Cancer Research Meeting Calendar  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neef, R.
Right arrow Articles by Johnson, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neef, R.
Right arrow Articles by Johnson, J. P.
[Cancer Research 62, 5920-5929, October 15, 2002]
© 2002 American Association for Cancer Research


Tumor Biology

Identification of the Human PHLDA1/TDAG51 Gene

Down-Regulation in Metastatic Melanoma Contributes to Apoptosis Resistance and Growth Deregulation1

Rüdiger Neef, Martina A. Kuske, Elma Pröls and Judith P. Johnson2

Institute for Immunology, Ludwig Maximilians University of Munich, Munich, Germany 80336


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To identify molecules involved in the progression of human melanoma to metastatic disease, autologous primary and metastatic melanoma cells were compared by differential mRNA display. One cDNA, expressed in primary but not in autologous metastatic cells in three different patients, was cloned and characterized, and shown to be the human homologue of the inducible, immediate early TDAG51/PHLDA1 (pleckstrin-homology-like domain family A, member1) gene. Monoclonal antibodies produced against the PHLDA1 protein revealed homogeneous strong expression by benign melanocytic nevi, and progressively reduced expression in primary and metastatic melanomas in vivo. Analysis of stable cDNA transfectants in two different cell lines revealed that constitutive PHLDA1 expression is associated with reduced cell growth, cloning efficiency, and colony formation but not with alterations in cell cycle parameters. However, PHLDA1 expression was associated with increased basal apoptosis as assessed by live cell annexin V binding, terminal deoxynucleotidyltransferase-dependent nucleotide incorporation, and with increased cleavage of poly(ADP-ribose) polymerase and caspase-9. Constitutive PHLDA1 expression greatly enhances the sensitivity of human melanoma cells to the chemotherapeutic agents doxorubicin and camptothecin. These results suggest that PHLDA1 is constitutively expressed by melanocytic nevi where it may contribute to their benign phenotype. The progressive loss of PHLDA1 expression in melanomas may play a role in deregulated cell growth and apoptosis resistance in these tumors.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The progression of human tumors to systemic, metastatic disease is responsible for the majority of cancer-associated morbidity and mortality. The identification of molecules contributing to this process can lead to an understanding of critical pathways involved as well as to potential targets for therapeutic intervention (1) . Malignant melanoma is a rapidly metastasizing, therapy-resistant tumor, which is increasing in incidence (2 , 3) . Because of their pigmented nature and epidermal location, a variety of benign and malignant melanocytic lesions have been identified and ordered into a scheme of distinct stages, which is proposed to reflect the development and progression of malignant melanoma (4 , 5) . Despite extensive histopathological and clinical analyses, the changes in gene expression and subsequent functional consequences that characterize these stages are only beginning to be defined. Different approaches have been used to identify changes in gene expression during melanoma development. Comparison of melanocytic protein expression in different stages has led to the identification of several molecules, which appear to play a role in the progression of this tumor in in vivo models. These include ß3 integrin (6 , 7) and the cell adhesion molecule MCAM/MUC18 (8, 9, 10) , which are up-regulated or induced during melanoma development. Comparison of gene expression between human melanoma cell lines selected for high and low metastatic behavior in immune-deficient mice has also led to the identification of molecules up-regulated in metastatic cells in vivo, for example the cell adhesion molecule ALCAM (11) , melanoma inhibitory activity (12) , and the GTPase RhoC (13) . The comparison of gene expression between syngeneic benign and malignant murine melanocytic cells has led to the identification of genes such as annexin-VI that are also differentially expressed in human melanocytic lesions in vivo (14) . In the study reported here, gene expression in cells derived from primary and metastatic lesions of the same patient has been compared using mRNA differential display (15) . This approach has led to the identification of the human homologue of the TDAG51/PHLDA13 gene (16) . The expression of this gene was down-regulated in metastatic as compared with primary melanoma cells in three different patients. PHLDA1/TDAG51, identified previously in murine T lymphocytes where it is required for activation induced cell death (17) , is here shown to be expressed in human benign melanocytic nevi and to be progressively down-regulated in primary and metastatic melanomas. Analysis of cDNA transfectants indicates that constitutive PHLDA1 expression in melanocytic cells is associated with increased apoptosis sensitivity and with reduced growth. These results suggest that changes in the expression of PHLDA1 in melanocytic cells may contribute to the progression of malignant melanomas.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Tissues
Cell lines were obtained from the ATCC (Manassas, VA), established in our laboratory or obtained through exchange. The autologous cell lines GT-BS and GU-BSA were established from a primary nodular melanoma and a lymph node metastasis, respectively (18) , and were kindly provided by Monika Vetterlein, Institute for Tumor Biology and Cancer Research, University of Vienna, Vienna, Austria. WM-115 and WM-266-4 were obtained from ATCC, and IgR37 and IgR39 from Stefan Carrell (deceased); Swiss Institute for Experimental Cancer Research, ISREC, Epalinges, Switzerland. All of the cells were maintained in RPMI 1640 with 5–10% FCS, 1 mM sodium pyruvate, and antibiotics. Cells were stimulated with 10 ng/ml PMA (Sigma Chemical Co.) for 24 h, or exposed to 2 µg/ml camptothecin (Sigma) or 1 µg/ml doxorubicin (Sigma) for the indicated times.

Tissue specimens and histological diagnoses were obtained from the Dermatology Departments of the University of Hamburg (Hamburg, Germany), the University of Munich, and the Technical University of Munich (Munich, Germany). Tissue specimens were frozen in liquid nitrogen shortly after removal and stored at -80°C.

Differential Display and Isolation of Full-Length P7 cDNA
Total RNA was extracted from GT-BS and GU-BSA cells using RNAzol (Wacker Chemie, Munich, Germany). Using the RNAmap kit (GenHunter, Nashville, TN), 0.2 µg of total RNA was reverse transcribed with the oligodeoxythymidylic acid primers T12MA, T12MC, or T12MG and subsequently amplified by PCR combining each of the three different T12MM primers with the five arbitrary primers AP-1 (5'-AGCCAGCGAA-3'), AP-2 (5'-GACCGCTTGT-3'), AP-3 (5'-AGGTGACCGT-3'), AP-4 (5'-GGTACTCCAC-3'), and AP-5 (5'-GTTGCGATCC-3'). Three independent reverse transcription and PCR reactions were performed and the [33P]ATP-labeled amplification products separated on a 6% denaturing polyacrylamide gel. Differentially amplified PCR products were cut out from the dried gel, reamplified, and cloned into the pCRII vector (Invitrogen, Groningen, Netherlands). The 350-bp P7 differential display fragment was used to screen a melanoma (Mel JuSo) cDNA library in {lambda} ZAP (Ref. 8 ; Stratagene, La Jolla, CA), and two overlapping clones of 3.0 and 2.7 kb were isolated. Neither clone contained an open reading frame, although the 3.0 kb clone contained a polyadenylic acid tail at the 3' end, suggesting that they were not full length in the 5' region. Application of the 5' rapid amplification of cDNA ends System (Invitrogen Life Technologies, Inc.) using the P7-specific primer 5'-CCAAGATTAGGAATTACTACG-3' and anchor primers with reverse-transcribed (P7-specific primer 5'- GCAGCCTGGACAGGAGTAC-3') RNA isolated from Mel JuSo melanoma cells generated a 700-bp fragment containing an open reading frame that overlapped with the cDNA clone GenBank Z50194, coding for a proline, histidine-rich protein from fetal liver.

For RT-PCR analysis, total RNA was treated with DNaseI and reverse transcribed with oligo(dT)12–18 and SuperScript RNase H- reverse transcriptase (Invitrogen and Life Technologies, Inc.). The following primers were used for the RT-PCR analysis of PHLDA1 expression: 5'CCAGGACAGATGCTACTTGG 3' and 5'-GACTACATAACCTAGCAGTGG 3'. For Northern blot analysis, 10 µg of total RNA was separated in formaldehyde containing agarose gels, transferred to Nylon membranes (Hybond N+; Amersham Bioscience, Uppsala, Sweden), and hybridized with a 32P random-labeled probe corresponding to the first 1.1 kb of the PHLDA1 gene.

Immunohistochemistry, Immunofluorescence, and Antigen Competition
Tissue sections were blocked with 100 µg/ml heat aggregated human IgG, and stained with an indirect immunoperoxidase method using a biotinylated second antibody (Zymed, South San Francisco, CA) and streptavidin-peroxidase complex (Roche Biochemicals, Mannheim, Germany) together with 3-amino-9-ethyl-carbazole [0.25 mg/ml in 0.1 M acetate buffer (pH 4.9)] + 0.003% H2O2 as substrate. Serial sections were stained with antimelanoma proteoglycan antibody (G7A5, IgG1; Immunotech, Marseille, France) to localize the melanocytic cells, anti-CD45 (GAP 8.3; ATCC; IgG2a) to localize leukocytes, and appropriate isotype controls (11-4-1, IgG2a anti-H-2 obtained from Gunther Hammerling, German Cancer Center, Heidelberg, Germany; FR4H12 IgG1, directed against CD66c produced in our laboratory). Staining was evaluated semiquantitatively, and the fraction of PHLDA1-positive melanoma/nevus cells as well as the intensity of staining was estimated by comparison of RN-6E2 with the antiproteoglycan staining.

Intracytoplasmic immunofluorescence was performed using the Fix and Perm Kit (Caltag Laboratories, Burlingame, CA), and FITC-antimouse immunoglobulin (Dako, Copenhagen, Denmark).

The specificity of RN-6E2 binding was determined by a 1-h preincubation of sections or cells with 1.25–1.4 mg/ml PHLDA1-GST or cMCAM-GST recombinant protein before the addition of RN-6E2 antibody. Recombinant GST proteins were produced using pGEX expression vectors (Amersham Bioscience) in Escherichia coli BL21-Codon Plus-RP (Stratagene, La Jolla, CA) and purified on glutathione Sepharose according to the manufacturer’s recommendations

Western Blotting
Fifty to 100 µg protein from total cell lysates per lane were separated on 10% reducing SDS-PAGE and transferred to nitrocellulose membranes (BA85; Schleicher & Schüll, Dassel, Germany). The filters were blocked in 5% dried milk in PBS, stained with anti PHLDA1 antibodies, anticleaved caspase 9 (1:500; Cell Signaling, Beverly, MA), or anticleaved PARP (1:1000; Cell Signaling), and peroxidase-coupled second antibodies (Dako), and bound enzyme activity detected with a chemiluminescence substrate (ECL; Amersham Bioscience). Goat antiserum against human TDAG51/PHLDA1 was obtained from Santa Cruz Laboratories (L-19; Santa Cruz, CA), and monoclonal antibody RN-6E2 (IgG2a) directed against the human PHLDA1 molecule was produced in our laboratory. To control for loading and transfer the filters were stripped [0.1 M glycine (pH 2.9), 2 x 20 min] and reprobed with antiactin antibody (A5441, IgG1; Sigma).

Apoptosis Assays, Cell Cycle Analysis
Apoptosis was assessed by annexin V binding in the presence of propidium iodide to distinguish living and dead cells, and by TdT-dependent dUTP incorporation (TUNEL). Assessment of apoptosis was performed on cells that were ~70% confluent. Binding of FITC-annexin V was performed according to the manufacturer’s instructions (Apoptosis Detection kit; BD PharMingen, San Diego, CA). TUNEL assays were performed using the In Situ Cell Death Detection Kit (Roche Biochemicals). Cells were incubated with FITC-dUTP with and without TdT. FITC incorporation in the absence of TdT served as background control for each cell line. Stained cells were analyzed by flow cytometry (FACscan; Becton Dickinson) and Cell Quest software.

Cells were harvested for cell cycle analysis at various times after plating of 300,000 cells/6-mm tissue culture well. The cells were washed in 0.1% glucose in PBS, adjusted to 1 x 106/ml, and fixed in 70% ethanol for at least 48 h (19) .

Fixed cells were resuspended in 0.1% glucose containing 50 µg/ml propidium iodide and 100 µg/ml RNase for 30 min, and analyzed by flow cytometry (FACscalibur; Becton Dickinson). Cell cycle parameters were obtained using curve fitting analysis with the ModFit program (Verity Software, Inc., Topsham, ME).

Transfectants
The 293 kidney epithelial cell line and the melanoma cell line Mel Rif were transfected with a PHLDA1 expression plasmid in pcDNA3 or with the neomycin resistance gene, using Fugene 6 (Roche Molecular Biochemicals; 1 µg plasmid DNA/3 µl Fugene 6) according to the manufacturer’s instructions. The PHLDA1 expression plasmid was constructed from two cDNA clones isolated from a fetal liver cDNA library (5' region; clones Z50194-3 and Z50194-1, kindly provided by Willy A. Flegel, Department of Transfusion Medicine, University of Ulm, Ulm, Germany) and a 2.7 kb cDNA clone isolated from a melanoma cDNA library (3' region). The PHLDA1 insert is 4.5 kb long and begins on the reverse strand of chromosome 12 with bp 74026201.4 It contains two potential ATG start codons, bp 74026036 and bp 74025613, although the second ATG appears to be used in the transfectants and in all of the cell lines examined (data not shown). Transfectants were selected with G418 (1 mg/ml; Sigma) and cloned by limiting dilution. Two independent neo and four independent PHLDA1 transfectants were generated in each cell line. PHLDA1 expression was assessed by immunofluorescence and by Western blotting.

Cell Growth Assays
Growth Assays.
Five x 103 cells/well were seeded in quadruplicate in 96-well flat-bottomed tissue culture plates and cultured for 6 days. MTT (Sigma) live cell ELISAs (20) were performed each day (days 0–6). Briefly MTT (1 mg/ml) was added to the wells and incubated for 4 h at 37°C, the cells were lysed with 7.5% SDS and 7.5 mM HCl overnight, and the plates read in an ELISA reader (Viktor 1420, Turku, Finland) at 570 nm.

Thymidine Incorporation.
Cells (104 per well) were seeded in quadruplicate in 96-well flat-bottomed tissue culture plates and pulsed for 16 h with 1 µC [3H]thymidine/well (Amersham Bioscience) on days 0 and 5 of culture. The cells were disrupted by freeze thawing and were harvested using a Skatron Micro96 Harvester, and the filters counted in a Beta Plate scintillation counter (1205; Wallac, Turku, Finland).

Cloning Efficiency.
One-hundred cells were plated in each of four 96-well plates, and growing colonies were scored at 14 days.

Colony-forming Assay.
Cells (350) were plated in each of three wells of a six-well plate. At day 16 the plates were fixed in 70% methanol, stained with 0.1% crystal violet, and the number of colonies counted.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of PHLDA1 as an mRNA Differentially Expressed in Cells Derived from Autologous Primary and Metastatic Melanoma.
mRNA differential display was used to compare gene expression in GT-BS, a cell line established from a primary nodular melanoma, and GU-BSA, established from a lymph node metastasis of the same patient. Among the nine cDNA fragments showing differential expression in three independent experiments, the 340-bp cDNA P7 was preferentially expressed in the primary tumor cell line (Fig. 1A)Citation . RT-PCR analysis with specific primers that amplified a 126-bp fragment within the P7 sequence generated a signal only in the primary tumor cell line (Fig. 1B, G)Citation . Examination of two additional pairs of cell lines derived from autologous primary and metastatic lesions of different patients (Fig. 1B, I and W)Citation , suggested that down-regulation of the P7 gene may be a common occurrence in melanoma metastases.



View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Differential expression of PHLDA1 in cells derived from primary (P) and metastatic (M) melanoma cell lines. Autologous cell line pairs: I, IgR37 (M)/IgR39 (P); G, GU-BSA (M)/GT-BS (P); W, WM-115 (P)/WM-266-4 (M). A, RNA differential display with cell line pair G, in triplicate (1 2 3) . Arrow indicates P7 fragment (PHLDA1). B, P7 (PHLDA1)specific RT-PCR in cell line pairs compared with RT-PCR products of an irrelevant gene P9. C, PHLDA1 protein expression in autologous cell pairs. Western blot was probed with anti-PHLDA1 L19 antiserum and anti-ß-actin. D, quantification of protein expression shown in C. Densitometric analysis of the PHLDA1 protein bands was normalized to the ß-actin bands. For each cell line pair, the value for the metastasis derived cell was set as 100. E, Western blot analysis of PHLDA1 expression in melanoma cell lines using the L19 anti-PHLDA1 antiserum and anti-ß-actin. F, summary of PHLDA1 protein expression in melanoma cell lines derived from primary or metastatic lesions. Indicated are the number of cell lines expressing strong or weak PHLDA1. Data were analyzed using Fisher’s exact test.

 
To obtain the full-length cDNA, the P7 fragment was used to screen human melanoma cDNA libraries, and the clones obtained were extended with 5' rapid amplification of cDNA ends. This resulted in sequence information overlapping with the GenBank cDNA clone Z50194, encoding a proline-rich protein. The 4.5-kb P7 cDNA (accession no. NM 007350) shows a 87% identity (at the amino acid level) to the murine TDAG51 cDNA (accession no. NM 009344) indicating that it represents the human homologue of TDAG51/PHLDA1 (16) gene.

Western blot analysis using a polyclonal antiserum confirmed that expression of the PHLDA1 protein, which migrates with an apparent molecular weight of Mr 40,000, is reduced in the cell lines derived from the metastatic lesion as compared with those derived from the autologous primary tumor (Fig. 1, C and D)Citation .

In addition to these three autologous cell pairs, Western blot analysis of 22 melanoma cell lines revealed a significant correlation between PHLDA1 expression and cell origin. Cell lines derived from melanoma metastases expressed significantly less PHLDA1 protein than those derived from primary tumors (P < 0.0219; Fig. 1, E and FCitation ).

Southern analysis of DNA derived from melanomas and normal leukocytes provided no evidence for PHLDA1 gene amplification or translocation in human melanoma cells (data not shown), whereas Northern blot analysis of mRNA derived from normal human tissues showed low ubiquitous PHLDA1 expression (data not shown), similar to what has been reported for the murine and rat homologues (17 , 21) .

PHLDA1 Protein Is Expressed in Melanocytic Lesions.
The results obtained from the differential display suggest that PHLDA1, an inducible early immediate gene, is constitutively expressed in malignant melanomas and that it is down-regulated during their progression to metastatic disease. To evaluate PHLDA1 protein expression on melanocytic lesions in vivo, we generated monoclonal antibodies directed to the human PHLDA1. The antibody RN-6E2, which recognizes the Mr 40,000 PHLDA1 protein in Western blots, reacts with the primary melanoma cell line Mel JuSo (Fig. 2, A and BCitation , solid line), and this reactivity is completely inhibited in the presence of recombinant PHLDA1 protein (Fig. 2ACitation , filled histogram) but is not influenced by the presence of an unrelated protein (Fig. 2BCitation , filled histogram). The identical results are obtained when recombinant protein is used in the staining of frozen tissue sections. Antibody RN-6E2 reactivity with melanocytic cells (labeled by the antiproteoglycan antibody in Fig. 2CCitation ) is inhibited by preincubation with recombinant PHLDA1 protein (Fig. 2D)Citation but not by recombinant MCAM protein (Fig. 2E)Citation . Additional evidence for the specificity of this antibody is shown by its reactivity with the cell line HL60. PHLDA1 mRNA (Fig. 2G)Citation as well as RN-6E2 binding (Fig. 2H)Citation can only be detected in HL60 cells after phorbol ester stimulation.



View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Specificity of the anti-PHLDA1 antibody RN-6E2. A and B, FACS analysis of RN-6E2 binding to melanoma cell line Mel JuSo. Reactivity of RN-6E2 (solid line) is inhibited by preincubation with recombinant PHLDA1 protein (A, filled histogram) but not by recombinant MCAM protein (B, filled histogram). Dashed lines, isotype control. Numbers in parentheses indicate the {delta} mean channels (mean channel anti-PHLDA1-mean channel isotype control) without and with inhibitor protein. C–F, immunoperoxidase staining of frozen tissue serial sections of melanocytic nevus, N3. Reactivity of RN-6E2 with melanocytic cells (identified by reactivity with antiproteoglycan antibody), C, is inhibited by preincubation with recombinant PHLDA1 protein (D) but not by preincubation with recombinant MCAM protein (E); Isotype control (F). G, Northern blot analysis of PHLDA1 mRNA expression in HL60 cells with (+) and without (-) PMA stimulation using a PHLDA1-specific probe ("Material and Methods"). H, FACS analysis of RN-6E2 binding to HL60 cells with (filled histogram) and without (solid line) PMA stimulation. Dashed line, isotype control. I, cytoplasmic expression of PHLDA1 in Mel JuSo. Green, FITC anti-PHLDA1; red, 4',6-diamidino-2-phenylindole staining of nucleus.

 
Although the derived cDNA sequence contains a putative nuclear localization signal, microscopic examination of the stained Mel JuSo melanoma cells indicates that at least in these cells, PHLDA1 is localized primarily to the cytoplasm (Fig. 2I)Citation .

The expression of PHLDA1 was examined on frozen tissue sections of 15 melanocytic nevi, 22 primary melanomas, and 18 metastatic lesions from skin and lymph node. In all of the cases the percentage of reactive melanocytic cells (based on the staining of a serial section with antimelanoma proteoglycan antibody) was estimated and the staining scored as strong (e.g., Fig. 3BCitation ) or weak (e.g., Fig. 3DCitation ). Strong and uniform expression was observed with 80% of the nevi, which included congenital as well as acquired lesions (Fig. 3, B and E)Citation . A similar expression pattern was observed in only 41% of the primary tumors and 22% of the metastases. Among the metastatic lesions, no apparent differences were seen between lymph node (in Fig. 3ECitation metastasis: lesions M 1, 2, 7, and 9–17), lung (in Fig. 3ECitation metastasis: lesion M 3) and skin metastases (in Fig. 3ECitation metastasis: lesions M 4, 5, 6, 8, and 18). Compared with the nevi, PHLDA1 expression by primary and metastatic melanomas was heterogeneous with many tumors showing only weak staining in a fraction of the melanoma cells. Comparing the primary tumors to the metastases, PHLDA1 expression was most heterogeneous in the metastatic lesions. Thirty-three percent of metastatic lesions showed staining in less than half of the tumor cells, compared with 10% of the primary tumors. These data, presented schematically in Fig. 3ECitation , suggest that PHLDA1 expression is down-regulated during the progression of malignant melanomas. Within the primary tumors, no correlation could be observed between the intensity or degree of PHLDA1 expression and the tumor stage. Among the primary tumors showing strong, uniform PHLDA1 expression were melanoma in situ (in Fig. 3ECitation , primary tumors: lesion PT 6), superficial spreading melanomas (in Fig. 3ECitation , lesions PT 2, 3, and 8), and nodular melanomas (in Fig. 3ECitation , lesions PT 5 and 7). The vertical thickness or Breslow index remains the most widely used prognostic parameter in melanoma (5) . Neither thin tumors (<0.75 mm, lesions PT 3, 15, 16, and 20) nor thick tumors (>3.5 mm, lesions PT 1 and 11) showed uniformity in PHLDA1 expression pattern. PHLDA1 expression of the melanomas was also not associated with the degree of leukocyte infiltration. The expression pattern observed on the melanocytic tumors contrasts starkly with the surrounding normal tissues. No immunoreactivity was observed with leukocytes, vessels, smooth muscle, keratinocytes, or any other cells in the lymph nodes or skin, including epidermal melanocytes (Fig. 3, B and D)Citation .



View larger version (99K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. PHLDA1 expression in melanocytic lesions. Serial frozen tissue sections were stained with an indirect immunoperoxidase method. A, nevus N11, antiproteoglycan; 125x; B, nevus N11, anti-PHLDA1 (RN-6E2); 125x; C, lymph node metastasis (LNM) M7, antiproteoglycan; 250x; D, LNM M7 anti-PHLDA1 (RN-6E2); 250x; E, summary of PHLDA1 reactivity on melanocytic lesions. Each investigated lesion is represented by a circle and ordered by the percentage of PHLDA1-positive melanocytic cells. Filled circles, strong staining; open circles, weak staining. The green-filled circle is nevus N11, the red, unfilled circle is LNM M7.

 
Constitutive Expression of PHLDA1 Is Associated with Reduced Cell Growth.
To directly examine the influence of PHLDA1 expression on the biological characteristics of cells, four independent stable transfectants constitutively expressing various levels of PHLDA1 protein were produced in two different human cell lines. Both of these cell lines, 293, an adenovirus 5 transformed embryonic kidney epithelial cell, and melanoma cell line Mel Rif, expressed low endogenous levels of PHLDA1 protein. The PHLDA1 expression in the eight transfectants and in neo control transfectants is shown in Fig. 4, A and BCitation . Whereas the different transfectants express different levels of PHLDA1, these are comparable with the endogenous levels observed in some melanoma cell lines derived from primary tumors (for example, Mel JuSo, Fig. 2, A and BCitation ).



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. PHLDA1 expression in stable transfectants. Tr1-Tr4, PHLDA1 transfectants; Neo1 and Neo2, neomycin-resistant transfectants. A, FACS histograms. Filled histograms, PHLDA1 expression (antibody RN-6E2); unfilled histograms, isotype control; numbers in parentheses indicate the {delta} mean channel values (mean channel PHLDA1-mean channel isotype control). B, Western blot analysis. PHLDA1 was detected with monoclonal antibody RN-6E2. Anti-ß-actin was used as loading control.

 
The PHLDA1-expressing transfectants did not differ morphologically from the neo controls, and no differences were observed in the expression of a variety of cell surface molecules including the ß1 integrins (CD29 and CD49a-f) and CD95 (Fas; data not shown).

The PHLDA1-expressing transfectants were observed to grow more slowly than the neo controls (Fig. 5)Citation . This difference was more pronounced after day 2, a time at which essentially all of the cells had established cell-cell contacts. Reduced growth of the PHLDA1 transfectants was observed both in assays for living cells (MTT ELISA; Fig. 5, A and BCitation ) and in DNA synthesis (Fig. 5C)Citation . However, the PHLDA1 transfectants did not demonstrate obvious derangements in the cell cycle parameters when examined at 24, 48, or 72 h after plating. Cell cycle analyses at 48 h, a time point at which a reduced growth rate is evident, are shown in Fig. 5DCitation .



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Constitutive PHLDA1 expression suppresses cell growth. A and B, live cells measured with an MTT ELISA. Dashed lines, neomycin transfectants; solid lines, PHLDA1 transfectants. Values are given as mean absorbance with SD of four wells. Y axis, A570 nm. C, thymidine incorporation in growing 293 PHLDA1 (Tr1-Tr3) and control transfectants (Neo1 and Neo2) at days 0 and day 5. Data are presented as the mean of quadruplicate cultures; bars, ± SD. D, cell cycle analysis. PHLDA1 (Tr2-Tr4) and neomycin (Neo1 and Neo2) transfectants in 293 and Mel Rif, 48 h after plating. Histograms showing cell number (Y axis) and DNA content as measured with propidium iodide (X axis), and the percentage of cells in the cell cycle phases as determined with the ModFit software.

 
The PHLDA1 transfectants also demonstrated a reduced ability to form colonies in liquid medium (Fig. 6, A and B)Citation and a reduced cloning efficiency (Fig. 6C)Citation , suggesting that autonomous growth potential is also decreased. The number of colonies was not increased when measurements were made at a later time indicating that this is not solely a reflection of the reduced growth rate. However, in both assays, the size of the individual colonies was notably smaller in the PHLDA1 transfectants than in the neo controls.



View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Influence of constitutive PHLDA1 expression on colony formation and cloning efficiency. Tr1-Tr4, PHLDA1 transfectants; Neo1 and Neo2, neomycin transfectants. A, photograph of representative colony formation plates 16 days after plating. Left plates, 293; right plates, Mel Rif. B, quantitation of colony formation. Shown are mean colony numbers per 350 cells (triplicates); bars, ±SD. C, cloning efficiency. Shown are the mean number of colonies per 100 cells (triplicates); bars, ±SD.

 
Constitutive PHLDA1 Expression Is Associated with Increased Sensitivity to Apoptosis.
PHLDA1 was originally identified as a molecule necessary for activation-induced cell death in T lymphocytes (17) . To determine whether the observed reduction in growth observed for the human transfectants might be associated with an increase in basal apoptosis, the PHLDA1 and neo transfectants were examined for surface binding of annexin V (Fig. 7A)Citation and for TdT-dependent incorporation of FITC-labeled dUTP (TUNEL; Fig. 7BCitation ). Compared with the neo controls, the PHLDA1 transfectants all demonstrate an increase in annexin V binding by live cells (i.e., propidium iodide negative), manifest as a shift in fluorescence intensity. In addition, as shown for the 293 transfectants, the TdT-treated cells demonstrate a population of small, FITC- positive cells (Fig. 7BCitation , red) not seen in control cells incubated with FITC-dUTP in the absence of enzyme (Fig. 7BCitation , green). This population is increased in all of the PHLDA1 transfectants as compared with the neo controls. In addition, cleaved caspase 9, an important effector of apoptosis and cleaved PARP, a commonly used marker of apoptosis (22) are also increased in PHLDA1 transfectants as compared with neo transfectants (Fig. 7C)Citation . Taken together the results of these independent assays indicate that constitutive expression of PHLDA1 is associated with an increase in basal apoptosis.



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Constitutive PHLDA1 expression is associated with increased apoptosis. Tr1-Tr4, PHLDA1-transfectants; Neo1 and Neo2, neomycin transfectants. A, annexin-V binding of transfectants under normal growth conditions. Shown are FACS histograms of FITC- annexin-V binding of living (propidium iodide-negative) cells of 293 and Mel Rif transfectants; X axis, fluorescence intensity; Y axis, cell number. The red bar in each panel denotes the median fluorescence intensity for the neomycin transfectants. m, mean channel B, FACS analysis of a TUNEL assay in 293 transfectants. Shown are dot blot diagrams; X axis, fluorescence intensity (incorporated FITC-labeled nucleotides) versus forward scatter (Y axis; cell size). Green represents the background fluorescence observed in the absence of TdT and red the FITC-positive cells (apoptotic cells) observed only in the presence of TdT. The percentage of apoptotic cells (red/red + green) is shown for each transfectant. C, Western blot analysis of cleaved caspase-9 (cCas-9) and cleaved PARP (cPARP) in representative Mel Rif PHLDA1 and neo transfectants. The numbers indicate the relative protein amount (PHLDA1 transfectant set to 100) after normalization to the ß-actin expression.

 
To examine whether expression of PHLDA1 enhances sensitivity of melanoma cells to chemotherapeutic agents, the Mel Rif transfectants were cultured in the presence of doxorubicin and then assessed for annexin V binding. Twenty-four h after doxorubicin exposure, a separate population of strongly annexin V-positive cells is visible in all of the PHLDA1 transfectants as compared with the neo controls (Fig. 8A)Citation . Constitutive expression of PHLDA1 also increases the sensitivity of the melanoma cells to camptothecin. As shown in Fig. 8BCitation in the analysis of propidium iodide-stained cells, the fraction of cells with a sub-G1 DNA component (Ap), which represents apoptotic cells, increases in the PHLDA1 transfectant much more rapidly than in the neo transfectant. Similar results are seen when the expression of cleaved PARP is compared between PHLDA1 and neo transfectants (Fig. 8C)Citation . These results indicate that constitutive PHLDA1 expression clearly enhances the sensitivity of the melanoma cells to chemotherapeutic agents. The time course study presented in Fig. 8BCitation also shows a difference between the PHLDA1 and neo transfectants at time = 0, providing additional evidence that basal apoptosis is enhanced in the PHLDA1-expressing cells.



View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. PHLDA1 expression enhances sensitivity of melanoma cells to chemotherapeutic agents. Tr1, Tr2, and Tr4, PHLDA1 transfectants; Neo1 and Neo2, neomycin transfectants. A, annexin-V binding assay of Mel Rif transfectants after exposure to doxorubicin. Cells were cultured with 1 µg/ml doxorubicin for 24 h. X axis, fluorescence intensity; Y axis, cell number. The bar in each panel denotes the median fluorescence intensity for the neomycin transfectants. m, mean channel values; p1 and p2, peak channels for the two populations. B, cell cycle analysis. PHLDA1 and neo transfectants in Mel Rif, 24 h after plating were treated for the indicated time with camptothecin and stained with propidium iodide. Histograms showing cell number (Y axis) and DNA content as measured with propidium iodide (X axis). The percentage of cells in the cell cycle phases and the fraction of cells with a sub-G1 DNA content (apoptotic cells, Ap) were determined with the ModFit software. C, Western blot analysis of cPARP expression in representative PHLDA1 and neomycin Mel Rif transfectants after exposure to stimulation with camptothecin for the indicated time. The band intensities were normalized to the actin expression, and PHLDA1 expression by Tr1 at each time point was set to 100. The numbers represent the relative amount between PHLDA1 and control transfectants.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The development and progression of malignant tumors is a complex multistep process involving alterations in the expression and function of a variety of different genes (23) . In the study presented here, a comparison of autologous primary and metastatic melanoma cells led to the identification of the human PHLDA1 gene as an mRNA that is down-regulated in cells derived from metastatic lesions. Immunohistochemical analysis of melanocytic lesions revealed PHLDA1 expression in benign melanocytic nevi and confirmed its progressive down-regulation in primary and metastatic lesions in vivo.

The PHLDA1 protein has a predicted size of 259 amino acids and contains a series of motifs indicative of protein-protein interactions. These include 16 proline-glutamine and 15 proline-histidine pairs in the COOH-terminal region and a stretch of 14 glutamine residues in the middle of the protein (17) . Polyglutamine tracts are found in a variety of transcription factors as well as in neurodegenerative disease associated proteins, and are thought to present protein binding regions (24) . Although PHLDA1 expression in melanoma cells was observed in the cytoplasm under normal culture conditions, the protein contains a putative nuclear localization signal suggesting that it may under certain conditions translocate into the nucleus. PHLDA1 does not contain a predicted transmembrane region but does contain a pleckstrin homology region, which may mediate interaction with cellular membranes and which is the basis for its inclusion in the PHLDA gene family (25) . PHLDA1 is an immediate early gene, and is induced in cell lines by a variety of external stimuli (17 , 21) and in normal lymphocytes by mitogen treatment.5

The PHLDA1 gene has been identified independently in two other systems. The murine PHLDA1 was isolated in a search for genes involved in T-cell receptor-induced cell death in a T-cell hybridoma (17) , and the rat homologue was identified as an immediate early gene induced by fibroblast growth factor in a hippocampal neuronal cell line (21) . In all three of the systems expression of PHLDA1 has been associated with enhanced apoptosis. In the studies reported here, constitutive PHLDA1 expression in melanoma cells and in 293 cells was associated with a reduction in growth rate, and a decrease in cloning efficiency and colony formation. The observed derangement in growth was not associated with an obvious alteration in cell cycle suggesting that it may be a reflection of an increased sensitivity to apoptosis. In fact under normal growth conditions, the PHLDA1 transfectants showed broad evidence of an increased basal apoptosis rate. PHLDA1 transfectants demonstrated increased annexin V binding, increased TdT-dependent dUTP incorporation, a higher fraction of cells with a sub-G1 DNA content, as well as higher levels of cleaved caspase 9 and cleaved PARP when compared with the neo transfectants. The increase in the fraction of apoptotic cells in the PHLDA1-expressing cells, as assessed by TdT-dependent dUTP incorporation or sub-G1 DNA content, averaged 5.7%. Apoptotic rates between 0.25 and 3% have been shown, in other systems, to lead to cell losses of 25–50%/day (26 , 27) .

The development of resistance to apoptosis is a hallmark of malignant cells, enabling them to survive despite apoptosis inducing environmental signals and the loss of normal survival signals (23 , 28 , 29) . Whereas mutation of p53 is a major mechanism used by tumor cells to escape from apoptosis, in malignant melanoma p53 mutations are rare (30) . Nevertheless, melanomas are highly resistant to apoptosis, and this is thought to be, at least in part, an explanation for their well-known insensitivity to chemotherapeutic drugs and radiotherapy (31 , 32) . Recent studies have uncovered multiple mechanisms used by melanomas to resist apoptosis. These include loss of expression of Apaf-1, an important mediator of caspase 9 activation (33) , increased expression of the apoptosis inhibitors survivin (34) and ML-IAP (35) , and up-regulation of the caspase 8 analogue c-flip (36) . The results presented here indicate that loss of PHLDA1 expression may contribute to the development of apoptosis resistance in melanomas. Constitutive expression of PHLDA1 by melanoma cells was associated with a greatly increased sensitivity to apoptosis induced by exposure the chemotherapeutic agents doxorubicin and camptothecin. In T-cell-receptor-triggered apoptosis, PHLDA1 expression was required for the up-regulation of Fas (17) . In our transfectants as well as in differentiating rat neurons (21) , PHLDA1 expression was not associated with Fas expression nor was Fas up-regulation after doxorubicin treatment altered in the transfectants (data not shown). Little is known in general regarding the function of PHLDA1. The observation that PHLDA1 expression is associated with increases in cleaved caspase 9 and cleaved PARP suggests that it may enhance the mitochondrial-mediated apoptotic pathway. Using the two hybrid system to identify binding partners, Hinz et al. (37) isolated three different proteins involved in translation and proposed that PHLDA1 functions to inhibit protein translation. The structure of PHLDA1 together with its status as a ubiquitous, inducible immediate early gene suggest a central role for this molecule in mediating the transduction of extracellular signals into the cell.

The observation that PHLDA1 protein is expressed by benign melanocytic nevi suggests that it is induced in these cells, as no expression is detectable in epidermal melanocytes nor in surrounding cells and tissues. In contrast to epidermal melanocytes, which occur as single cells in intimate contact with keratinocytes, melanocytes in nevi, as in melanomas, occur in nests together with other melanocytes; thus, they have lost the regulatory influence of their normal keratinocyte neighbors, an event which is proposed to contribute to the early steps in tumor development. However, nevi are benign melanocytic tumors with a tightly regulated growth control (38 , 39) and a high level of apoptosis (40) . In transfectants, constitutive PHLDA1 expression was associated with a reduction in growth rate, a decrease in cloning efficiency, and an increased apoptosis sensitivity. The constitutive expression of PHLDA1 protein by nevi in vivo raises the possibility that it contributes to the benign nature of these tumors, maintaining growth regulation and apoptosis sensitivity to loss of survival signals provided by keratinocyte neighbors. Therefore, the progressive loss of PHLDA1 expression with malignant transformation may contribute to the loss of these characteristics in melanoma. The mechanisms involved in the down-regulation of PHLDA1 expression remain unknown. TSSC3, a member of the PHLDA1 gene family, is imprinted during normal development (41) and also in brain tumors (42) . Although PHLDA1 is localized to a chromosomal region not yet implicated in imprinting (16 , 24) , methylation, which has been shown to contribute to loss of Apaf-1 expression (29) , could also be involved in PHLDA1 silencing in melanoma.


    ACKNOWLEDGMENTS
 
We thank Drs. Eckhard Breitbart (Buxtehude Hospital Dermatology Center, Buxtehude, Germany) and Sigfried Borelli (Department of Dermatology, University of Zurich, Zurich, Switzerland) for tissue specimens, and Dr. Willy Flegel (Department of Transfusion Medicine, University of Ulm, Ulm, Germany) for cDNA clones.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Deutsche Krebshilfe, Mildred Scheel Stiftung, W137/94/Jo1. This work was presented in part at the 92nd annual meeting of the AACR (2001) and at the 32nd Annual Meeting of the German Society of Immunology (2001). Back

2 To whom requests for reprints should be addressed, at Institute for Immunology, Goethestrasse 31, 80336 Munich, Germany. Phone: 49-89-5996-660; Fax: 49-89-5160-2236; E-mail: johnson{at}ifi.med.uni-muenchen.de Back

3 The abbreviations used are: PHLDA1, pleckstrin-homology-like domain family A, member 1; ATCC, American Type Culture Collection; PMA, phorbol 12-myristate 13-acetate; RT-PCR, reverse transcription-PCR; GST, glutathione S-transferase; TUNEL, terminal deoxynucleotidyl transferase (Tdt)-mediated nick end labeling; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; neo, neomycin-resistant; PARP, poly(ADP-ribose) polymerase; FACS, fluorescence-activated cell sorter. Back

4 Internet address: http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/maps.cgi?CHR = 12&BEG = 74021350&END = 74026201. Back

5 Unpublished observations. Back

Received 1/30/02. Accepted 8/15/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Yoshida B. A., Sokoloff M. M., Welch D. R., Rinker-Schaeffer C. W. Metastasis-suppressor genes: a review and perspective on an emerging field. J. Natl. Cancer Inst., 92: 1717-1730, 2000.[Abstract/Free Full Text]
  2. Howe H. L., Wingo P. A., Thun M. J., Ries L. A., Rosenberg H. M., Feigal E. G., Edwards B. K. Annual report to the nation on the status of cancer (1973 through 1998), featuring cancers with recent increasing trends. J. Natl. Cancer Inst., 93: 824-842, 2001.[Abstract/Free Full Text]
  3. Rigel D. S., Carucci J. A. Malignant melanoma: prevention, early detection, and treatment in the 21st century. CA Cancer J. Clin., 50: 215-236, 2000.[Abstract]
  4. Clark W. H. J., Elder D. E., Guerry D., Epstein M. N., Greene M. H., Van Horn M. A study of tumor progression: the precursor lesions of superficial spreading and nodular melanoma. Hum. Pathol., 15: 1147-1165, 1984.[Medline]
  5. Elder D. Tumor progression, early diagnosis and prognosis of melanoma. Acta. Oncol., 38: 535-547, 1999.[Medline]
  6. Albelda S. M., Mette S. A., Elder D. E., Stewart R., Damjanovich L., Herlyn M., Buck C. A. Integrin distribution in malignant melanoma: association of the ß 3 subunit with tumor progression. Cancer Res., 50: 6757-6764, 1990.[Abstract/Free Full Text]
  7. Hsu M. Y., Shih D. T., Meier F. E., Van Belle P., Hsu J. Y., Elder D. E., Buck C. A., Herlyn M. Adenoviral gene transfer of ß3 integrin subunit induces conversion from radial to vertical growth phase in primary human melanoma. Am. J. Pathol., 153: 1435-1442, 1998.[Abstract/Free Full Text]
  8. Lehmann J. M., Riethmuller G., Johnson J. P. MUC18, a marker of tumor progression in human melanoma, shows sequence similarity to the neural cell adhesion molecules of the immunoglobulin superfamily. Proc. Natl. Acad. Sci. USA, 86: 9891-9895, 1989.[Abstract/Free Full Text]
  9. Xie S., Luca M., Huang S., Gutman M., Reich R., Johnson J. P., Bar-Eli M. Expression of MCAM/MUC18 by human melanoma cells leads to increased tumor growth and metastasis. Cancer Res., 57: 2295-2303, 1997.[Abstract/Free Full Text]
  10. Schlagbauer-Wadl H., Jansen B., Muller M., Polterauer P., Wolff K., Eichler H. G., Pehamberger H., Konak E., Johnson J. P. Influence of MUC18/MCAM/CD146 expression on human melanoma growth and metastasis in SCID mice. Int. J. Cancer, 81: 951-955, 1999.[Medline]
  11. Degen W. G., van Kempen L. C., Gijzen E. G., van Groningen J. J., van Kooyk Y., Bloemers H. P., Swart G. W. MEMD, a new cell adhesion molecule in metastasizing human melanoma cell lines, is identical to ALCAM (activated leukocyte cell adhesion molecule). Am. J. Pathol., 152: 805-813, 1998.[Abstract]
  12. van Groningen J. J., Bloemers H. P., Swart G. W. Identification of melanoma inhibitory activity and other differentially expressed messenger RNAs in human melanoma cell lines with different metastatic capacity by messenger RNA differential display. Cancer Res., 55: 6237-6243, 1995.[Abstract/Free Full Text]
  13. Clark E. A., Golub T. R., Lander E. S., Hynes R. O. Genomic analysis of metastasis reveals an essential role for RhoC. Nature (Lond.), 406: 532-535, 2000.[Medline]
  14. Francia G., Mitchell S. D., Moss S. E., Hanby A. M., Marshall J. F., Hart I. R. Identification by differential display of annexin-VI, a gene differentially expressed during melanoma progression. Cancer Res., 56: 3855-3858, 1996.[Abstract/Free Full Text]
  15. Liang P., Pardee A. B. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science (Wash. DC), 257: 967-971, 1992.[Abstract/Free Full Text]
  16. Kuske M. D., Johnson J. P. Assignment of the human PHLDA1 gene to chromosome 12q15 by radiation hybrid mapping. Cytogenet. Cell Genet., 89: 1 2000.[Medline]
  17. Park C. G., Lee S. Y., Kandala G., Choi Y. A novel gene product that couples TCR signaling to Fas(CD95) expression in activation-induced cell death. Immunity, 4: 583-591, 1996.[Medline]
  18. Berger W., Elbling L., Minai-Pour M., Vetterlein M., Pirker R., Kokoschka E. M., Micksche M. Intrinsic MDR-1 gene and P-glycoprotein expression in human melanoma cell lines. Int. J. Cancer, 59: 717-723, 1994.[Medline]
  19. Coligan J., Kruisbeek A. M., Margulier D. H., Shevach E. M., Strober W. Current Protocols in Immunology5.71 John Wiley & Sons New York 2000.
  20. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods, 65: 55-63, 1983.[Medline]
  21. Gomes I., Xiong W., Miki T., Rosner M. R. A proline- and glutamine-rich protein promotes apoptosis in neuronal cells. J. Neurochem., 73: 612-622, 1999.[Medline]
  22. Oliver F. J., de la Rubia G., Rolli V., Ruiz-Ruiz M. C., de Murcia G., Murcia J. M. Importance of poly(ADP-ribose) polymerase and its cleavage in apoptosis. Lesson from an uncleavable mutant. J. Biol. Chem., 273: 33533-33539, 1998.[Abstract/Free Full Text]
  23. Hanahan D., Weinberg R. A. The hallmarks of cancer. Cell, 100: 57-70, 2000.[Medline]
  24. Waragai M., Lammers C. H., Takeuchi S., Imafuku I., Udagawa Y., Kanazawa I., Kawabata M., Mouradian M. M., Okazawa H. PQBP-1, a novel polyglutamine tract-binding protein, inhibits transcription activation by Brn-2 and affects cell survival. Hum. Mol. Genet., 8: 977-987, 1999.[Abstract/Free Full Text]
  25. Frank D., Mendelsohn C. L., Ciccone E., Svensson K., Ohlsson R., Tycko B. A novel pleckstrin homology-related gene family defined by Ipl/Tssc3. TDAG51, and Tih1: tissue-specific expression, chromosomal location, and parental imprinting. Mamm. Genome, 10: 1150-1159, 1999.[Medline]
  26. Barres B. A., Hart I. K., Coles H. S., Burne J. F., Voyvodic J. T., Richardson W. D., Raff M. C. Cell death and control of cell survival in the oligodendrocyte lineage. Cell, 70: 31-46, 1992.[Medline]
  27. Bursch W., Paffe S., Putz B., Barthel G., Schulte-Hermann R. Determination of the length of the histological stages of apoptosis in normal liver and in altered hepatic foci of rats. Carcinogenesis (Lond.), 11: 847-853, 1990.[Abstract/Free Full Text]
  28. Evan G. I., Vousden K. H. Proliferation, cell cycle and apoptosis in cancer. Nature (Lond.), 411: 342-348, 2001.[Medline]
  29. Johnstone R. W., Ruefli A. A., Lowe S. W. Apoptosis: a link between cancer genetics and chemotherapy. Cell, 108: 153-164, 2002.[Medline]
  30. Hartmann A., Blaszyk H., Cunningham J. S., McGovern R. M., Schroeder J. S., Helander S. D., Pittelkow M. R., Sommer S. S., Kovach J. S. Overexpression and mutations of p53 in metastatic malignant melanomas. Int. J. Cancer, 67: 313-317, 1996.[Medline]
  31. Staunton M. J., Gaffney E. F. Tumor type is a determinant of susceptibility to apoptosis. Am. J. Clin. Pathol., 103: 300-307, 1995.[Medline]
  32. Serrone L., Hersey P. The chemoresistance of human malignant melanoma: An update. Melanoma Res., 9: 51-58, 1999.[Medline]
  33. Soengas M. S., Capodieci P., Polsky D., Mora J., Esteller M., Opitz-Araya X., McCombie R., Herman J. G., Gerald W. L., Lazebnik Y. A., Cordon-Cardo C., Lowe S. W. Inactivation of the apoptosis effector Apaf-1 in malignant melanoma. Nature (Lond.), 409: 207-211, 2001.[Medline]
  34. Grossman D., McNiff J. M., Li F., Altieri D. C. Expression and targeting of the apoptosis inhibitor, survivin, in human melanoma. J. Investig. Dermatol., 113: 1076-1081, 1999.[Medline]
  35. Vucic D., Stennicke H. R., Pisabarro M. T., Salvesen G. S., Dixit V. M. ML-IAP, a novel inhibitor of apoptosis that is preferentially expressed in human melanomas. Curr. Biol., 10: 1359-1366, 2000.[Medline]
  36. Medema J. P., de Jong J., van Hall T., Melief C. J., Offringa R. Immune escape of tumors in vivo by expression of cellular FLICE-inhibitory protein. J. Exp. Med., 190: 1033-1038, 1999.[Abstract/Free Full Text]
  37. Hinz T., Flindt S., Marx A., Janssen O., Kabelitz D. Inhibition of protein synthesis by the T cell receptor-inducible human TDAG51 gene product. Cell. Signal, 13: 345-352, 2001.[Medline]
  38. Goovaerts G., Buyssens N. Nevus cell maturation or atrophy?. Am. J. Dermatopathol., 10: 20-27, 1988.[Medline]
  39. Mancianti M. L., Gyorfi T., Shih I. M., Valyi-Nagy I., Levengood G., Menssen H. D., Halpern A. C., Elder D. E., Herlyn M. Growth regulation of cultured human nevus cells. J. Investig. Dermatol., 100: 281S-287S, 1993.[Medline]
  40. Sprecher E., Bergman R., Meilick A., Kerner H., Manov L., Reiter I., Shafer Y., Maor G., Friedman-Birnbaum R. Apoptosis. Fas and Fas-ligand expression in melanocytic tumors. J. Cutan. Pathol., 26: 72-77, 1999.[Medline]
  41. Lee M. P., Feinberg A. P. Genomic imprinting of a human apoptosis gene homologue. TSSC3. Cancer Res., 58: 1052-1056, 1998.[Abstract/Free Full Text]
  42. Muller S., van den Boom D., Zirkel D., Koster H., Berthold F., Schwab M., Westphal M., Zumkeller W. Retention of imprinting of the human apoptosis-related gene TSSC3 in human brain tumors. Hum. Mol. Genet., 9: 757-763, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
D. J. Gregory, R. Sladek, M. Olivier, and G. Matlashewski
Comparison of the Effects of Leishmania major or Leishmania donovani Infection on Macrophage Gene Expression
Infect. Immun., March 1, 2008; 76(3): 1186 - 1192.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Kumbrink, M. Gerlinger, and J. P. Johnson
Egr-1 Induces the Expression of Its Corepressor Nab2 by Activation of the Nab2 Promoter Thereby Establishing a Negative Feedback Loop
J. Biol. Chem., December 30, 2005; 280(52): 42785 - 42793.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
E Puxeddu, J A Knauf, M A Sartor, N Mitsutake, E P Smith, M Medvedovic, C R Tomlinson, S Moretti, and J A Fagin
RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response
Endocr. Relat. Cancer, June 1, 2005; 12(2): 319 - 334.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. Hardy, L. Mansfield, A. Mackay, S. Benvenuti, S. Ismail, P. Arora, M. J. O'Hare, and P. S. Jat
Transcriptional Networks and Cellular Senescence in Human Mammary Fibroblasts
Mol. Biol. Cell, February 1, 2005; 16(2): 943 - 953.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Toyoshima, M. Karas, S. Yakar, J. Dupont, Lee Helman, and D. LeRoith
TDAG51 Mediates the Effects of Insulin-like Growth Factor I (IGF-I) on Cell Survival
J. Biol. Chem., June 11, 2004; 279(24): 25898 - 25904.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Zettl, T. Rudiger, M.-A. Konrad, A. Chott, I. Simonitsch-Klupp, R. Sonnen, H. K. Muller-Hermelink, and G. Ott
Genomic Profiling of Peripheral T-Cell Lymphoma, Unspecified, and Anaplastic Large T-Cell Lymphoma Delineates Novel Recurrent Chromosomal Alterations
Am. J. Pathol., May 1, 2004; 164(5): 1837 - 1848.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Pandini, E. Medico, E. Conte, L. Sciacca, R. Vigneri, and A. Belfiore
Differential Gene Expression Induced by Insulin and Insulin-like Growth Factor-II through the Insulin Receptor Isoform A
J. Biol. Chem., October 24, 2003; 278(43): 42178 - 42189.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. S. Hossain, J. V. van Thienen, G. H. Werstuck, J. Zhou, S. K. Sood, J. G. Dickhout, A. B. L. de Koning, D. Tang, D. Wu, E. Falk, et al.
TDAG51 Is Induced by Homocysteine, Promotes Detachment-mediated Programmed Cell Death, and Contributes to the Development of Atherosclerosis in Hyperhomocysteinemia
J. Biol. Chem., August 8, 2003; 278(32): 30317 - 30327.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neef, R.
Right arrow Articles by Johnson, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neef, R.
Right arrow Articles by Johnson, J. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online