| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Institute for Immunology, Ludwig Maximilians University of Munich, Munich, Germany 80336
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Tissue specimens and histological diagnoses were obtained from the Dermatology Departments of the University of Hamburg (Hamburg, Germany), the University of Munich, and the Technical University of Munich (Munich, Germany). Tissue specimens were frozen in liquid nitrogen shortly after removal and stored at -80°C.
Differential Display and Isolation of Full-Length P7 cDNA
Total RNA was extracted from GT-BS and GU-BSA cells using RNAzol (Wacker Chemie, Munich, Germany). Using the RNAmap kit (GenHunter, Nashville, TN), 0.2 µg of total RNA was reverse transcribed with the oligodeoxythymidylic acid primers T12MA, T12MC, or T12MG and subsequently amplified by PCR combining each of the three different T12MM primers with the five arbitrary primers AP-1 (5'-AGCCAGCGAA-3'), AP-2 (5'-GACCGCTTGT-3'), AP-3 (5'-AGGTGACCGT-3'), AP-4 (5'-GGTACTCCAC-3'), and AP-5 (5'-GTTGCGATCC-3'). Three independent reverse transcription and PCR reactions were performed and the [33P]ATP-labeled amplification products separated on a 6% denaturing polyacrylamide gel. Differentially amplified PCR products were cut out from the dried gel, reamplified, and cloned into the pCRII vector (Invitrogen, Groningen, Netherlands). The 350-bp P7 differential display fragment was used to screen a melanoma (Mel JuSo) cDNA library in 
ZAP (Ref. 8
; Stratagene, La Jolla, CA), and two overlapping clones of 3.0 and 2.7 kb were isolated. Neither clone contained an open reading frame, although the 3.0 kb clone contained a polyadenylic acid tail at the 3' end, suggesting that they were not full length in the 5' region. Application of the 5' rapid amplification of cDNA ends System (Invitrogen Life Technologies, Inc.) using the P7-specific primer 5'-CCAAGATTAGGAATTACTACG-3' and anchor primers with reverse-transcribed (P7-specific primer 5'- GCAGCCTGGACAGGAGTAC-3') RNA isolated from Mel JuSo melanoma cells generated a 700-bp fragment containing an open reading frame that overlapped with the cDNA clone GenBank Z50194, coding for a proline, histidine-rich protein from fetal liver.
For RT-PCR analysis, total RNA was treated with DNaseI and reverse transcribed with oligo(dT)12–18 and SuperScript RNase H- reverse transcriptase (Invitrogen and Life Technologies, Inc.). The following primers were used for the RT-PCR analysis of PHLDA1 expression: 5'CCAGGACAGATGCTACTTGG 3' and 5'-GACTACATAACCTAGCAGTGG 3'. For Northern blot analysis, 10 µg of total RNA was separated in formaldehyde containing agarose gels, transferred to Nylon membranes (Hybond N+; Amersham Bioscience, Uppsala, Sweden), and hybridized with a 32P random-labeled probe corresponding to the first 1.1 kb of the PHLDA1 gene.
Immunohistochemistry, Immunofluorescence, and Antigen Competition
Tissue sections were blocked with 100 µg/ml heat aggregated human IgG, and stained with an indirect immunoperoxidase method using a biotinylated second antibody (Zymed, South San Francisco, CA) and streptavidin-peroxidase complex (Roche Biochemicals, Mannheim, Germany) together with 3-amino-9-ethyl-carbazole [0.25 mg/ml in 0.1 M acetate buffer (pH 4.9)] + 0.003% H2O2 as substrate. Serial sections were stained with antimelanoma proteoglycan antibody (G7A5, IgG1; Immunotech, Marseille, France) to localize the melanocytic cells, anti-CD45 (GAP 8.3; ATCC; IgG2a) to localize leukocytes, and appropriate isotype controls (11-4-1, IgG2a anti-H-2 obtained from Gunther Hammerling, German Cancer Center, Heidelberg, Germany; FR4H12 IgG1, directed against CD66c produced in our laboratory). Staining was evaluated semiquantitatively, and the fraction of PHLDA1-positive melanoma/nevus cells as well as the intensity of staining was estimated by comparison of RN-6E2 with the antiproteoglycan staining.
Intracytoplasmic immunofluorescence was performed using the Fix and Perm Kit (Caltag Laboratories, Burlingame, CA), and FITC-antimouse immunoglobulin (Dako, Copenhagen, Denmark).
The specificity of RN-6E2 binding was determined by a 1-h preincubation of sections or cells with 1.25–1.4 mg/ml PHLDA1-GST or cMCAM-GST recombinant protein before the addition of RN-6E2 antibody. Recombinant GST proteins were produced using pGEX expression vectors (Amersham Bioscience) in Escherichia coli BL21-Codon Plus-RP (Stratagene, La Jolla, CA) and purified on glutathione Sepharose according to the manufacturer’s recommendations
Western Blotting
Fifty to 100 µg protein from total cell lysates per lane were separated on 10% reducing SDS-PAGE and transferred to nitrocellulose membranes (BA85; Schleicher & Schüll, Dassel, Germany). The filters were blocked in 5% dried milk in PBS, stained with anti PHLDA1 antibodies, anticleaved caspase 9 (1:500; Cell Signaling, Beverly, MA), or anticleaved PARP (1:1000; Cell Signaling), and peroxidase-coupled second antibodies (Dako), and bound enzyme activity detected with a chemiluminescence substrate (ECL; Amersham Bioscience). Goat antiserum against human TDAG51/PHLDA1 was obtained from Santa Cruz Laboratories (L-19; Santa Cruz, CA), and monoclonal antibody RN-6E2 (IgG2a) directed against the human PHLDA1 molecule was produced in our laboratory. To control for loading and transfer the filters were stripped [0.1 M glycine (pH 2.9), 2 x 20 min] and reprobed with antiactin antibody (A5441, IgG1; Sigma).
Apoptosis Assays, Cell Cycle Analysis
Apoptosis was assessed by annexin V binding in the presence of propidium iodide to distinguish living and dead cells, and by TdT-dependent dUTP incorporation (TUNEL). Assessment of apoptosis was performed on cells that were 
70% confluent. Binding of FITC-annexin V was performed according to the manufacturer’s instructions (Apoptosis Detection kit; BD PharMingen, San Diego, CA). TUNEL assays were performed using the In Situ Cell Death Detection Kit (Roche Biochemicals). Cells were incubated with FITC-dUTP with and without TdT. FITC incorporation in the absence of TdT served as background control for each cell line. Stained cells were analyzed by flow cytometry (FACscan; Becton Dickinson) and Cell Quest software.
Cells were harvested for cell cycle analysis at various times after plating of 300,000 cells/6-mm tissue culture well. The cells were washed in 0.1% glucose in PBS, adjusted to 1 x 106/ml, and fixed in 70% ethanol for at least 48 h (19) .
Fixed cells were resuspended in 0.1% glucose containing 50 µg/ml propidium iodide and 100 µg/ml RNase for 30 min, and analyzed by flow cytometry (FACscalibur; Becton Dickinson). Cell cycle parameters were obtained using curve fitting analysis with the ModFit program (Verity Software, Inc., Topsham, ME).
Transfectants
The 293 kidney epithelial cell line and the melanoma cell line Mel Rif were transfected with a PHLDA1 expression plasmid in pcDNA3 or with the neomycin resistance gene, using Fugene 6 (Roche Molecular Biochemicals; 1 µg plasmid DNA/3 µl Fugene 6) according to the manufacturer’s instructions. The PHLDA1 expression plasmid was constructed from two cDNA clones isolated from a fetal liver cDNA library (5' region; clones Z50194-3 and Z50194-1, kindly provided by Willy A. Flegel, Department of Transfusion Medicine, University of Ulm, Ulm, Germany) and a 2.7 kb cDNA clone isolated from a melanoma cDNA library (3' region). The PHLDA1 insert is 4.5 kb long and begins on the reverse strand of chromosome 12 with bp 74026201.4
It contains two potential ATG start codons, bp 74026036 and bp 74025613, although the second ATG appears to be used in the transfectants and in all of the cell lines examined (data not shown). Transfectants were selected with G418 (1 mg/ml; Sigma) and cloned by limiting dilution. Two independent neo and four independent PHLDA1 transfectants were generated in each cell line. PHLDA1 expression was assessed by immunofluorescence and by Western blotting.
Cell Growth Assays
Growth Assays.
Five x 103 cells/well were seeded in quadruplicate in 96-well flat-bottomed tissue culture plates and cultured for 6 days. MTT (Sigma) live cell ELISAs (20)
were performed each day (days 0–6). Briefly MTT (1 mg/ml) was added to the wells and incubated for 4 h at 37°C, the cells were lysed with 7.5% SDS and 7.5 mM HCl overnight, and the plates read in an ELISA reader (Viktor 1420, Turku, Finland) at 570 nm.
Thymidine Incorporation.
Cells (104 per well) were seeded in quadruplicate in 96-well flat-bottomed tissue culture plates and pulsed for 16 h with 1 µC [3H]thymidine/well (Amersham Bioscience) on days 0 and 5 of culture. The cells were disrupted by freeze thawing and were harvested using a Skatron Micro96 Harvester, and the filters counted in a Beta Plate scintillation counter (1205; Wallac, Turku, Finland).
Cloning Efficiency.
One-hundred cells were plated in each of four 96-well plates, and growing colonies were scored at 14 days.
Colony-forming Assay.
Cells (350) were plated in each of three wells of a six-well plate. At day 16 the plates were fixed in 70% methanol, stained with 0.1% crystal violet, and the number of colonies counted.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. RT-PCR analysis with specific primers that amplified a 126-bp fragment within the P7 sequence generated a signal only in the primary tumor cell line (Fig. 1B, G)
. Examination of two additional pairs of cell lines derived from autologous primary and metastatic lesions of different patients (Fig. 1B, I and W)
, suggested that down-regulation of the P7 gene may be a common occurrence in melanoma metastases.
|
Western blot analysis using a polyclonal antiserum confirmed that expression of the PHLDA1 protein, which migrates with an apparent molecular weight of Mr 40,000, is reduced in the cell lines derived from the metastatic lesion as compared with those derived from the autologous primary tumor (Fig. 1, C and D)
.
In addition to these three autologous cell pairs, Western blot analysis of 22 melanoma cell lines revealed a significant correlation between PHLDA1 expression and cell origin. Cell lines derived from melanoma metastases expressed significantly less PHLDA1 protein than those derived from primary tumors (P < 0.0219; Fig. 1, E and F
).
Southern analysis of DNA derived from melanomas and normal leukocytes provided no evidence for PHLDA1 gene amplification or translocation in human melanoma cells (data not shown), whereas Northern blot analysis of mRNA derived from normal human tissues showed low ubiquitous PHLDA1 expression (data not shown), similar to what has been reported for the murine and rat homologues (17 , 21) .
PHLDA1 Protein Is Expressed in Melanocytic Lesions.
The results obtained from the differential display suggest that PHLDA1, an inducible early immediate gene, is constitutively expressed in malignant melanomas and that it is down-regulated during their progression to metastatic disease. To evaluate PHLDA1 protein expression on melanocytic lesions in vivo, we generated monoclonal antibodies directed to the human PHLDA1. The antibody RN-6E2, which recognizes the Mr 40,000 PHLDA1 protein in Western blots, reacts with the primary melanoma cell line Mel JuSo (Fig. 2, A and B
, solid line), and this reactivity is completely inhibited in the presence of recombinant PHLDA1 protein (Fig. 2A
, filled histogram) but is not influenced by the presence of an unrelated protein (Fig. 2B
, filled histogram). The identical results are obtained when recombinant protein is used in the staining of frozen tissue sections. Antibody RN-6E2 reactivity with melanocytic cells (labeled by the antiproteoglycan antibody in Fig. 2C
) is inhibited by preincubation with recombinant PHLDA1 protein (Fig. 2D)
but not by recombinant MCAM protein (Fig. 2E)
. Additional evidence for the specificity of this antibody is shown by its reactivity with the cell line HL60. PHLDA1 mRNA (Fig. 2G)
as well as RN-6E2 binding (Fig. 2H)
can only be detected in HL60 cells after phorbol ester stimulation.
|
.
The expression of PHLDA1 was examined on frozen tissue sections of 15 melanocytic nevi, 22 primary melanomas, and 18 metastatic lesions from skin and lymph node. In all of the cases the percentage of reactive melanocytic cells (based on the staining of a serial section with antimelanoma proteoglycan antibody) was estimated and the staining scored as strong (e.g., Fig. 3B
) or weak (e.g., Fig. 3D
). Strong and uniform expression was observed with 80% of the nevi, which included congenital as well as acquired lesions (Fig. 3, B and E)
. A similar expression pattern was observed in only 41% of the primary tumors and 22% of the metastases. Among the metastatic lesions, no apparent differences were seen between lymph node (in Fig. 3E
metastasis: lesions M 1, 2, 7, and 9–17), lung (in Fig. 3E
metastasis: lesion M 3) and skin metastases (in Fig. 3E
metastasis: lesions M 4, 5, 6, 8, and 18). Compared with the nevi, PHLDA1 expression by primary and metastatic melanomas was heterogeneous with many tumors showing only weak staining in a fraction of the melanoma cells. Comparing the primary tumors to the metastases, PHLDA1 expression was most heterogeneous in the metastatic lesions. Thirty-three percent of metastatic lesions showed staining in less than half of the tumor cells, compared with 10% of the primary tumors. These data, presented schematically in Fig. 3E
, suggest that PHLDA1 expression is down-regulated during the progression of malignant melanomas. Within the primary tumors, no correlation could be observed between the intensity or degree of PHLDA1 expression and the tumor stage. Among the primary tumors showing strong, uniform PHLDA1 expression were melanoma in situ (in Fig. 3E
, primary tumors: lesion PT 6), superficial spreading melanomas (in Fig. 3E
, lesions PT 2, 3, and 8), and nodular melanomas (in Fig. 3E
, lesions PT 5 and 7). The vertical thickness or Breslow index remains the most widely used prognostic parameter in melanoma (5)
. Neither thin tumors (<0.75 mm, lesions PT 3, 15, 16, and 20) nor thick tumors (>3.5 mm, lesions PT 1 and 11) showed uniformity in PHLDA1 expression pattern. PHLDA1 expression of the melanomas was also not associated with the degree of leukocyte infiltration. The expression pattern observed on the melanocytic tumors contrasts starkly with the surrounding normal tissues. No immunoreactivity was observed with leukocytes, vessels, smooth muscle, keratinocytes, or any other cells in the lymph nodes or skin, including epidermal melanocytes (Fig. 3, B and D)
.
|
. Whereas the different transfectants express different levels of PHLDA1, these are comparable with the endogenous levels observed in some melanoma cell lines derived from primary tumors (for example, Mel JuSo, Fig. 2, A and B
).
|
The PHLDA1-expressing transfectants were observed to grow more slowly than the neo controls (Fig. 5)
. This difference was more pronounced after day 2, a time at which essentially all of the cells had established cell-cell contacts. Reduced growth of the PHLDA1 transfectants was observed both in assays for living cells (MTT ELISA; Fig. 5, A and B
) and in DNA synthesis (Fig. 5C)
. However, the PHLDA1 transfectants did not demonstrate obvious derangements in the cell cycle parameters when examined at 24, 48, or 72 h after plating. Cell cycle analyses at 48 h, a time point at which a reduced growth rate is evident, are shown in Fig. 5D
.
|
and a reduced cloning efficiency (Fig. 6C)
, suggesting that autonomous growth potential is also decreased. The number of colonies was not increased when measurements were made at a later time indicating that this is not solely a reflection of the reduced growth rate. However, in both assays, the size of the individual colonies was notably smaller in the PHLDA1 transfectants than in the neo controls.
|
and for TdT-dependent incorporation of FITC-labeled dUTP (TUNEL; Fig. 7B
). Compared with the neo controls, the PHLDA1 transfectants all demonstrate an increase in annexin V binding by live cells (i.e., propidium iodide negative), manifest as a shift in fluorescence intensity. In addition, as shown for the 293 transfectants, the TdT-treated cells demonstrate a population of small, FITC- positive cells (Fig. 7B
, red) not seen in control cells incubated with FITC-dUTP in the absence of enzyme (Fig. 7B
, green). This population is increased in all of the PHLDA1 transfectants as compared with the neo controls. In addition, cleaved caspase 9, an important effector of apoptosis and cleaved PARP, a commonly used marker of apoptosis (22)
are also increased in PHLDA1 transfectants as compared with neo transfectants (Fig. 7C)
. Taken together the results of these independent assays indicate that constitutive expression of PHLDA1 is associated with an increase in basal apoptosis.
|
. Constitutive expression of PHLDA1 also increases the sensitivity of the melanoma cells to camptothecin. As shown in Fig. 8B
in the analysis of propidium iodide-stained cells, the fraction of cells with a sub-G1 DNA component (Ap), which represents apoptotic cells, increases in the PHLDA1 transfectant much more rapidly than in the neo transfectant. Similar results are seen when the expression of cleaved PARP is compared between PHLDA1 and neo transfectants (Fig. 8C)
. These results indicate that constitutive PHLDA1 expression clearly enhances the sensitivity of the melanoma cells to chemotherapeutic agents. The time course study presented in Fig. 8B
also shows a difference between the PHLDA1 and neo transfectants at time = 0, providing additional evidence that basal apoptosis is enhanced in the PHLDA1-expressing cells.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The PHLDA1 protein has a predicted size of 259 amino acids and contains a series of motifs indicative of protein-protein interactions. These include 16 proline-glutamine and 15 proline-histidine pairs in the COOH-terminal region and a stretch of 14 glutamine residues in the middle of the protein (17) . Polyglutamine tracts are found in a variety of transcription factors as well as in neurodegenerative disease associated proteins, and are thought to present protein binding regions (24) . Although PHLDA1 expression in melanoma cells was observed in the cytoplasm under normal culture conditions, the protein contains a putative nuclear localization signal suggesting that it may under certain conditions translocate into the nucleus. PHLDA1 does not contain a predicted transmembrane region but does contain a pleckstrin homology region, which may mediate interaction with cellular membranes and which is the basis for its inclusion in the PHLDA gene family (25) . PHLDA1 is an immediate early gene, and is induced in cell lines by a variety of external stimuli (17 , 21) and in normal lymphocytes by mitogen treatment.5
The PHLDA1 gene has been identified independently in two other systems. The murine PHLDA1 was isolated in a search for genes involved in T-cell receptor-induced cell death in a T-cell hybridoma (17) , and the rat homologue was identified as an immediate early gene induced by fibroblast growth factor in a hippocampal neuronal cell line (21) . In all three of the systems expression of PHLDA1 has been associated with enhanced apoptosis. In the studies reported here, constitutive PHLDA1 expression in melanoma cells and in 293 cells was associated with a reduction in growth rate, and a decrease in cloning efficiency and colony formation. The observed derangement in growth was not associated with an obvious alteration in cell cycle suggesting that it may be a reflection of an increased sensitivity to apoptosis. In fact under normal growth conditions, the PHLDA1 transfectants showed broad evidence of an increased basal apoptosis rate. PHLDA1 transfectants demonstrated increased annexin V binding, increased TdT-dependent dUTP incorporation, a higher fraction of cells with a sub-G1 DNA content, as well as higher levels of cleaved caspase 9 and cleaved PARP when compared with the neo transfectants. The increase in the fraction of apoptotic cells in the PHLDA1-expressing cells, as assessed by TdT-dependent dUTP incorporation or sub-G1 DNA content, averaged 5.7%. Apoptotic rates between 0.25 and 3% have been shown, in other systems, to lead to cell losses of 25–50%/day (26 , 27) .
The development of resistance to apoptosis is a hallmark of malignant cells, enabling them to survive despite apoptosis inducing environmental signals and the loss of normal survival signals (23 , 28 , 29) . Whereas mutation of p53 is a major mechanism used by tumor cells to escape from apoptosis, in malignant melanoma p53 mutations are rare (30) . Nevertheless, melanomas are highly resistant to apoptosis, and this is thought to be, at least in part, an explanation for their well-known insensitivity to chemotherapeutic drugs and radiotherapy (31 , 32) . Recent studies have uncovered multiple mechanisms used by melanomas to resist apoptosis. These include loss of expression of Apaf-1, an important mediator of caspase 9 activation (33) , increased expression of the apoptosis inhibitors survivin (34) and ML-IAP (35) , and up-regulation of the caspase 8 analogue c-flip (36) . The results presented here indicate that loss of PHLDA1 expression may contribute to the development of apoptosis resistance in melanomas. Constitutive expression of PHLDA1 by melanoma cells was associated with a greatly increased sensitivity to apoptosis induced by exposure the chemotherapeutic agents doxorubicin and camptothecin. In T-cell-receptor-triggered apoptosis, PHLDA1 expression was required for the up-regulation of Fas (17) . In our transfectants as well as in differentiating rat neurons (21) , PHLDA1 expression was not associated with Fas expression nor was Fas up-regulation after doxorubicin treatment altered in the transfectants (data not shown). Little is known in general regarding the function of PHLDA1. The observation that PHLDA1 expression is associated with increases in cleaved caspase 9 and cleaved PARP suggests that it may enhance the mitochondrial-mediated apoptotic pathway. Using the two hybrid system to identify binding partners, Hinz et al. (37) isolated three different proteins involved in translation and proposed that PHLDA1 functions to inhibit protein translation. The structure of PHLDA1 together with its status as a ubiquitous, inducible immediate early gene suggest a central role for this molecule in mediating the transduction of extracellular signals into the cell.
The observation that PHLDA1 protein is expressed by benign melanocytic nevi suggests that it is induced in these cells, as no expression is detectable in epidermal melanocytes nor in surrounding cells and tissues. In contrast to epidermal melanocytes, which occur as single cells in intimate contact with keratinocytes, melanocytes in nevi, as in melanomas, occur in nests together with other melanocytes; thus, they have lost the regulatory influence of their normal keratinocyte neighbors, an event which is proposed to contribute to the early steps in tumor development. However, nevi are benign melanocytic tumors with a tightly regulated growth control (38 , 39) and a high level of apoptosis (40) . In transfectants, constitutive PHLDA1 expression was associated with a reduction in growth rate, a decrease in cloning efficiency, and an increased apoptosis sensitivity. The constitutive expression of PHLDA1 protein by nevi in vivo raises the possibility that it contributes to the benign nature of these tumors, maintaining growth regulation and apoptosis sensitivity to loss of survival signals provided by keratinocyte neighbors. Therefore, the progressive loss of PHLDA1 expression with malignant transformation may contribute to the loss of these characteristics in melanoma. The mechanisms involved in the down-regulation of PHLDA1 expression remain unknown. TSSC3, a member of the PHLDA1 gene family, is imprinted during normal development (41) and also in brain tumors (42) . Although PHLDA1 is localized to a chromosomal region not yet implicated in imprinting (16 , 24) , methylation, which has been shown to contribute to loss of Apaf-1 expression (29) , could also be involved in PHLDA1 silencing in melanoma.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by grants from the Deutsche Krebshilfe, Mildred Scheel Stiftung, W137/94/Jo1. This work was presented in part at the 92nd annual meeting of the AACR (2001) and at the 32nd Annual Meeting of the German Society of Immunology (2001). 
2 To whom requests for reprints should be addressed, at Institute for Immunology, Goethestrasse 31, 80336 Munich, Germany. Phone: 49-89-5996-660; Fax: 49-89-5160-2236; E-mail: johnson{at}ifi.med.uni-muenchen.de
3 The abbreviations used are: PHLDA1, pleckstrin-homology-like domain family A, member 1; ATCC, American Type Culture Collection; PMA, phorbol 12-myristate 13-acetate; RT-PCR, reverse transcription-PCR; GST, glutathione S-transferase; TUNEL, terminal deoxynucleotidyl transferase (Tdt)-mediated nick end labeling; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; neo, neomycin-resistant; PARP, poly(ADP-ribose) polymerase; FACS, fluorescence-activated cell sorter.
4 Internet address: http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/maps.cgi?CHR = 12&BEG = 74021350&END = 74026201.
Received 1/30/02. Accepted 8/15/02.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  D. J. Gregory, R. Sladek, M. Olivier, and G. Matlashewski Comparison of the Effects of Leishmania major or Leishmania donovani Infection on Macrophage Gene Expression Infect. Immun., March 1, 2008; 76(3): 1186 - 1192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Kumbrink, M. Gerlinger, and J. P. Johnson Egr-1 Induces the Expression of Its Corepressor Nab2 by Activation of the Nab2 Promoter Thereby Establishing a Negative Feedback Loop J. Biol. Chem., December 30, 2005; 280(52): 42785 - 42793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E Puxeddu, J A Knauf, M A Sartor, N Mitsutake, E P Smith, M Medvedovic, C R Tomlinson, S Moretti, and J A Fagin RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response Endocr. Relat. Cancer, June 1, 2005; 12(2): 319 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hardy, L. Mansfield, A. Mackay, S. Benvenuti, S. Ismail, P. Arora, M. J. O'Hare, and P. S. Jat Transcriptional Networks and Cellular Senescence in Human Mammary Fibroblasts Mol. Biol. Cell, February 1, 2005; 16(2): 943 - 953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Toyoshima, M. Karas, S. Yakar, J. Dupont, Lee Helman, and D. LeRoith TDAG51 Mediates the Effects of Insulin-like Growth Factor I (IGF-I) on Cell Survival J. Biol. Chem., June 11, 2004; 279(24): 25898 - 25904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zettl, T. Rudiger, M.-A. Konrad, A. Chott, I. Simonitsch-Klupp, R. Sonnen, H. K. Muller-Hermelink, and G. Ott Genomic Profiling of Peripheral T-Cell Lymphoma, Unspecified, and Anaplastic Large T-Cell Lymphoma Delineates Novel Recurrent Chromosomal Alterations Am. J. Pathol., May 1, 2004; 164(5): 1837 - 1848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Pandini, E. Medico, E. Conte, L. Sciacca, R. Vigneri, and A. Belfiore Differential Gene Expression Induced by Insulin and Insulin-like Growth Factor-II through the Insulin Receptor Isoform A J. Biol. Chem., October 24, 2003; 278(43): 42178 - 42189. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. S. Hossain, J. V. van Thienen, G. H. Werstuck, J. Zhou, S. K. Sood, J. G. Dickhout, A. B. L. de Koning, D. Tang, D. Wu, E. Falk, et al. TDAG51 Is Induced by Homocysteine, Promotes Detachment-mediated Programmed Cell Death, and Contributes to the Development of Atherosclerosis in Hyperhomocysteinemia J. Biol. Chem., August 8, 2003; 278(32): 30317 - 30327. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
mean channels (mean channel anti-PHLDA1-mean channel isotype control) without and with inhibitor protein. C–F, immunoperoxidase staining of frozen tissue serial sections of melanocytic nevus, N3. Reactivity of RN-6E2 with melanocytic cells (identified by reactivity with antiproteoglycan antibody), C, is inhibited by preincubation with recombinant PHLDA1 protein (D) but not by preincubation with recombinant MCAM protein (E); Isotype control (F). G, Northern blot analysis of PHLDA1 mRNA expression in HL60 cells with (+) and without (-) PMA stimulation using a PHLDA1-specific probe ("Material and Methods"). H, FACS analysis of RN-6E2 binding to HL60 cells with (filled histogram) and without (solid line) PMA stimulation. Dashed line, isotype control. I, cytoplasmic expression of PHLDA1 in Mel JuSo. Green, FITC anti-PHLDA1; red, 4',6-diamidino-2-phenylindole staining of nucleus.
