Cancer Research Meeting Calendar  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Doorn, R.
Right arrow Articles by Tensen, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Doorn, R.
Right arrow Articles by Tensen, C. P.
[Cancer Research 62, 5389-5392, October 1, 2002]
© 2002 American Association for Cancer Research


Advances in Brief

A Novel Splice Variant of the Fas Gene in Patients with Cutaneous T-Cell Lymphoma

Remco van Doorn1,,2, Remco Dijkman1, Maarten H. Vermeer, Theo M. Starink, Rein Willemze and Cornelis P. Tensen3

Department of Dermatology, Vrije Universiteit Medical Center, 1081 HV Amsterdam, the Netherlands, and Department of Dermatology, Leiden University Medical Center, 2333 AL Leiden, the Netherlands


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Defective apoptosis signaling has been implicated in the pathogenesis of primary cutaneous T-cell lymphomas (CTCLs), a group of malignancies derived from skin-homing T cells. An important mediator of apoptosis in T cells is the Fas receptor. We identified a novel splice variant of the Fas gene that displays retention of intron 5 and encodes a dysfunctional Fas protein in 13 of 22 patients (59%) in both early and advanced CTCL. Impairment of Fas-induced apoptosis resulting from aberrant splicing potentially contributes to the development and progression of CTCL by allowing continued clonal expansion of activated T cells and by reducing susceptibility to antitumor immune responses.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
CTCLs4 are a group of clinically heterogeneous malignancies of mature skin-homing T cells (1) . The low mitosis index in the early stages of MF, the most common type of CTCL, and resistance to treatment with genotoxic agents suggest that defective apoptosis signaling plays a role in the pathogenesis of CTCL (2) . One of the key regulators of apoptosis in mature T cells is Fas, a homotrimer cell surface receptor that mediates apoptosis upon cross-linking to Fas ligand. The Fas protein contains an intracellular region essential for transduction of the apoptotic signal termed the death domain; mutations in this domain dominantly interfere with Fas function (3 , 4) . Fas is a critical mediator of activation-induced cell death, a propriocidal mechanism involved in homeostasis of activated T cells (5) . In addition, Fas signaling renders neoplastic cells susceptible to antitumor immune responses executed by cytotoxic T cells through cross-linking with Fas ligand. We previously reported loss of Fas protein expression in aggressive types of CTCL (6) . In non-Hodgkin’s lymphoma, deleterious mutations of the Fas gene have been identified in 11% of patients (7) . In the present study, we examined the occurrence of splice variants and mutations of the Fas gene as well as Fas protein expression in lesional skin biopsy specimens from patients with CTCL.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Lesional skin biopsy specimens were obtained from 15 patients with advanced CTCL, including 7 patients with tumor-stage MF (T3N0M0) and 8 patients with CD30- PCLTCL. For the detection of splice variants in early CTCL, skin biopsy specimens from 7 patients with plaque-stage MF (T2N0M0; Ref. 8 ) were obtained. Cultured keratinocytes, phytohemagglutinin-activated CD4+ and CD8+ T cells, and skin biopsy specimens from patients with benign cutaneous lymphocytic infiltrates (atopic dermatitis, graft-versus-host-disease, and chronic discoid lupus erythematosus) were used as controls. Total cellular RNA was extracted from homogenized samples before treatment with RQ1 DNase (Promega, Madison, WI). cDNA synthesis was performed using Expand Reverse Transcriptase (Roche, Mannheim, Germany) after priming with an oligo(dT)12–18 primer (Invitrogen, Breda, the Netherlands). PCR amplification of cDNA was performed with five overlapping primer pairs (FAS I-V) covering the entire coding region of the Fas gene used previously (9) and an additional primer pair encompassing intron 5 (FAS intron: sense, 5' TCAAGGAATGCACACTCACC 3'; antisense, 5' CCAAACAATTAGTGGAATTG 3'). PCR was performed under the following conditions: denaturing for 30 s at 94°C; annealing for 60 s at 58°C for primer pairs I and II and at 50°C for primer pairs III, IV, and V, and intron 5; and extension for 60 s at 72°C; for 35 cycles. PCR products were separated by electrophoresis on a 2% agarose gel containing ethidium bromide and on a 12.5% acrylamide gel stained using PlusOne DNA Silver Staining Kit (Amersham Pharmacia, Uppsala, Sweden). PCR products were extracted from agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) for reamplification under identical conditions and direct sequence analysis using the dideoxy chain termination method. The presence of transmembrane helices was predicted using TMHMM version 2.0 software (CBS, Denmark). Snap-frozen skin biopsy specimens were stained with a monoclonal antibody to Fas (Fas6 antibody; kindly provided by Dr. L. A. Aarden) as described previously (6) .


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
In three of seven (43%) patients with tumor-stage MF and four of eight (50%) patients with CD30- PCLTCL, an aberrantly spliced transcript of the Fas gene was identified that has not been described previously. Sequence analysis revealed that this splice variant displays selective retention of intron 5, a 152-bp sequence, leading to frameshift and formation of a truncated protein (Figs. 1Citation and 2Citation ). Aberrant splicing of Fas pre-mRNA was not due to splice site mutations because none were detected in intron 5 or in its boundaries. The presence of this particular splice variant was confirmed by using a different primer set designed to amplify the exonic sequences flanking intron 5 and cannot be due to contamination with genomic DNA because this would have generated a larger PCR product containing not only intron 5 but also intron 4. Subsequent examination of an additional group of seven patients with early patch/plaque-stage MF for this splice variant revealed that it was also present in six of seven (85%) patients. It could not be demonstrated in benign cutaneous lymphocytic infiltrates, keratinocytes (Fig. 1A)Citation , or phytohemagglutinin-activated CD4+ and CD8+ T cells (data not shown). This indicates that the aberrant splicing of Fas generating this particular variant is specific for CTCL and is an early event in lymphomagenesis. Detection of this transcript might therefore be useful in the early diagnosis of this group of lymphomas. From one patient with CD30- PCLTCL, we analyzed the presence of this splice variant in a skin biopsy specimen obtained at the time of diagnosis and in a separate skin biopsy specimen obtained 7 months later (Table 1Citation , patient 15a and 15b). Analysis revealed the identical splice variant (Fig. 1ACitation , Lanes 13 and 14), suggesting that alternative splicing of Fas is a persistent event.



View larger version (68K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Detection and analysis of Fas transcripts. A, reverse transcription-PCR analysis of human Fas mRNA using primer pair FAS III. In addition to the expected PCR product of 240 bp, a second PCR product of 392 bp (indicated by the arrow) was detected. Input cDNA template was synthesized from RNA isolated from the following sources. A1: Lane 1, H2O (no cDNA) control; Lane 2, cultured primary keratinocytes; Lanes 3, 5, 6, 7, 11, and 12, MF tumor-stage biopsies; Lanes 4, 8, 9, and 13–17, PCLTCL biopsies; Lane 10, benign lymphocytic skin infiltrate biopsy. A2: Lane 1, H2O (no cDNA) control; Lanes 2–6, benign lymphocytic skin infiltrate biopsies; Lanes 7–13, patch/plaque-stage biopsies. Lane M, molecular size marker (Generuler; MBI Fermentas, St. Leon-Rot, Germany). B, sequence analysis of reverse transcription-PCR products of 240 and 392 bp demonstrating the wild-type transcript and the alternative transcript that exhibits retention of a 152-bp sequence corresponding to intron 5.

 


View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Top, schematic representation of the FAS-encoding exons, the FAS protein, and amplified regions of FAS cDNA in this study. Bottom, location of retained intron found in cDNA synthesized from RNA isolated from CTCL biopsies and schematic representation of altered protein encoded by mRNA with retained intron 5. CRD, cysteine-rich domains; TM, transmembrane domain. Nucleotides are numbered starting with the ATG encoding the initiating methionine as 1 (taken from GenBank accession number M67454).

 

View this table:
[in this window]
[in a new window]

 
Table 1 Clinical features, Fas mutations and alternative transcripts, and Fas protein expression of 15 patients with advanced CTCL

 
Translation of the aberrantly spliced variant results in a protein that contains 32 novel amino acid residues and terminates prematurely at codon 201. The predicted translation product encodes a form of Fas that does not contain a functional transmembrane anchor domain and lacks the death domain (Fig. 2)Citation . Therefore, if the aberrantly spliced variant is translated exclusively in a cell, the resulting aberrant Fas receptor would not be expressed on the plasma membrane. If both the wild-type and alternative transcript are translated simultaneously, assembly and expression of dysfunctional mixed receptor complexes are predicted to occur (10 , 11) . In skin biopsy specimens from the 15 patients with advanced CTCL, Fas protein could not be detected on neoplastic T cells in 9 cases (56%). In five of the seven skin biopsy specimens in which the splice variant was identified, Fas protein expression was not detectable (Table 1)Citation .

In addition, three missense point mutations and two silent point mutations were detected in the 15 patients with advanced CTCL. Two missense point mutations detected in one patient were located in the extracellular domain (G to C at position 406 causing substitution of Thr for Arg at codon 71 and G to T at position 417 causing substitution of Phe for Val at codon 75). One point mutation (C to T at position 892 causing substitution of Thr for Ile at codon 233) was located in the cytoplasmic domain and is predicted to interfere dominantly with the function of Fas. The observed low frequency of deleterious point mutations in the Fas gene in CTCL corresponds with the recent findings of Dereure et al. (12) .

Although alternative splicing is used extensively by genes involved in apoptosis, a role for this mechanism in the pathogenesis of lymphoma has scarcely been described thus far (13 , 14) . The function of the Fas gene is regulated at the level of pre-mRNA splicing in human thymocytes, where five splice variants have been demonstrated (11) . Another three different Fas splice variants have been detected in leukocytes from patients with silicosis (9) . One of the regulators of alternative splicing of Fas is TIA-1, an apoptosis-promoting protein that has been shown to be expressed by neoplastic T cells in a subset of patients with MF (15 , 16) .

In conclusion, we found a splice variant of the Fas tumor suppressor gene, associated with formation of a dysfunctional protein that dominantly interferes with Fas-induced apoptosis, frequently and specifically occurring in patients with CTCL. This could be implicated in the pathogenesis of CTCL by allowing continued clonal expansion of activated T cells and in tumor progression by reducing the susceptibility to antitumor immune responses.


    ACKNOWLEDGMENTS
 
We appreciate the help of Dr. Zoi-Toli, Ing. P. van Beek, and Ing. A. Mulder in preparing sections and staining biopsy material.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 R. v. D. and R. D. contributed equally to this study. Back

2 R. v. D. is supported by a grant from the Dutch foundation "De Drie Lichten." Back

3 To whom requests for reprints should be addressed, at Department of Dermatology, Leiden University Medical Center, Wassenaarseweg 72, 2333 AL Leiden, the Netherlands, Phone: 31-71-5271903; Fax: 31-71-5271910; E-mail:c.p.tensen{at}lumc.nl Back

4 The abbreviations used are: CTCL, cutaneous T-cell lymphoma; MF, mycosis fungoides; PCLTCL, primary cutaneous large T-cell lymphoma. Back

Received 7/23/02. Accepted 8/19/02.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Willemze R., Kerl H., Sterry W., Berti E., Cerroni L., Chimenti S., Diaz-Perez J. L., Geerts M. L., Goos M., Knobler R., Ralfkiaer E., Santucci M., Smith N., Wechsler J., van Vloten W. A., Meijer C. J. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood, 90: 354-371, 1997.[Abstract/Free Full Text]
  2. Kikuchi A., Nishikawa T. Apoptotic and proliferating cells in cutaneous lymphoproliferative diseases. Arch. Dermatol., 133: 829-833, 1997.[Abstract/Free Full Text]
  3. Cascino I., Papoff G., De Maria R., Testi R., Ruberti G. Fas/Apo-1 (CD95) receptor lacking the intracytoplasmic signaling domain protects tumor cells from Fas-mediated apoptosis. J. Immunol., 156: 13-17, 1996.[Abstract]
  4. Vaishnaw A. K., Orlinick J. R., Chu J. L., Krammer P. H., Chao M. V., Elkon K. B. The molecular basis for apoptotic defects in patients with CD95 (Fas/Apo-1) mutations. J. Clin. Investig., 103: 355-363, 1999.[Medline]
  5. Chan K. F., Siegel M. R., Lenardo J. M. Signaling by the TNF receptor superfamily and T cell homeostasis. Immunity, 13: 419-422, 2000.[Medline]
  6. Zoi-Toli O., Vermeer M. H., De Vries E., Van Beek P., Meijer C. J., Willemze R. Expression of Fas and Fas-ligand in primary cutaneous T-cell lymphoma (CTCL): association between lack of Fas expression and aggressive types of CTCL. Br. J. Dermatol., 143: 313-319, 2000.[Medline]
  7. Gronbaek K., Straten P. T., Ralfkiaer E., Ahrenkiel V., Andersen M. K., Hansen N. E., Zeuthen J., Hou-Jensen K., Guldberg P. Somatic Fas mutations in non-Hodgkin’s lymphoma: association with extranodal disease and autoimmunity. Blood, 92: 3018-3024, 1998.[Abstract/Free Full Text]
  8. Bunn P., Lamberg S. Report of the Committee on Staging and Classification of Cutaneous T-Cell Lymphomas. Cancer Treat. Rep., 63: 725-728, 1979.[Medline]
  9. Otsuki T., Sakaguchi H., Tomokuni A., Aikoh T., Matsuki T., Isozaki Y., Hyodoh F., Kawakami Y., Kusaka M., Kita S., Ueki A. Detection of alternatively spliced variant messages of Fas gene and mutational screening of Fas and Fas ligand coding regions in peripheral blood mononuclear cells derived from silicosis patients. Immunol. Lett., 72: 137-143, 2000.[Medline]
  10. Siegel R. M., Frederiksen J. K., Zacharias D. A., Chan F. K., Johnson M., Lynch D., Tsien R. Y., Lenardo M. J. Fas preassociation required for apoptosis signaling and dominant inhibition by pathogenic mutations. Science (Wash. DC), 288: 2354-2357, 2000.[Abstract/Free Full Text]
  11. Jenkins M., Keir M., McCune J. M. A membrane-bound Fas decoy receptor expressed by human thymocytes. J. Biol. Chem., 275: 7988-7993, 2000.[Abstract/Free Full Text]
  12. Dereure O., Levi E., Vonderheid E. C., Kadin M. E. Infrequent Fas mutations but no Bax or p53 mutations in early mycosis fungoides: a possible mechanism for the accumulation of malignant T lymphocytes in the skin. J. Investig. Dermatol., 118: 949-956, 2002.[Medline]
  13. Jiang Z., Wu J. Alternative splicing and programmed cell death. Proc. Soc. Exp. Biol. Med., 220: 64-72, 1999.[Medline]
  14. Xerri L., Hassoun J., Devilard E., Birnbaum D., Birg F. BCL-X and the apoptotic machinery of lymphoma cells. Leuk. Lymphoma, 28: 451-458, 1998.[Medline]
  15. Forch P., Puig O., Kedersha N., Martinez C., Granneman S., Seraphin B., Anderson P., Valcarcel J. The apoptosis-promoting factor TIA-1 is a regulator of alternative pre-mRNA splicing. Mol. Cell, 6: 1089-1098, 2000.[Medline]
  16. Vermeer M. H., Geelen F. A., Kummer J. A., Meijer C. J., Willemze R. Expression of cytotoxic proteins by neoplastic T cells in mycosis fungoides increases with progression from plaque stage to tumor stage disease. Am. J. Pathol., 154: 1203-1210, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
C.-D. Klemke, D. Brenner, E.-M. Weiss, M. Schmidt, M. Leverkus, K. Gulow, and P. H. Krammer
Lack of T-Cell Receptor-Induced Signaling Is Crucial for CD95 Ligand Up-regulation and Protects Cutaneous T-Cell Lymphoma Cells from Activation-Induced Cell Death
Cancer Res., May 15, 2009; 69(10): 4175 - 4183.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. van Doorn, M. S. van Kester, R. Dijkman, M. H. Vermeer, A. A. Mulder, K. Szuhai, J. Knijnenburg, J. M. Boer, R. Willemze, and C. P. Tensen
Oncogenomic analysis of mycosis fungoides reveals major differences with Sezary syndrome
Blood, January 1, 2009; 113(1): 127 - 136.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Contassot, K. Kerl, S. Roques, R. Shane, O. Gaide, M. Dupuis, A. H. Rook, and L. E. French
Resistance to FasL and tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis in Sezary syndrome T-cells associated with impaired death receptor and FLICE-inhibitory protein expression
Blood, May 1, 2008; 111(9): 4780 - 4787.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. B. Wallach-Dayan, R. Golan-Gerstl, and R. Breuer
Evasion of myofibroblasts from immune surveillance: A mechanism for tissue fibrosis
PNAS, December 18, 2007; 104(51): 20460 - 20465.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
K W Chan, P Y Lee, A K Y Lam, S Law, J Wong, and G Srivastava
Clinical relevance of Fas expression in oesophageal squamous cell carcinoma
J. Clin. Pathol., January 1, 2006; 59(1): 101 - 104.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. van Doorn, W. H. Zoutman, R. Dijkman, R. X. de Menezes, S. Commandeur, A. A. Mulder, P. A. van der Velden, M. H. Vermeer, R. Willemze, P. S. Yan, et al.
Epigenetic Profiling of Cutaneous T-Cell Lymphoma: Promoter Hypermethylation of Multiple Tumor Suppressor Genes Including BCL7a, PTPRG, and p73
J. Clin. Oncol., June 10, 2005; 23(17): 3886 - 3896.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. L. Piekarz, R. W. Robey, Z. Zhan, G. Kayastha, A. Sayah, A. H. Abdeldaim, S. Torrico, and S. E. Bates
T-cell lymphoma as a model for the use of histone deacetylase inhibitors in cancer therapy: impact of depsipeptide on molecular markers, therapeutic targets, and mechanisms of resistance
Blood, June 15, 2004; 103(12): 4636 - 4643.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. Girardi, P. W. Heald, and L. D. Wilson
The Pathogenesis of Mycosis Fungoides
N. Engl. J. Med., May 6, 2004; 350(19): 1978 - 1988.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Doorn, R.
Right arrow Articles by Tensen, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Doorn, R.
Right arrow Articles by Tensen, C. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online