| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Departments of Laboratory Medicine [E. Z., M. S. M.], Medicine [R. G., A. E., M. S. M.], and Pathology [M. D. W., M. S. M.], University of California, San Francisco, California 94110; Histology Laboratory, M. D. Anderson Cancer Center, Science Park, Smithville, Texas 78957 [N. W. A.]; SLIL Biomedical Corp., Menlo Park, California 94025 [L. K., J. R.]; School of Medicine, University of California, Davis, California 95616 [I. G.]; Department of Soft Tissue Pathology, Armed Forces Institute of Pathology, Washington, DC 20306 [C. M.]; and Department of Pathology, University of California, San Diego, California 92093 [B. G. H.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Direct and indirect evidence of a role for macrophages in multistep malignant transformation known as sequential pathogenesis is increasing (7
, 8)
. The largest epidemiology study of non-Hodgkins lymphoma to date showed that events that decreased antigen presentation/macrophage inflammation, such as nonsteroidal anti-inflammatory drug use, were significantly protective for lymphoma development (9)
. Nonsteroidal anti-inflammatory drugs block macrophage production of IL-63
and other inflammatory mediators implicated in tumorigenesis in experimental models (10)
. Malignant transformation in mice given i.p. injection with mineral oil was associated with high-level IL-6 production from macrophages, and indomethacin treatment was protective (10)
. Although IL-6 has traditionally been considered a differentiation factor for normal B cells, it has been implicated as both an autocrine and a paracrine growth factor in multiple myeloma and lymphoma (11
, 12)
. Molecular studies have identified a significant subset of large cell lymphomas with prominent fes-expressing macrophage populations (7
, 13)
. fes is a tyrosine protein kinase associated with malignant transformation in animal tumor systems (14)
. It is also an intracellular signal molecule communicating transmembrane signals in macrophages initiated by macrophage colony-stimulating factor, granulocyte macrophage colony-stimulating factor, and IL-3. Increased levels of the TH1 cytokine IFN-
from tumor-associated macrophages have been reported in a series of macrophage-rich lymphomas (15)
. Abundant IFN-
-induced monokine (mig) production by tumor-associated macrophages suggested an important role for that chemokine in interacting with CXCR3 present on lymphoma cells in another study (16)
.
One subtype of lymphoma that contains easily identifiable macrophages is PEL or BCBL (17, 18, 19) . These are a rare type of non-Hodgkins lymphoma that grow in the pleural, pericardial, or peritoneal cavities as lymphomatous effusions occurring predominantly, but not exclusively, in AIDS patients. Cytokine production from these tumors has been characterized. Macrophages from these tumors express high levels of inflammatory cytokines, such as IL-6 and IL-10, which have been implicated in lymphomagenesis (12 , 20) . While attempting to establish PEL in SCID mice, we discovered a potential model of murine lymphomagenesis consistent with the sequential pathogenesis model. This communication describes a series of experiments in which PEL material from different patients induced solid lymphomas in SCID mice. Although PELs represent a rare form of lymphoma, they were chosen for use in this study for a number of reasons. They are generally a rapidly fatal neoplasm that occurs almost exclusively in immunosuppressed individuals. An association with both EBV and KSHV infection has been established (17) , although herpes virus-negative PEL have been described (21) . Although the clinical presentation is unique, it is debatable whether the basic mechanisms underlying development of PEL and other forms of lymphoma are likely to be different. If mechanisms of lymphomagenesis are similar among all types of lymphomas, it is possible that because of multiple identifiable associated factors, PEL merely represents an accelerated form of lymphoma.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PEL Cell Culture.
Effusions were obtained from the abdominal or pleural cavity of two different HIV-infected patients with PEL by paracentesis. The effusions were centrifuged, the supernatant was collected, and the cells were percoll-separated. After washing, cells were either cultured overnight in RPMI 1640 + 10% fetal bovine serum and 10% cell-free effusion fluid as described previously (23
, 24) or frozen in 10% DMSO for future use. Frozen cells were rapidly thawed, resuspended, and injected directly without being cultured. To dislodge cultured cells from plastic flasks, media were removed and replaced with cold calcium and magnesium-free PBS (PBS). The flasks were placed on ice for 5 min, and the cells were scraped off with a tissue culture scraper. In the first experiments, plastic-adherent cells were compared with nonadherent cells in the same flask. In the second experiment, PEL cells were cultured in either Teflon vessels (23)
or plastic as described previously. In the second experiment, the adherent and nonadherent cell populations from the plastic culture flasks were combined for injection.
Control Macrophage Cultures.
To test whether normal human macrophages are associated with lymphomagenesis in SCID mice, primary human macrophage cultures were prepared from three different donors as described previously (24)
. Buffy coat preparations were obtained from the Stanford Blood Bank (Stanford, CA) and used within 24 h of being drawn. The 30-ml preparations were diluted with an equal volume of DPBS (Mediatech, Herndon, VA). Thirty ml of the diluted preparations were then placed into 50-ml conical tubes, and 14 ml of a percoll solution (1.087 g/cc) were pipetted underneath. The tubes were centrifuged at 1,800 rpm for 30 min. After centrifugation, the upper clear plasma layer was discarded. The buffy cell layer was collected with a pipette and transferred to a clean centrifuge tube, washed with DPBS, and centrifuged at 1,400 rpm for 10 min. The DPBS was aspirated off, and the cells were resuspended in medium and transferred into 150-mm glass Petri plates and incubated for 34 h at 37°C in a humidified CO2 incubator. The Petri plates were then washed two times with DPBS. The attached cells were scraped off the plates, centrifuged, resuspended, placed into T75 tissue culture flasks, and grown in a humidified CO2 incubator. Cells were cultured in a medium composed of 50% Myelocult medium (Stem Cell Technologies, Vancouver, British Columbia, Canada), 25% IMDM (Biowhitaker, Walkersville, MD) + 10% FCS supplemented with antibiotics and glutamine, 25% IMDM conditioned medium from HS27 human diploid fibroblasts (UCSF Cell Culture Facility, San Francisco, CA), 1 ng/ml IL-3, and 1 ng/ml macrophage colony-stimulating factor. For experiments, 1-month-old macrophages were scraped off the flasks in DPBS, and the cells were diluted to a concentration of 1,000,000 cells/ml.
Additionally, IC21, a mouse macrophage cell line (25) , was used to determine whether syngeneic proliferating macrophages were associated with lymphomagenesis in SCID mice. IC21 cells were obtained from Dr. Lonnie Kapp (SLIL Biomedical Corp., Menlo Park, CA) and grown in IMDM + 10% FCS supplemented with antibiotics and glutamine. For experiments, cells were trypsinized to remove them from the flasks, centrifuged, and resuspended in DPBS to a concentration of 1,000,000 cells/ml.
Murine Lymphoma Induction via Human Tumor Cell Inoculation.
For all mouse studies, 8-week-old SCID mice were obtained from Taconic (Germantown, NY) and housed at UCSF. All studies were performed with the approval of the UCSF Committee on Animal Research. Mice were acclimated for at least 1 week before starting the experiment. Because we had initially intended to transplant human tumors, all mice, including control animals, received i.p. injection with 0.1 ml of anti-asialo-GM1 antiserum (Wako Pure Chemical Industries, Ltd.) at least 24 h before i.p. inoculation with PEL cells. This method of antibody pretreatment has been demonstrated to increase tumor engraftment in other systems (26)
. Throughout the three tumor induction experiments, control animals received antibody only and did not receive cells or other injections beyond the antibody. In the first experiment, 107 cells cultured in plastic were injected into seven C.B-17-SCID mice. Three mice received cell-rich culture supernatant, and four mice received macrophage-enriched adherent material scraped off the cell culture flasks. In the second experiment, four ICR SCID mice received 107 cells cultured in plastic, four received 106 cells cultured in plastic, four received 107 cells cultured in Teflon, and three received 107 unseparated frozen cells. In the second experiment, there was no attempt to enrich the injected material for macrophages by adherence to plastic, and cell-rich supernatant and cells scraped off the plastic flasks were combined for injection into the mice. In the third experiment, frozen PEL cells were thawed and stained with anti-CD3 or anti-CD14 antibodies, and FACS-separated cells were injected into mice as in the first two experiments. Four C.B-17-SCID mice received 175,000 CD3+ cells, four mice received 175,000 CD14+ cells, and five mice received 6 x 106 cells prepared similarly and stained with CD3 and CD14, but not sorted. Individual mice died acutely without overt evidence of disease or were euthanized at the first sign of illness or at 6 months (experiments 1 and 2) or 4 months (experiment 3) PI. Postmortem exam was performed, and the following tissues were collected for histology and immunohistochemistry if available: liver, spleen, brain, bone, and any grossly abnormal tissue including thymic lymphomas. In mice that died acutely, autolysis often precluded gross or histological examination of spleens. Additionally, some splenic tissue was misinterpreted by the histology technician and discarded. One mouse was partially cannibalized by his cagemates, and only the liver was available for examination.
To test whether normal macrophages were associated with lymphomagenesis, human macrophages from the three different donors described above were injected into C.B-17-SCID mice (200,000 cells/mouse; 5 mice for donor 1 and 4 mice each for donors 2 and 3). Additionally, to determine whether syngeneic proliferating macrophages were associated with lymphomagenesis in SCID mice, 10 mice received 200,000 IC21 cells i.p. As was done for the mice in experiment 3, mice in the normal macrophage control experiment were observed for 4 months after cell injection and euthanized, and tissues were collected. Also included in this experiment were nine mice treated with antibody only as described above.
Cell Sorting.
CD14+ monocyte and CD3+ T-cell fractions were isolated from frozen pleural effusion PEL material via cell sorting. Cells were rapidly thawed, washed with calcium- and magnesium-free PBS, and stained for CD3 and CD14 markers following the standard protocols from package inserts specific for each antibody (Becton Dickinson). The antibody-labeled cells were then sorted on FACS Vantage (Becton Dickinson). A fraction of the sorted material was then phenotypically analyzed as described above before injection into mice. Mice received injection with antibody-labeled but not sorted PEL cells (starting material), CD3+ T-cell fraction, and CD14+ monocyte cell fraction.
Histology and Immunohistochemistry.
Tissues were fixed in neutral buffered formalin for paraffin embedding and histological examination after H&E staining. Sections from sternum and lumbar vertebrae were decalcified postfixation and then processed routinely for histological examination of bone marrow. Immunophenotyping with human- and murine-specific reagents was done by standard three-step immunohistochemical techniques (27)
using antibodies against CD20, CD3, CD45RO, and lysozyme (DAKO Corp). The CD20, CD45RO, and lysozyme antibodies are human specific and do not cross-react with mouse. The CD3 antibody cross-reacts with both human and mouse CD3.
PCR of Human and Murine Lymphomas.
DNA was extracted from PEL material and murine tissue using DNeasy tissue kit (Qiagen) for use in PCR detection of KSHV, EBV, HLA, and HIV gag sequences. Oligonucleotide primer sequences were as follows: (a) EBV 5' primer, AGAAGGGGAGCGTGTGTTGT; (b) EBV 3' primer, GGCTCGTTTTTGACGTCGGC; (c) HLA 5' primer, CAGGTGTAAACTTGTACCAG; (d) HLA 3' primer, CGGTAGCAGCGGTAGAGTTG; (e) HHV8 5' primer (KS 5'; Biosource International), AGCCGAAAGCATTCCACCT; (f) HHV8 3' primer (KS 3'; Biosource International), TCCGTGTTGTCTACGTCCAG; (g) HIV gag 5' primer (SK38; Biosource International), TAAATCCACCTATCCCAGTAGGAGAAA; (h) HIV gag 3' primer (SK39; Biosource International), TTTGGTCCTTGTCTTATGTCCAGAATG; (i) 5' mouse c-jun, 5'-CATGGAGTCTCAGGAGCGGATCA-3'; and (j) 3' mouse c-jun, 3'-GCAACTGCTGCGTTAGCATGAGT-5'. The PCR conditions were as follows: 1 cycle of 95°C for 3 min; 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min; and 1 cycle of 72°C for 10 min. We performed dilutional analysis studies that showed that the sensitivity of HLA PCR with these primers was 1:100 for detecting human DNA in murine tissue. Sensitivities for the viral primers were at least 1:1000 (17)
, wherein 1 infected cell would be detected within 1000 uninfected cells.
| RESULTS |
|---|
|
|
|---|
|
|
|
Identification of Human Macrophages in SCID Mouse Tumors.
Although the SCID mouse tumor cells consistently expressed CD3, the histological pattern was reminiscent of the "starry sky" pattern present in human Burketts lymphoma, where the tumors have significant numbers of macrophages. Tumors that arose in animals in these experiments were stained with human-specific anti-lysozyme antibody. Control tissues were stained as well. Fig. 2
shows examples of the immunohistological study.
|
Human Tumor-associated Macrophages but not T Cells Are Associated with SCID Mouse Tumor Induction.
The first two experiments demonstrated lymphoma induction in PEL cell-injected SCID mice. The induced tumors contained murine T cells and human macrophages. To test whether PEL macrophages would induce these SCID tumors, FACS-separated CD14 cells or CD3 cells were injected into SCID mice (Table 2)
. Cells previously frozen from the pleural effusion of the patient in experiment 2 were used. These cells were thawed, stained, sorted, and injected as described in "Materials and Methods." Flow cytometric analysis is displayed in Table 1
and Fig. 3
. The original frozen material contained 1.6% CD14+ cells and 45% CD3+ cells. The material sorted for CD3 contained 0.05% CD14+ cells and 94% CD3+ cells. The fraction sorted for CD14 contained 69% CD14+ cells and 6% CD3+ cells. Mice receiving human CD14+ cells, either alone or in mixed suspension, developed high-grade lymphoma. As shown in Table 2
, three of four mice receiving injection with the CD14+ fraction developed gross lymphomas. One of these mice was severely ill with widespread multicentric lymphoma involving peripheral lymph nodes in addition to liver, spleen, and bone marrow. None of the mice receiving injection with CD3 cells developed gross or histological evidence of lymphoma, although they did develop bilaterally symmetrical alopecia. Histopathology of affected skin was normal except for lack of hair in follicles.
|
|
| DISCUSSION |
|---|
|
|
|---|
Spontaneous thymic lymphomas occur in 315% of SCID mice (28
, 29)
. These low-grade tumors originate in the thymus, disseminate rarely (approximately 5%), and are generally incidental findings at necropsy (28)
. Leukemic bone marrow has not been described with spontaneous SCID mouse thymic lymphoma. In contrast to the spontaneous tumors observed in SCID mice, the human tumor cell-induced murine lymphomas were unique. The incidence of murine T-cell lymphomas in our mice was >50% in mice receiving injection with material containing human PEL-associated CD14+ cells. Thymic involvement as part of aggressive systemic disease was observed in only 11 of 20 tumor-bearing animals, suggesting that the tumors did not always originate in the thymus. Most of the tumor-bearing mice were overtly ill and died from lymphomatous complications or were euthanized for humane reasons. One mouse had evidence of disseminated intravascular coagulopathy, another had lymphomatous meningitis, and another had multicentric lymphoma with involvement of peripheral as well as central lymphoid tissue. Ten of 20 of the affected mice had leukemic pattern of bone marrow infiltration (Fig. 1A)
. Nineteen of 20 mice were <6 months of age at the identification of tumors. Control mice (3 of 44) developed infrequent lymphomas that were incidental findings at necropsy 46 months PI. Clearly, there is strong circumstantial evidence that inoculation of human macrophage-containing PEL played a crucial role in the fatal lymphomas that developed in these mice.
Macrophages are classically thought of as terminally differentiated cells without the ability to proliferate. There is a growing body of evidence that challenges this dogma. The concept of "proliferating macrophages" deserves discussion. Macrophages positive for PCNA were present in the original, cultured, and frozen PEL material used in these experiments. We have demonstrated abnormally high PCNA macrophage expression in peripheral blood of patients with refractory HIV-associated lymphoma (31) . In vitro sensitivity to macrophage-targeted therapy is associated with in vivo response in these patients. Abnormal activated and/or proliferating macrophages may be important in other disease states as well. For example, we have described abnormal macrophages in patients with AIDS dementia (32) . A series of very elegant experiments involving various human and animal nephropathies has very clearly demonstrated a role for proliferating macrophages in the progression of those diseases (33, 34, 35, 36) . Langerhans cell histiocytosis is a disease characterized by the accumulation of a locally proliferating clonal population of macrophage-derived cells (37) . The importance of recognizing and studying this cell lies in the potential to directly affect and potentially reverse a wide variety of chronically progressive diseases.
Most tumors in animals contain substantial numbers of mononuclear phagocytes. Determining what role these cells have in these tumors may be key to our understanding of the biology of neoplasia. Whether these cells play a role in actual tumor induction, accelerate or support a preexisting propensity for neoplasia, or simply come in secondarily is uncertain. It is not surprising that macrophages were observed in the tumors that developed in these mice. However, the strong association between human macrophages and these tumors is notable and supports a direct or indirect inductive or supportive role for macrophages in these tumors. The role may be a simple activation of endogenous retroviral elements, complicated dysregulated immunopathology, novel viral infection, or any of a number of other possibilities. Although some of these lysozyme-positive cells could represent murine macrophages that had engulfed human lysozyme, especially in the spleens, the pervasive presence of human lysozyme-positive cells in anaplastic thymic lymphomas 4 months after i.p. injection supports the idea of long-lived, tumor-promoting, human macrophages.
Immunodeficiency-associated lymphoproliferations are often polyclonal when critically evaluated. This polyclonality was defined by multiple studies as a process having fewer than 5% of a clonal B cell present within a histologically defined lymphoma section (38 , 39) . Molecular studies on HIV-associated polyclonal lymphomas using an inverse PCR technique identified clonal HIV in a subset of these lesions (14) , and cell sorter analysis demonstrated that the clonal form of HIV was present in tumor-associated macrophages (7 , 13) . Additional observations including the experiments described here have lead to and supported the "sequential neoplasia" model wherein a clonal macrophage would drive early stages of tumorigenesis, with sequential evolution of an independent tumor (40) . This model could hold great promise in changing the current approach to treatment of AIDS-associated lymphoma and potentially lymphoma in general.
In the most general form, the "sequential pathogenesis" model of disease is initiated by macrophages that provide an environment for evolution of a specific disease (7) . In this study, animals receiving injection with human cells developed murine lymphomas, indicating that tumors were induced rather than transplanted. These data and our previous work demonstrating clonal HIV in a subset of lymphoma-associated macrophages suggest that macrophages are likely candidates for stimulation of lymphomagenesis. The process of sequential pathogenesis is believed to be initiated by events causing macrophage proliferation. In the case of HIV, that event could be the clonal integration of HIV near a gene that promotes cellular proliferation (7 , 13 , 14) . In an immunosuppressed state, normal immune function is disrupted, and the complex network of soluble factors may be misregulated. Through inappropriate or uncontrolled elaboration of growth factors, secondary cell proliferation occurs, and secondary events occurring in these cells can lead to an outgrowth of frank malignant neoplasia. The current study provides experimental support of the sequential pathogenesis theory. We and others have demonstrated lymphostimulatory products produced by tumor-associated macrophages, including PEL-associated macrophages, that provide one possible explanation of how macrophages may support lymphoma growth (10 , 12 , 13 , 15 , 16) . Work is under way to more clearly define how these abnormal macrophages support lymphoma development in these mice and humans.
| FOOTNOTES |
|---|
1 Supported by Grants R01-CA67381 (to M.S.M.), the AIDS and Cancer Specimen Resource (NCI) Grant U01-CA66529 (to M.S.M.), MH59037 (BH), and (NIAID) Grant K11 AI01221 (to E.Z.) from the NIH. ![]()
2 To whom requests for reprints should be addressed, at San Francisco General Hospital, Building 80, Ward 84, 1001 Potrero Avenue, San Francisco, CA 94110. Phone: (415) 206-5268; Fax: (415) 206-3765; E-mail: MMcgrath{at}php.ucsf.edu ![]()
3 The abbreviations used are: IL, interleukin; SCID, severe combined immunodeficient; PEL, primary effusion lymphoma; UCSF, University of California San Francisco; BCBL, body cavity-based lymphoma; KSHV, Kaposis sarcoma-associated herpes virus; PCNA, proliferating cell nuclear antigen; DPBS, Dulbeccos PBS; IMDM, Iscoves modified Dulbeccos medium; PI, postinjection; FACS, fluorescence-activated cell-sorting. ![]()
Received 2/ 5/01. Accepted 7/31/02.
| REFERENCES |
|---|
|
|
|---|
-interferon may play a role in the histopathogenesis of peripheral T-cell lymphoma. Cancer Res., 50: 8028-8033, 1990.This article has been cited by other articles:
![]() |
W. Wu, J. Vieira, N. Fiore, P. Banerjee, M. Sieburg, R. Rochford, W. Harrington Jr, and G. Feuer KSHV/HHV-8 infection of human hematopoietic progenitor (CD34+) cells: persistence of infection during hematopoiesis in vitro and in vivo Blood, July 1, 2006; 108(1): 141 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Narvaez, R. L. Gascon, R. Zhang, L. Kaplan, and M. S. McGrath Evidence for Disease Specific Immunophenotypic Abnormalities in Blood from Patients with Mantle Cell Lymphoma. Blood (ASH Annual Meeting Abstracts), November 16, 2005; 106(11): 4684 - 4684. [Abstract] |
||||
![]() |
M. J. Jakubiak, C. T. Siedlecki, E. Zenger, M. L. Matteucci, K. A. Bruskiewicz, D. A. Rohn, and P. J. Bergman Laryngeal, Laryngotracheal, and Tracheal Masses in Cats: 27 Cases (1998-2003) J. Am. Anim. Hosp. Assoc., September 1, 2005; 41(5): 310 - 316. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Staudt, Y. Kanan, J. H. Jeong, J. F. Papin, R. Hines-Boykin, and D. P. Dittmer The Tumor Microenvironment Controls Primary Effusion Lymphoma Growth in Vivo Cancer Res., July 15, 2004; 64(14): 4790 - 4799. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |