain includes the HNF3
gene and the EST stSG46936. The transcription factor HNF3
is a member of the forkhead gene family, and the involvement of the HNF3
gene in liver differentiation and regeneration, embryonic gut development, and pancreatic development has been reported in rodent studies (11, 12, 13, 14)
. The pathogenic significance of overexpressed HNF3
is currently unclear. However, the evidence from our study suggests potential oncogenic involvement for HNF3
in the development and/or progression of gastroesophageal and lung adenocarcinomas.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA Isolation and RLGS Two-dimensional Gel Electrophoresis.
High molecular weight DNA was isolated as described previously (15)
. All of the tumor portions used for DNA isolation in this study contained >70% tumor cells as determined by frozen tissue sections. RLGS two-dimensional gel electrophoresis was performed as described previously (16)
. In brief, DNA from normal and tumor tissues was double-digested using the restriction enzymes NotI and EcoRV (New England Biolabs Inc., Beverly, MA), and the NotI ends were filled with [
-32P]dCTP and [
-32P]dGTP (NEN Life Science Products, Boston, MA). First-dimensional size fractionation was performed in a 32-cm 0.9% disk-agarose gel. The resulting DNA fragments were then in-gel digested with HinfI (or DpnII for cloning purposes) and separated in the second dimension on a 5.25% polyacrylamide gel. Gels were then dried and autoradiographic images obtained (Molecular Dynamics, Sunnyvale, CA). Digital images were analyzed using ImageQuant v1.2 software (Molecular Dynamics). Amplified DNA fragments were quantified by densitometry using the two-dimensional images from the corresponding normal tissue DNA as standards. For cloning purposes, preparative gels were run and the amplified spots were collected (8)
.
Isolation and Cloning of Two-dimensional DNA Fragments.
The gel pieces containing the amplified DNA fragments were isolated and electrophoresed onto a DEAE membrane (Schleicher & Schuell, Keene, NH). The DNA was then eluted and purified as described previously (8)
, and dissolved in 7 µl of distilled water. A pBC vector (Stratagene, La Jolla, CA) was cleaved with the enzymes NotI and BamHI (DpnII compatible end), and was gel-purified using SeaKem GTG agarose (FMC BioProducts, Rockland, ME). Purified two-dimensional gel fragments were then incubated with 1 µl of vector (1 ng/µl) and 1 µl of 10x ligation buffer (Boehringer Mannheim, Indianapolis, IN) at room temperature for 10 min and at 65°C for 7 min, and 1 µl T4 ligase (5 ng/µl; Boehringer Mannheim) was added. The ligation reaction was carried at 16°C for 25 h. The ligation mixture was purified using a standard phenol:chloroform extraction protocol (17)
. The XL1 Blue competent cells were then transformed with the purified plasmid DNA through electroporation using Escherichia coli Pulser (Bio-Rad Laboratories, Hercules, CA). Individual colonies were collected for DNA isolation (mini-preps) via the alkaline lysis method as described by Sambrook et al. (17)
.
Electronic-PCR Analysis.
The cloned fragments were sequenced and analyzed by the BLAST tools6
for similarity matches in the databases. Resulting sequences were used as templates to perform electronic-PCR analysis.6
Chromosomal location of the template was determined based on an alignment to sequences in the databases.
STS-Amplification Mapping Using QG-PCR.
STS markers located in the 14q13 region were selected for quantitative PCR, as described previously (9)
. In brief, PCR primers were designed to ensure that the melting temperature (Tm) of each primer set was compatible with that of the internal control (GAPDH or same chromosome control D14S72). The quantity of the normal and tumor genomic DNA was measured by a fluorometer (TKO100; Hoefer Scientific Instruments, San Francisco, CA) to ensure equity of the starting materials. Forward primers for GAPDH, D14S72 and STS markers, were end-labeled with [
-32P]ATP (NEN Life Science Products) using T4 polynucleotide kinase (New England Biolabs). PCR was performed using Taq polymerase (Promega, Madison, WI), and the PCR products were resolved on 8% denaturing polyacrylamide gels. PCR product signal ratios [the intensity ratio of tumor (Ts/c) or normal (Ns/c) samples versus GAPDH control from QG-PCR] for both the tumor (Ts/c, tumor STS fragment/tumor GAPDH fragment) and normal DNA samples (Ns/c, normal STS fragment/normal GAPDH fragment) were quantified using ImageQuant software (Molecular Dynamics). Values
2.0 were considered indicative of DNA amplification. All of the results were repeated and verified.
Southern Blot Analysis and Interphase FISH Assay.
Ten µg of high molecular weight DNA from paired normal-tumor tissues were loaded into a 1.0% agarose gel. DNA was blotted, and a labeled HNF3
probe was hybridized to the Southern filter using the protocol described previously (10)
. The 459-bp probe spans the sequence of the HNF3
gene (NM_004496, a curated mRNA from National Center for Biotechnology Information databases) from 1485 bp to 1943 bp in the 3' untranslated region and was selected to avoid cross-hybridization to other members of HNF3 family. All of the reagents for interphase FISH were purchased from Vysis, Inc. (Downers Grove, IL) except pepsin (Sigma, St. Louis, MO) and Cot I DNA (Life Technologies, Inc., Gaithersburg, MD). Interphase slides were made using a touch approach, and nick translation and hybridization were conducted according to the Vysis protocol with modification. A prelabeled chromosome 14q telomeric probe (Part number, 33-260014; Vysis) was cohybridized with the target probe. The BAC clone (R-356O9) that includes the HNF3
sequence was purchased from the BACPAC Resources (Childrens Hospital Oakland Research Institute, Oakland, CA).7
BAC DNA was prepared using Concert High Purity Maxiprep System (Life Technologies, Inc.).
RNA Isolation and Real-Time Quantitative RT-PCR.
Total RNA was isolated using TriZol reagent (Life Technologies, Inc.). Agarose gel electrophoresis and the A260:280 ratio were used to assess RNA quality. RNA samples were stored at -80°C until use. All of the RNA samples were treated with DNase I (Promega) before performing reverse transcription. Two µg of total RNA was reverse transcribed using reverse transcriptase (Life Technologies, Inc.) and primed by both (dT)18 and random hexamers in a total of 20 µl of reaction volume. Two µl of the cDNA products underwent RT-PCR with GAPDH coamplified as an internal control. RT-PCR products were then resolved on 8% denaturing PAGE gels, and gel data were analyzed using ImageQuant software as in QG-PCR. Real-time quantitative RT-PCR for HNF3
was performed to verify the expression levels in the tumors. HNF3
and GAPDH were amplified using TaqMan probes labeled with 5' fluorescent label, 6FAM or VIC, respectively, and 3' Quencher 6-carboxytetramethylrhodamine (PE Applied Biosystems, Foster City, CA). The forward and reverse primers flanking a 78-bp fragment of HNF3
, which maps to the 3' untranslated region of the gene and ensures the specificity of the fragment to HNF3
, are (5'-3') CATTGCCATCGTGTGCTTGT and CCCGTCTGGCTATACTAACACCAT, respectively. The sequence of 6FAM-labeled probe is (5'-3') TCATCCAGTGTTATGCACTTTCCACAGTTGG. Human GAPDH primers and VIC-prelabeled probe were purchased from PE Applied Biosystems (catalogue no. 4310884E). Real-time quantitative PCR was performed and analyzed using the PRISM 7700 Sequence Detector according to instructions of the manufacturer (PE Applied Biosystems).
Immunohistochemical Analysis.
Frozen specimens were sectioned at 5 µm, placed on 0.1% poly-L-lysine-coated slides, and fixed in 100% acetone at -20°C for 10 min. Endogenous peroxidase activity was quenched, and nonspecific binding was blocked using horse serum in PBS-1% BSA. The HNF3
protein was detected using an anti-HNF3
antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at a 1:100 dilution in PBS-1% BSA. Immunoreactivity was detected using the Vectastain avidin/biotin complex kit (Vector Laboratories, Burlingame, CA) as described previously (18)
.
Expression Analysis Using Oligonucleotide (Affymetrix) Microarrays.
Total cellular RNA was isolated from 10 normal and 86 lung adenocarcinoma samples using TriZol reagent (Life Technologies, Inc.). Total RNA was additionally purified using RNeasy spin column (Qiagen, Valencia, CA) and used to generate cRNA probes. Preparation of cRNA and hybridization of the HuGeneFL Arrays were performed according to the manufacturers protocol (Affymetrix, Santa Clara, CA). The arrays were scanned using the GeneArray scanner (Affymetrix), and data analysis was performed using GeneChip 4.0 software as described previously (19)
.
| RESULTS |
|---|
|
|
|---|
|
|
gene, and the sequence of the P163 fragment was found to overlap the sequence of gene PAX9 (Table 1)
Defining and Characterizing the Core-amplified Domain of the 14q13 Amplicon Using the STS-Amplification Mapping Approach.
To define the core-amplified domain and determine the frequency of the 14q13 amplification present in esophageal adenocarcinomas, >13 STS or gene markers, spanning a distance >6 Mb in the vicinity of the cloned genomic fragments, were selected by searching the NCBI, Whitehead Institute Center for Genome Research, and Stanford Human Genome Center databases. QG-PCR analysis was applied to DNA from 75 normal-tumor paired esophageal samples with these markers (Fig. 2A
; Fig. 3
). The housekeeping gene GAPDH, located on 12p13, was coamplified in every reaction as an internal control. D14S72, which maps to centromeric chromosome band 14q11, was coamplified with target genes or STS markers in additional reactions as a chromosome 14 control to exclude aneuploidy as the cause of increased DNA dosage in the tumors containing the 14q13 amplicon. GAPDH and D14S72 were PCR coamplified before the targeted assays for each normal-tumor pair to ensure that D14S72 is not increased in copy number in the tumors examined. DNA copy number of D14S72 was found to parallel that of GAPDH between normal and tumor DNAs in all of the tumors tested (data not shown). This indicates that the 14q13 amplicon represents an intrachromosomal amplification and that aneuploidy is not the cause of increased DNA content in amplified tumors. This is consistent with the results of interphase FISH, where a telomeric 14q (14q32) probe and a HNF3
containing BAC probe (R-356O9) were cohybridized to the tumor sections (Fig. 6, B and C)
. Therefore, D14S72 can be used as a reference marker to more accurately reflect copy number of amplified genomic fragments at 14q13 in a QG-PCR assay. Increased DNA dosage (value
2.0) was observed in amplified tumors (Fig. 2A)
. The frequency of the 14q13 amplification is 6.7%, and the amplicon spans
6 Mb in tumor P16 and is contained in a region <0.3 Mb in all of the remaining amplified tumors (Fig. 2A
and Fig. 3
). The core-amplified domain of this amplicon maps between markers AA029430 and Stanford Human Genome Center-103312 (Fig. 3)
, a distance of
254 kb based on the physical maps from the NCBI. The transcription factor, HNF3
, resides in the core-amplified domain (Fig. 3)
. Genomic coamplification of the PAX9 (cloned two-dimensional fragment P163) and the NKX-2.8 genes, an oncogene 80 kb centromeric to PAX9, with HNF3
was only observed in tumor P16 (Fig. 3)
. The copy number of the NFKBIA gene (IKBA or MAD-3) was not found to be increased in any tumors examined.
|
|
|
-specific probe, and gene amplification of HNF3
was verified in tumor P16 (Fig. 2B)
containing BAC probe. FISH images demonstrated an apparent increase in copy number of the 14q13 region in the tumors containing 14q13 amplicon, whereas the telomeric region of 14q remained unchanged in the same tumors, indicating a nonaneuploid status of chromosome 14 for these tumors and that the gene amplification of HNF3
is not a result of increased numbers of chromosome 14 (Fig. 6, B and C)
containing BAC probe as compared with its cohybridized telomeric 14q probe (Fig. 6B)
was confirmed in tumor I34, where three or more green spots (HNF3
containing BAC probe) were observed (Fig. 6C)
Real-Time Quantitative PCR Reveals Increased Expression of the HNF3
mRNA.
Quantitative RT-PCR was applied to amplified tumors and a few tumors not containing the 14q13 amplicon to investigate the expression level of 8 genes and ESTs within or near the core-amplified region (Table 2
; Fig. 4
). HNF3
was found to be overexpressed in all of the amplified tumors. HNF3
exhibits the most frequent rate of both overexpression and amplification among the examined 8 genes and ESTs (Table 2)
located within or near the core amplified domain (
254 kb). This suggests that HNF3
is the best candidate for selection in the 14q13 amplicon. Moreover, HNF3
mRNA expression data, analyzed using real-time quantitative RT-PCR of an HNF3
-specific sequence, are consistent with the results from conventional quantitative RT-PCR (Table 2)
.
|
|
mRNA Is a Frequent Event in Lung Adenocarcinomas.
mRNA (
2.5-fold of mean expression in normal lungs) in 32 of the 86 (37%) lung tumors analyzed (Table 3)
mRNA (all
4.8-fold of mean expression in normal lungs) in microarrays were analyzed for HNF3
amplification by QG-PCR (Fig. 5
was also found in 1 lung adenocarcinoma, H01, in an independent series of 27 lung tumors examined (Fig. 5)
|
|
Protein in Esophageal Tumors Containing the 14q13 Amplicon.
protein in esophageal tumors with or without HNF3
amplification. Intense nuclear staining was observed in tumor P16 (Fig. 6F)
primary antibody (negative control; Fig. 6E
was sporadic in tumor O65, which does not contain the 14q13 amplicon (Fig. 6H)
protein was also found in lung adenocarcinomas containing the 14q13 amplification (data not shown). | DISCUSSION |
|---|
|
|
|---|
gene (Table 1)
is overexpressed in all 5 of the amplified tumors (Table 2)
protein was observed in the esophageal tumors containing the HNF3
amplicon. Amplification and overexpression of HNF3
were also found in lung adenocarcinomas. Overexpression of the HNF3
mRNA can be gene amplification dependent and independent, because elevated expression of this gene was observed not only in the tumor RNA, which possesses HNF3
gene amplification, but also in lung tumor RNAs not containing gene amplification. This is the first study to report and characterize the 14q13 amplification in esophageal and gastric cardia adenocarcinomas as well as in lung adenocarcinomas.
During the preparation of this manuscript, amplification of chromosome band 14q13 was reported in cell lines derived from esophageal squamous cell carcinomas (20)
. The minimal common region of amplification was 4 Mb with 7 genes named as the candidates for the amplicon. One of the most frequently amplified genes in that study, NFKBIA, which is 2.6 Mb centromeric to HNF3
, was not found amplified in any of the 75 primary esophageal adenocarcinomas examined in the present study. The analyses of genomic DNA amplification, and mRNA and protein expression in these tumors indicate that HNF3
is a strong candidate for the 14q13 amplicon in our series of esophageal adenocarcinomas. Analyses of virtual Northern and serial analysis of gene expression (SAGE) data indicated that increased expression of HNF3
is observed in cell lines derived from prostate, breast, and ovarian cancers.6
High expression of the HNF3
mRNA has also been observed in a luminal subtype of primary breast carcinomas (21)
. Increased HNF3
mRNA expression in many tumor types indicates a possible role for HNF3
in the development or progression of many cancers.
HNF3
(FOXA1) belongs to the hepatocyte nuclear factor 3 (HNF3) gene family, which includes HNF3ß (FOXA2) and HNF3
(FOXA3). HNF3
encodes a polypeptide of 473 amino acids in humans (22)
. The HNF3 genes are members of the forkhead class of DNA-binding proteins (23)
, all of which contain a highly conserved 110-amino acid forkhead motif, a variant of the helix-turn-helix motif, first identified in the Drosophila gene fork head (fkh; Ref. 11
). HNF3
is expressed in embryonic endoderm and adult tissues of endodermal origin, including stomach, intestines, liver, and lung (24)
. Recently, expression of the secreted signaling factor sonic hedgehog (Shh) in mice has been shown to be regulated by an HNF3-dependent mechanism (25)
. Overexpression of Shh in mice has been associated with the development of basal cell carcinoma (26)
.
Forkhead-family genes have been associated previously with cancer and leukemia, but our report is the first example of amplification and overexpression in primary tumors of the esophagus and lung. Breakpoints within the forkhead domain of two forkhead-family genes, FOXO4 and FOXO2, have been found to be associated with chromosomal translocations in acute lymphocyte leukemia and secondary acute leukemia (27
, 28)
. Translocation involving another forkhead family gene, FOXO1a, has also been associated with pediatric solid tumor alveolar rhabdomyosarcoma (29)
. Oncogenic transformation was observed when the fused gene of PAX3 and FOXO1a was transfected into chicken embryo fibroblasts (30)
. In addition, the Foxg1b (qin) oncogene, a member of the forkhead/HNF3 family of transcriptional regulators, has been found to transform chicken embryo fibroblasts and induce fibrosarcomas in chickens (31
, 32)
. A deletion of the winged helix forkhead domain of the qin gene was shown to completely abrogate the oncogenic capacity of qin/foxg1b in chicken embryo fibroblasts, indicating the necessity of the forkhead domain for the transforming activity of the gene (32)
. Interestingly, several forkhead family genes, e.g., FOXA1(HNF3
), FOXG1A, and FOXG1B (QIN) are clustered and located at 14q13,6
but both FOXG1A and FOXG1B are outside our 14q13 amplicon. Evidence from our study and oncogenic properties of other members of the forkhead gene family suggest a potential oncogenic role for HNF3
(FOXA1) in the development and/or progression of esophageal and lung adenocarcinomas.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by National Cancer Institute Grant CA71606 and the Weber Research Fund. ![]()
2 These authors contributed equally to this work. ![]()
3 To whom requests for reprints should be addressed, at MSRB II B560, Box 0686, Department of Surgery, Section of General Thoracic Surgery, University of Michigan Medical School, Ann Arbor, MI 48109. Phone: (734) 763-0325; Fax: (734) 763-0323; E-mail: dgbeer{at}umich.edu ![]()
4 According to the new nomenclature, all vertebrate genes encoding winged helix proteins will be termed Fox, for forkhead box (Kaestner, K. H., Knochel, W., and Martinez, D. E. Unified nomenclature for the winged helix/forkhead transcription factors. Genes Dev., 14: 142146, 2000). ![]()
5 The abbreviations used are: RLGS, restriction landmark genome scanning; FISH, florescent in situ hybridization; STS, sequence tagged site; EST, expressed sequence tag; QG-PCR, quantitative genomic-PCR; NCBI, the National Center for Biotechnology Information; BAC, bacterial artificial chromosome; Tsc:Ns/c, the intensity ratio of tumor (Ts/c) or normal (Ns/c) samples versus GAPDH control from QG-PCR. ![]()
6 Internet address: http://www.ncbi.nlm.nih.gov. ![]()
7 E-mail address: BACPACorders@chori.org. ![]()
Received 11/15/01. Accepted 7/19/02.
| REFERENCES |
|---|
|
|
|---|
belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genes Dev., 5: 416-427, 1991.
affects glucose homeostasis and islet glucagon gene expression in vivo. Genes Dev., 13: 495-504, 1999.
from a human pulmonary adenocarcinoma cell line. Biochim. Biophys. Acta, 1307: 17-20, 1996.[Medline]
belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genomics, 20: 377-385, 1994.[Medline]
, ß and
genes in the determination of the definitive endoderm, chordamesoderm and neuroectoderm. Development (Camb.), 119: 567-578, 1993.This article has been cited by other articles:
![]() |
C. Nucera, J. Eeckhoute, S. Finn, J. S. Carroll, A. H. Ligon, C. Priolo, G. Fadda, M. Toner, O. Sheils, M. Attard, et al. FOXA1 Is a Potential Oncogene in Anaplastic Thyroid Carcinoma Clin. Cancer Res., June 1, 2009; 15(11): 3680 - 3689. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Jonckheere, A. Vincent, M. Perrais, M.-P. Ducourouble, A. K.-v. Male, J.-P. Aubert, P. Pigny, K. L. Carraway, J.-N. Freund, I. B. Renes, et al. The Human Mucin MUC4 Is Transcriptionally Regulated by Caudal-related Homeobox, Hepatocyte Nuclear Factors, Forkhead Box A, and GATA Endodermal Transcription Factors in Epithelial Cancer Cells J. Biol. Chem., August 3, 2007; 282(31): 22638 - 22650. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Sagaert, P. de Paepe, L. Libbrecht, V. Vanhentenrijk, G. Verhoef, J. Thomas, I. Wlodarska, and C. De Wolf-Peeters Forkhead Box Protein P1 Expression in Mucosa-Associated Lymphoid Tissue Lymphomas Predicts Poor Prognosis and Transformation to Diffuse Large B-Cell Lymphoma J. Clin. Oncol., June 1, 2006; 24(16): 2490 - 2497. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wan, S. Dingle, Y. Xu, V. Besnard, K. H. Kaestner, S.-L. Ang, S. Wert, M. T. Stahlman, and J. A. Whitsett Compensatory Roles of Foxa1 and Foxa2 during Lung Morphogenesis J. Biol. Chem., April 8, 2005; 280(14): 13809 - 13816. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kauraniemi, T. Kuukasjarvi, G. Sauter, and A. Kallioniemi Amplification of a 280-Kilobase Core Region at the ERBB2 Locus Leads to Activation of Two Hypothetical Proteins in Breast Cancer Am. J. Pathol., November 1, 2003; 163(5): 1979 - 1984. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Miller, J. R. Moy, L. Lin, M. Schipper, D. Normolle, D. E. Brenner, M. D. Iannettoni, M. B. Orringer, and D. G. Beer Gene Amplification in Esophageal Adenocarcinomas and Barrett's with High-Grade Dysplasia Clin. Cancer Res., October 15, 2003; 9(13): 4819 - 4825. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |