| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Medical Genetics, University of Alberta, Edmonton, Alberta, T6G 2H7 Canada [D. W., J. L. S., M. J. S., S. E. A.], and Department of Medical Genetics, Alberta Childrens Hospital, Calgary, Alberta, T2T 5C7 Canada [R. M., G. G., K. B.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
An association does exist between loss of MMR in some human lymphomas and leukemias (4, 5, 6, 7, 8, 9, 10) . Although the development of lymphoma in human HNPCC kindreds is not common, it has been observed in the HNPCC variant Muir-Torre syndrome and in Turcots syndrome with MMR mutations (11 , 12) . One patient with a dominant negative mutation in PMS2 presented with early-onset non-Hodgkins lymphoma, further strengthening the connection between MMR gene mutations and the path to hematological malignancy (13) .
Most recently, three HNPCC families have been reported with consanguinity resulting in homozygosity of two inherited MLH1 mutant alleles predicted to result in a lack of MMR activity (14, 15, 16) . Notably, five homozygous children in two of the families developed leukemia or lymphoma. The homozygous offspring in all families also were diagnosed with NF-1 with no family history of the disorder. The other published example of constitutional loss of MMR is a heterozygous MLH1 mutation (13) . However, this mutation is proposed to have dominant negative activity and may have had additional effects on the cell besides inactivating MMR.
Here we report a fourth example of inherited homozygous deficiency of MMR. A novel MSH2 mutation that results in exon skipping and lack of MSH2 protein was inherited by a child presenting with ALL and features of NF-1. This individual case therefore suggests that it is the general lack of MMR from conception that underlies hematological malignancy in the rare MMR-deficient individuals and that the occurrence of sporadic NF-1 in these individuals may also be associated with a constitutive lack of MMR.
| Materials and Methods |
|---|
|
|
|---|
DNA Analysis.
Genomic DNA was isolated from peripheral blood using standard phenol chloroform extraction and precipitation with 4 M ammonium acetate and isopropanol. DNA was dissolved in low TE buffer [10 mM Tris and 1 mM EDTA (pH 8.0)]. Exonic and intronic sequences flanking each MSH2 exon were amplified by PCR using primers and conditions as described previously.4
PCR products were sequenced by 33P cycle sequencing (thermosequenase radiolabeled terminator cycle sequencing kit; United States Biochemical). Sequencing reactions were run on 6% polyacrylamide gels.
Semiquantitative PCR was carried out with primers from the MSH2, ATRX, and CF genes using 8 ng of template and the following primers: (a) MSH2 Ex11F, CATTGCTTCTAGTACATTT; (b) MSH2 Ex11R, CAGGTGACATTCAGAACATTA; (c) ATRX Di, GGATTATGAGGTATTTCATGTCT; (d) ATRX DRi, CTCAAAGGCCTGGTATATGG; (e) M1101KF, CAACACTGCGCTGGTTCCATA; and (f) M1101KR, ATAACCTATAGAATGCAGCA. PCR conditions for all reactions were 95°C 5 min; (95°C 45 s, 60°C 45 s, 72°C 45 s) 26, 27, 28 and 29 cycles; 72°C 2 min. Samples were run on an Applied Biosystems Prism 377 automated sequencer.
Microsatellites D2S123, BAT26, BAT25, D5S346, and D17S250 were amplified using previously published primers (IRD700 labeled) and conditions (17) . PCR products were run on a Licor automated sequencer. The causative CAG repeat and adjacent 3' polymorphic CCG repeat within the Huntington disease gene (IT-15) were amplified using primers and conditions published previously (18) labeled with 4,7,2',7'-tetrachloro-6-carboxyfluorescein. PCR was performed using 5 cycles of 99.9°C for 5 s, 55°C for 30 s, and 72°C for 1 min; 30 cycles of 99.9°C for 3 s, 55°C for 30 s, and 72°C for 1 min; and 72°C for 10 min. The CGG repeat in the 5'-untranslated region of the FMR-1 gene was amplified (19) using primers labeled with 4,7,2',7'-tetrachloro-6-carboxyfluorescein. Amplified products were analyzed on an Applied Biosystems 310 Genetic Analyzer with GS500 size standard (Applied Biosystems) and GeneScan and GenoTyper analysis software (Applied Biosystems). The TG variable repeat in tandem with a poly(T) tract from the cystic fibrosis transmembrane conductance regulator gene (CFTR) exon 9 (20) was analyzed using a multiplex Amplification Refractory Mutation System approach using primers and PCR conditions described elsewhere.5
RNA and Immunoblotting.
RNA and total protein extracts were isolated from a lymphoblastoid cell line established from the patient, and cDNA was generated using the SuperScript First Strand Synthesis System for reverse transcription-PCR (Life Technologies, Inc.) according to the manufacturers instructions. Primers within exon 10 (5'-TATTACTTTCGTGTAACCTG-3') and exon 12 (5'-ACAGGTGCTCCATTTGACACG-3') were used to amplify across the predicted splice junction using the following PCR conditions: 95°C for 3 min; 10 cycles of 95°C for 30 s, 65°C for 30 s, and 72°C for 30 s; 39 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and 72°C for 1 min. The PCR product was sequenced.
Whole cell lysates were resolved by discontinuous 8% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Proteins were detected using the following antibodies: (a) purified mouse antihuman MSH2 monoclonal antibody (PharMingen); (b) purified mouse antihuman PMS2 monoclonal antibody (PharMingen); and (c) horseradish peroxidase-conjugated secondary antibody (goat antimouse; BD Biosciences). Antibody binding was visualized using enhanced chemiluminescence (NEN Western Blot Chemiluminescence Reagent Plus Kit; Life Science Product).
| Results and Discussion |
|---|
|
|
|---|
|
|
|
|
Because MSH2 is the key MMR protein required for recognition of a DNA mismatch and subsequent repair, the proband is predicted to completely lack any MMR activity. The heterozygous parents are at risk of developing HNPCC and require counseling and screening. The young age of the parents and grandparents or an occult malignancy may explain the lack of observed cancer in this pedigree at the time of ascertainment. Environmental factors play an important role in loss of the wild-type allele and in risk of tumor development in HNPCC carriers, therefore the diet and/or lifestyle of this particular family may be protective of the occurrence of such a mutational event. The family will be followed closely for development of malignancies.
A lack of MMR in neoplastic cells is associated with instability at repetitive DNA sequences. We used microsatellite markers BAT26, BAT25, D5S346, D2S123, and D17S250 as well as a TG variable repeat in tandem with a poly(T) tract at the splice acceptor site of the cystic fibrosis transmembrane conductance regulator gene (CFTR) exon 9 to test instability in lymphocyte DNA from the MMR-deficient patient. Interestingly, and in contrast to other MLH1 homozygotes (14 , 16) , no instabilities were observed in the proband (data not shown). However, because leukemic cells cannot be tested alone for MSI, we cannot exclude the fact that MSI may be present in tumorigenic cells from this patient. However, this is consistent with the results from MSH2-deficient mice, in which instability was seen in thymic lymphomas but not in the adjacent normal tissue (21) . Trinucleotide repeats can also be unstable; therefore, we determined the trinucleotide repeat length for the Huntington disease and fragile X repeats in the proband. No instability was seen in the MMR-deficient proband (data not shown), supporting other evidence that MMR does not play a role in expansion of trinucleotide repeats (22) .
The role of MSH2 in hematological malignancy is not clear. It is possible that genes involved in T- and B-cell development contain targets for mutation that remain unrepaired in the absence of MMR. Several such genes (such as TGFßRII, IGFRII, BAX, and PTEN) have successfully been identified in HNPCC colon tumors (23) . These genes contain mononucleotide repeats within coding regions that result in a truncated, nonfunctional protein after polymerase frameshift errors remain uncorrected in the absence of MMR. Alternatively, a role for MSH2 in signaling apoptosis has recently been suggested (24 , 25) , and lack of MSH2 may hinder initiation of cell death pathways and contribute to neoplasia.
Mouse models for MMR deficiency have been generated (26) . More than two thirds of the Msh2-/- mice succumb to thymic lymphomas, with 50% of the colony developing tumors by 5 months of age (27) . The development of hematological malignancy in MMR-deficient individuals, similar to that seen in the homozygous knockout mouse, suggests that the mouse may be an excellent model to study human lymphomagenesis.
We describe the fourth known example of MMR deficiency in a homozygous state that is associated with hematological malignancy and multiple café-au-lait spots. We suspect that the proband may develop other features that allow the clinical diagnosis of NF-1 to be confirmed in the future. If so, our patients phenotype would support previous claims that lack of MMR and the development of NF-1 are likely a consequence of the mutator phenotype in the absence of MMR. This is the first patient described with a complete loss of MSH2. This case demonstrates that hematological malignancy can arise in the absence of MLH1 and MSH2 and is therefore likely a consequence of the lack of activity of the MMR complex rather than due to specific individual roles of MLH1 or MSH2.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by Alberta Heritage Foundation for Medical Research (AHFMR), the Leukemia Research Fund of Canada, and CIHR (S. E. A.). S. E. A. is an AHFMR, Canadian Institutes of Health Research (CIHR), and a Canadian Genetic Diseases Network (CGDN) Network Scholar. ![]()
2 To whom requests for reprints should be addressed, at 833 Medical Sciences Building, University of Alberta, Edmonton, Alberta, T6G 2H7 Canada. Phone: (780) 492-1127; Fax: (780) 492-1998; E-mail: susan.andrew{at}ualberta.ca ![]()
3 The abbreviations used are: MMR, mismatch repair; HNPCC, hereditary nonpolyposis colorectal cancer; NF-1, neurofibromatosis type 1; ALL, acute lymphocytic leukemia; MSI, microsatellite instability. ![]()
4 www.hgu.mrc.uk/Users/Malcolm.Dunlop/MMRprim.htm. ![]()
5 M. J. Somerville, A. V. Ng, S. M. Hasse, M. Hicks, K. A. Sprysak, B. G. Elyas, R. Tomaszewski, L. M. Vicen-Wyhony. High throughput screening of both components of the CFTR intron 8 polyvariant locus, manuscript in preparation. ![]()
Received 7/ 9/01. Accepted 11/30/01.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. T. Russo, G. De Luca, I. Casorelli, P. Degan, S. Molatore, F. Barone, F. Mazzei, T. Pannellini, P. Musiani, and M. Bignami Role of MUTYH and MSH2 in the Control of Oxidative DNA Damage, Genetic Instability, and Tumorigenesis Cancer Res., May 15, 2009; 69(10): 4372 - 4379. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Peron, A. Metin, P. Gardes, M.-A. Alyanakian, E. Sheridan, C. P. Kratz, A. Fischer, and A. Durandy Human PMS2 deficiency is associated with impaired immunoglobulin class switch recombination J. Exp. Med., October 27, 2008; 205(11): 2465 - 2472. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Feitsma, R. V. Kuiper, J. Korving, I. J. Nijman, and E. Cuppen Zebrafish with Mutations in Mismatch Repair Genes Develop Neurofibromas and Other Tumors Cancer Res., July 1, 2008; 68(13): 5059 - 5066. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. van Boxtel, P. W. Toonen, H. S. van Roekel, M. Verheul, B. M. G. Smits, J. Korving, A. de Bruin, and E. Cuppen Lack of DNA mismatch repair protein MSH6 in the rat results in hereditary non-polyposis colorectal cancer-like tumorigenesis Carcinogenesis, June 1, 2008; 29(6): 1290 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kenyon and S. L. Gerson The role of DNA damage repair in aging of adult stem cells Nucleic Acids Res., December 26, 2007; (2007) gkm1064v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Barwell, L Pangon, S Hodgson, A Georgiou, I Kesterton, T Slade, M Taylor, S J Payne, H Brinkman, J Smythe, et al. Biallelic mutation of MSH2 in primary human cells is associated with sensitivity to irradiation and altered RAD51 foci kinetics J. Med. Genet., August 1, 2007; 44(8): 516 - 520. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H Scott, T. Homfray, N. L Huxter, S. G Mitton, R. Nash, M. N Potter, D. Lancaster, and N. Rahman Familial T-cell non-Hodgkin lymphoma caused by biallelic MSH2 mutations J. Med. Genet., July 1, 2007; 44(7): e83 - e83. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Peron, Q. Pan-Hammarstrom, K. Imai, L. Du, N. Taubenheim, O. Sanal, L. Marodi, A. Bergelin-Besancon, M. Benkerrou, J.-P. de Villartay, et al. A primary immunodeficiency characterized by defective immunoglobulin class switch recombination and impaired DNA repair J. Exp. Med., May 14, 2007; 204(5): 1207 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rahman and R. H. Scott Cancer genes associated with phenotypes in monoallelic and biallelic mutation carriers: new lessons from old players Hum. Mol. Genet., April 15, 2007; 16(R1): R60 - R66. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Chao and S. M. Lipkin Molecular models for the tissue specificity of DNA mismatch repair-deficient carcinogenesis Nucleic Acids Res., February 6, 2006; 34(3): 840 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gill, N. M. Lindor, L. J. Burgart, R. Smalley, O. Leontovich, A. J. French, R. M. Goldberg, D. J. Sargent, J. R. Jass, J. L. Hopper, et al. Isolated Loss of PMS2 Expression in Colorectal Cancers: Frequency, Patient Age, and Familial Aggregation Clin. Cancer Res., September 15, 2005; 11(18): 6466 - 6471. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Hegde, B. Chong, M. E. Blazo, L. H. E. Chin, P. A. Ward, M. M. Chintagumpala, J. Y. Kim, S. E. Plon, and C. S. Richards A Homozygous Mutation in MSH6 Causes Turcot Syndrome Clin. Cancer Res., July 1, 2005; 11(13): 4689 - 4693. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Offman, K. Gascoigne, F. Bristow, P. Macpherson, M. Bignami, I. Casorelli, G. Leone, L. Pagano, S. Sica, O. Halil, et al. Repeated Sequences in CASPASE-5 and FANCD2 but not NF1 Are Targets for Mutation in Microsatellite-Unstable Acute Leukemia/Myelodysplastic Syndrome Mol. Cancer Res., May 1, 2005; 3(5): 251 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Campbell, P. N. Nation, and S. E. Andrew A Lack of DNA Mismatch Repair on an Athymic Murine Background Predisposes to Hematologic Malignancy Cancer Res., April 1, 2005; 65(7): 2626 - 2635. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Velangi, E. C. Matheson, G. J. Morgan, G. H. Jackson, P. R. Taylor, A. G. Hall, and J. A.E. Irving DNA mismatch repair pathway defects in the pathogenesis and evolution of myeloma Carcinogenesis, October 1, 2004; 25(10): 1795 - 1803. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Young, K. J. Thulien, M. R. Campbell, V. A. Tron, and S. E. Andrew DNA mismatch repair proteins promote apoptosis and suppress tumorigenesis in response to UVB irradiation: an in vivo study Carcinogenesis, October 1, 2004; 25(10): 1821 - 1827. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Nichols, J. A. Heath, D. Friedman, J. A. Biegel, A. Ganguly, P. Mauch, and L. Diller TP53, BRCA1, and BRCA2 Tumor Suppressor Genes Are Not Commonly Mutated in Survivors of Hodgkin's Disease With Second Primary Neoplasms J. Clin. Oncol., December 15, 2003; 21(24): 4505 - 4509. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Reese, L. Liu, and S. L. Gerson Repopulating defect of mismatch repair-deficient hematopoietic stem cells Blood, September 1, 2003; 102(5): 1626 - 1633. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |