Cancer Research The Future of Cancer Research: Science and Patient Impact  AACR Conference on Molecular Diagnostics - 2008
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilson, A. J.
Right arrow Articles by Augenlicht, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilson, A. J.
Right arrow Articles by Augenlicht, L. H.
[Cancer Research 62, 6006-6010, November 1, 2002]
© 2002 American Association for Cancer Research


Advances in Brief

Novel Detection and Differential Utilization of a c-myc Transcriptional Block in Colon Cancer Chemoprevention1

Andrew J. Wilson2, Anna Velcich, Diego Arango, Amy R. Kurland, Shailesh M. Shenoy, Rossanna C. Pezo, Jeffrey M. Levsky, Robert H. Singer and Leonard H. Augenlicht

Department of Oncology, Albert Einstein Cancer Center, Montefiore Medical Center, Bronx, New York 10467 [A. J. W., A. V., D. A., L. H. A.], and Department of Anatomical and Structural Biology, Albert Einstein College of Medicine, Bronx, New York 10461 [A. R. K., S. M. S., R. C. P., J. M. L., R. H. S.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Mutations in the adenomatous polyposis coli (APC) gene, which initiate almost all human colon cancers, directly target the proto-oncogene, c-myc, by elevating ß-catenin/T-cell factor (TCF) signaling. We have shown that agents ascribed chemopreventive activity for colon cancer in fact also stimulate ß-catenin/TCF activity in vitro. Their effects on c-myc transcription were assayed using a novel variant of fluorescence in situ hybridization that detects c-myc transcription sites in intact nuclei. Increased transcriptional initiation of c-myc induced by the short-chain fatty acid, butyrate, consistent with elevated ß-catenin/TCF activity, was efficiently abrogated by a block to transcriptional elongation, resulting in decreased c-myc expression. 1{alpha},25-Dihydroxyvitamin D3 also induced transcriptional blockage. In contrast, the nonsteroidal anti-inflammatory drug, sulindac, increased c-myc expression, an effect attributable at least in part to its failure to induce transcriptional blockage. We have described a novel approach for evaluating the effects of chemopreventive agents on the expression of a gene critical in colonic tumorigenesis.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Elevated expression of the c-myc proto-oncogene product is characteristic of various human malignancies, including colon cancer (1) . Almost all human colon cancers are initiated by mutations in the APC gene, which directly induce the c-myc gene through elevated ß-catenin/TCF3 signaling (2 , 3) . We have shown that the short-chain fatty acid, butyrate, and the nonsteroidal anti-inflammatory drug, sulindac, both of which have been ascribed chemopreventive activity in the colon (4, 5, 6) , stimulate ß-catenin/TCF activity in colon cancer cells (7) . However, butyrate clearly reduces steady-state c-myc RNA levels in these cells (8 , 9) .

We hypothesized that resolution of this issue may be linked to an important mechanism of regulation of c-myc expression identified in a variety of cell types, i.e., changes in the ability of RNA polymerase II to progress through specific DNA sites within the first exon/intron border of c-myc, at which transcriptional elongation can be blocked (8 , 10) . To address how elevated ß-catenin/TCF signaling could be linked to reduced c-myc expression, we used a novel method of FISH to visualize c-myc nuclear transcription sites and interrogate transcriptional initiation and elongation (11, 12, 13) . We show that butyrate-mediated stimulation of c-myc transcriptional initiation was efficiently abrogated by a block to transcriptional elongation. This block was also induced by another physiological inducer of colon cell maturation, 1{alpha},25-dihydroxyvitamin D3 (14 , 15) , but not by sulindac. We have identified differential regulation of expression of a key gene controlling colonic tumorigenesis by chemopreventive agents with physiological and pharmacological relevance to the colonic epithelium. These results concerning the effects of chemopreventive agents on c-myc transcription are particularly significant in light of the recent report that even brief inactivation of c-myc is sufficient to induce a sustained loss of the transformed phenotype in murine osteogenic sarcoma cells that overexpress the gene (16) .


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Oligonucleotide Probe Synthesis.
DNA probes consisting of 50 nucleotides were designed complementary to two separate regions of c-myc mRNA encoded by exon 1 or exon 3 of the c-myc gene and three separate regions of human ß-actin mRNA. The probes were synthesized with deoxythymidine (amino-allyl dT) at defined positions in the sequence, purified by reverse chromatography, and the activated fluorophores, Cy3, Cy5 (both from Amersham, Piscataway, NJ), and FITC (Molecular Probes, Eugene, OR) were chemically coupled to these primary amines (17) . Each probe was labeled with a total of five identical fluorophore molecules.4 Probes were as follows: human c-myc exon 1 HCM5, 5'-TTTTATACTCAGCGCGATCCCTCCCTCCGTTCTTTTTTCCCGCCAAGCCT; human c-myc exon 1 HCM6, 5'-AAAAAATCCAGCGTCTAAGCAGCTGCAAGGAGAGCCTTTCAGAGAAGCG; human c-myc exon 3 HCM3, 5'-TGACCTTTTGCCAGGAGCCTGCCTCTTTTGCACAGAAACAACATCGATTT; human c-myc exon 3 HCM4, 5'-CTGGTGCATTTTCGGTTGTTGCTGATCTGTCTCAGGACTCTGACACTGTC; human ß-actin HBA1, 5'-GTGAACTTTGGGGGATGCTCGCTCCAACCGACTGCTGTCACCTTCACCGT; human ß-actin HBA2, 5'-TCCTTAGAGAGAAGTGGGGTGGCTTTTAGGATGGCAAGGGACTTCCTGTA; human ß-actin HBA3, 5'-CTTTTATTCAACTGGTCTCAAGTCAGTGTACAGGTAAGCCCTGGCTGCCT.

In Situ Hybridization.
SW837 colon carcinoma cells (CCL-235; American Type Culture Collection, Manassas, VA) were maintained by serial passage at 37°C, 5% CO2 in RPMI 1640 supplemented with 10% FBS, 1x antibiotic/antimycotic (100 units/ml streptomycin sulfate, 100 units/ml penicillin G sulfate, and 0.25 µg/ml amphotericin B), 100 µM nonessential amino acids, and 10 mM HEPES buffer solution (all from Invitrogen, Carlsbad, CA). The cells were seeded onto glass coverslips (Fisher, Pittsburgh, PA) coated with 0.5% gelatin (Sigma Chemical Co., St. Louis, MO). After the cultures reached ~60% confluency, they were treated with 5 mM butyrate, 10-7 M 1{alpha},25-dihydroxyvitamin D3, 1.6 mM sulindac, or 1 µM TSA (all from Sigma) for a time period of 0, 2, 4, 6, 8, 12, 16, or 24 h.5

Image Acquisition and Analysis.
Images were captured with a Photometrics CoolSNAP HQ digital CCD camera (Roper Scientific, Tucson, AZ) mounted on an AX-70 Provis microscope using a PlanApo 60X, 1.4 NA objective, and 100W mercury lamp for epi-illumination (Olympus, Melville, NY). A Uniblitz model VS35S2ZM0 shutter with model VMM-D1 electronic controller (Vincent Associates, Rochester, NY) was used for the capturing of images in three dimensions. These images were acquired using #31000 (DAPI), #41001 (FITC), #41007a (Cy3), and #41008 (Cy5) fluorescence filter sets (Chroma Technology, Brattleboro, VT) and viewed and superimposed with IPLab Windows version 3 software (Scanalytics, Fairfax, VA). Images acquired by the FITC, Cy3, and Cy5 filters were assigned green, red, and blue colors, respectively, for visualization.

To be scored as a true transcription site, our experimental strategy required the simultaneous detection of at least two colors at a site, independent hybridization events highly unlikely to be attributable to chance. Only sites in nonoverlapping, apparently intact nuclei were counted. This counting was performed with the scorer blinded to the identity of the slide; at least 20 transcription sites were counted/slide. Transcription sites were scored as three-color (red/green/blue) or two-color (red/green) based on the intensity of signal in the Cy5 channel above background. The majority of sites were readily classified as having either high or negligible Cy5 intensity. A small percentage of sites with intermediate Cy5 intensity were detected but were not included in the analysis. The number of nuclei in each field examined was also counted (DAPI image), including those in fields where transcription sites were not detected, to determine the relative frequency of occurrence of these sites.

Measurement of c-myc mRNA Levels.
The steady-state level of c-myc mRNA in SW837 cells was measured by real-time PCR analysis. Cells were grown and treated in a similar fashion to those used in the FISH experiments. RNA was prepared using an RNeasy kit (Qiagen, Valencia, CA), and first-strand cDNA was synthesized from 3 µg of total RNA by the Superscript II RT method provided (Invitrogen). cDNA was amplified using the SYBR Green Core Reagents kit and 7900HT real-time PCR apparatus (Applied Biosystems, Foster City, CA). A region within exon 3 of human c-myc cDNA was amplified using primers designed by Primer Express software (ABI) and purchased from Sigma-Genosys (The Woodlands, TX). Primers specific for human GAPDH cDNA, the expression of which acted as an internal control, were also used. Primer sequences were as follows: human c-myc forward, 5'-CGTCTCCACACATCAGAGCACAA; human c-myc reverse, 5'-TCTTGGCAGCAGGATAGTCCTT; human GAPDH forward, 5'-TCGGAGTCAACGGATTTGG; and human GAPDH reverse, 5'-CAACAATATCCACTTTACCAGAGTTAAAA.

A dissociation reaction was added at the conclusion of the amplification to ensure that a single product was obtained. Expression of c-myc was assayed in triplicate and was standardized using GAPDH as a reference. Relative levels were quantified by calculating 2-{Delta}{Delta}CT, where {Delta}{Delta}CT is the difference in CT (cycle number at which the amount of amplified target reaches a fixed threshold) between target and reference.

Statistical Analysis.
Statistical significance was assessed by Student’s t test (Minitab release 8 for the Macintosh; Minitab Inc., State College, PA). P <= 0.05 compared with untreated cells was considered statistically significant.


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
The experimental strategy to demonstrate transcriptional blockage used a novel method of imaging of transcription sites (11, 12, 13) , as illustrated in Fig. 1aCitation . Oligonucleotide probes recognizing exon 1 of c-myc RNA interrogated initiation of c-myc transcription, because these probes recognize regions of the transcripts encoded by DNA sequences upstream of a site at the exon 1/intron 1 border that can function in transcriptional attenuation (8 , 10) . In addition, the unsuccessful completion of c-myc transcription was evaluated using probes that recognize exon 3 of c-myc mRNA, because these probes only detect transcripts that undergo full elongation. The exon 1 probes were labeled with FITC and Cy3, and the exon 3 probes were labeled with Cy5. Therefore, when initiated and elongated transcripts were detected simultaneously, full-length and truncated c-myc RNA transcripts were detected as three-color (red/green/blue) and two-color (red/green) transcription sites, respectively. A magnified example of each type of site obtained is shown in Fig. 1aCitation .



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1. a, schematic illustration of the experimental FISH strategy used to assay transcriptional initiation and to demonstrate transcriptional blockage in c-myc. The structure of the c-myc gene is shown, with introns indicated by a vertical bar; a site that can function in transcriptional attenuation is located as indicated. c-myc RNA was interrogated by probes labeled with FITC (green) and Cy3 (red) that recognized exon 1 and probes labeled with Cy5 (blue) that recognized exon 3. Magnified examples of a c-myc transcription site with truncated or full-length transcripts are shown. b, low-power photomicrographs of transcription sites detected in fields of butyrate and sulindac-treated cells in relation to DAPI-stained nuclei. The red arrows indicate two-color sites, and the white arrows indicate three-color sites. Scale bar, 3 µM.

 
Fig. 1bCitation shows lower magnification pictures of fields of nuclei in which transcription sites (arrows) are detected after treatment with butyrate or sulindac. The red arrows indicate that two two-color sites were detected in the field of butyrate-treated cells shown, whereas the remaining four sites detected in these fields were three-color (white arrows). There are three important points regarding these data:

(a) The nuclei were visualized by staining with DAPI and demonstrated that each transcription site, as expected, had a nuclear localization.

(b) At the magnification shown in Fig. 1bCitation , it is difficult to resolve whether the transcription site is two-color or three-color. Therefore, this evaluation of the computer image was always made at a higher magnification (~5-fold higher).

(c) Finally, because some individual genes are activated transiently (13) , the distribution of detectable transcription sites at a point in time is heterogeneous in the culture. It was, therefore, essential, to score the number and type (color) of transcription sites to achieve a statistically valid representation of the results. This was done blinded from the treatment of the cells.

We have shown that butyrate increases ß-catenin/TCF activity in colon cancer cells cultured in vitro (7) , and c-myc is a direct target of this signaling pathway (3) . Therefore, we first determined the effect of 5 mM butyrate on the initiation of c-myc transcription, using SW837 colon cancer cells. When initiated transcripts were detected as outlined in Fig. 1aCitation , there was a significant increase in the number of nuclei with detectable c-myc transcription sites within 12 h of stimulation (Fig. 2a)Citation . This time course is consistent with our previously reported kinetics of butyrate-mediated induction of ß-catenin/TCF (7) . By 16–24 h, a 2.5-fold increase was observed.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2. Butyrate stimulated initiation of c-myc transcription but induced a block to transcriptional elongation in c-myc in SW837 cells. The number of nuclear c-myc transcription sites (a) and the percentage of three-color transcription sites (b) were detected in cells treated with butyrate for the indicated times after simultaneous interrogation of initiated and elongated c-myc transcripts. c, the number of c-myc transcription sites detected in butyrate-treated cells when initiated ({blacksquare}) and elongated ({square}) transcripts were interrogated individually using, respectively, exon 1 or exon 3 probes separately labeled with FITC, and Cy3 and Cy5. Values are means; bars, SE. *, P < 0.05, Student’s t test.

 
Simultaneous interrogation of initiated and elongated transcripts revealed that the percentage of c-myc transcription sites in untreated subconfluent cells scored as three-color sites was ~70% (Fig. 2b)Citation . This observation demonstrated that full read-through of the gene was the predominant event under basal conditions. However, butyrate induced an ~2-fold reduction in the number of elongated transcripts detected at c-myc transcription sites, with significant effects observed between 6 and 12 h after its addition (Fig. 2b)Citation .

To confirm these results, we used a related, but different, approach. Three spectrally distinct probes recognizing either the 5' or 3' end of the transcript were used to detect initiated and elongated transcription, respectively, in parallel experiments. The results of these experiments are shown in Fig. 2cCitation . Interrogation of initiated and elongated transcripts individually confirmed, first, a butyrate-induced initiation of c-myc transcription, and, second, that it significantly decreased the number of full-length transcripts detected compared with untreated cells. Therefore, the stimulatory effect of butyrate on c-myc transcriptional initiation was abrogated by recruitment of a block to transcriptional elongation.

We extended these experiments to the nonsteroidal anti-inflammatory drug, sulindac, because this drug has significant chemopreventive activity for colon cancer (6) . In addition, we have shown that, similar to butyrate, it induces G0-G1 arrest and apoptosis and increases ß-catenin/TCF activity in colon cancer cells in vitro (7) . As expected, therefore, 1.6 mM sulindac significantly increased the number of nuclei with active c-myc transcription sites (Fig. 3a)Citation . However, in contrast to butyrate, there was no decrease in the number of sites that completed elongation of c-myc RNA throughout the 24-h incubation (Fig. 3b)Citation .



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3. Effects of sulindac ({blacksquare}), 1{alpha},25-dihydroxyvitamin D3 ({diamond}), and TSA ({blacktriangleup}) on c-myc transcription in SW837 cells. a, the number of nuclear c-myc transcription sites detected in cells treated as indicated after simultaneous interrogation of initiated and elongated transcripts. Values are means; bars, SE. b, the percentage of nuclear three-color transcription sites detected after simultaneous interrogation of initiated and elongated transcripts. Values show the means (bars were omitted for clarity). *, P < 0.05, Student’s t test.

 
Alteration of steady-state c-myc mRNA levels by butyrate and sulindac were consistent with their relative effects on c-myc transcription sites. Butyrate, as has been demonstrated (8 , 9) , decreased c-myc expression (Fig. 4a)Citation , whereas sulindac increased c-myc RNA levels, again consistent with a previous observation (18) . Therefore, the recruitment of the block to transcriptional elongation by butyrate efficiently abrogated the stimulation of c-myc initiation by increased ß-catenin/TCF activity, whereas the failure of sulindac to recruit this block resulted in elevated c-myc levels. The relative effects of butyrate and sulindac on c-myc expression in SW837 cells are consistent with our previous observation in another colon cancer cell line, SW620 (19) , although it is unknown whether their effects are mediated by the same mechanism in these cells.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Modulation of steady-state c-myc RNA levels in SW837 cells. Real-time PCR analysis of the effects of 5 mM butyrate ({bullet}) and 1.6 mM sulindac ({blacksquare}; a), and 10-7 M 1{alpha},25-dihydroxyvitamin D3 ({lozenge}) and 1 µM TSA ({blacktriangleup}; b) on c-myc expression is shown. Values show the mean of triplicate measurements and are expressed relative to expression in untreated cells after normalization to GAPDH steady-state mRNA reference levels.

 
It was striking that a physiological regulator of colonic epithelial maturation, butyrate, induced a block to transcriptional elongation in c-myc, whereas a pharmacological regulator, sulindac, did not. We therefore examined the effect of 1{alpha},25-dihydroxyvitamin D3, another physiologically relevant inducer of G0-G1 arrest and apoptosis in colon cancer cells in vitro (14 , 15) , on c-myc transcription. We identified two mechanisms by which 10-7 M 1{alpha},25-dihydroxyvitamin D3 reduced c-myc expression (Fig. 4b)Citation . Consistent with its ability to reduce ß-catenin/TCF activity in colon cancer cells (15) , 1{alpha},25-dihydroxyvitamin D3 significantly reduced the number of c-myc transcription sites detected at 8 h by ~50%, and this reduction persisted to 24 h (Fig. 3a)Citation . This sustained inhibition of c-myc transcriptional initiation was a likely explanation for the persistent decrease in c-myc expression observed, although the transcriptional block to the gene did not persist past 16 h (Fig. 3b)Citation . Our demonstration of a 1{alpha},25-dihydroxyvitamin D3-induced block to c-myc transcriptional elongation is a novel finding in colon cancer cells.

To gain insight into the mechanisms underlying the transcriptional block, we investigated the effect of TSA, which, similar to butyrate, is an inhibitor of histone deacetylase (20) . TSA induces similar effects to butyrate in stimulating ß-catenin/TCF activity (7) . This was confirmed in the present study, because 1 µM TSA also induced a significant increase in the number of c-myc transcription sites detected (Fig. 3a)Citation . Furthermore, the number of c-myc transcripts undergoing full read-through was significantly reduced by TSA (Fig. 3b)Citation , suggesting that the butyrate-induced transcriptional block in c-myc was mediated, at least in part, through its ability to alter chromatin structure through histone hyperacetylation. However, this effect of TSA was observed at an earlier time point than that of butyrate and was not as sustained. A similar pattern of effect was also observed in the relative effects of butyrate and TSA on steady-state c-myc RNA levels (Fig. 4)Citation . These observations are consistent with our previous finding that TSA induces more rapid histone acetylation than butyrate, but that the resultant hyperacetylation is transient (19) .

Parallel experiments using probes that recognized three regions within human ß-actin mRNA were also performed. Neither butyrate, TSA, 1{alpha},25-dihydroxyvitamin D3 or sulindac induced a significant change in the number of ß-actin transcription sites detected by probes separately labeled with FITC, Cy3, and Cy5 (data not shown), indicating that the results obtained with the c-myc probes was not a consequence of nonspecific effects on transcription by these factors.

Through high resolution profiling of the transcriptional activity of c-myc, we have identified a striking difference in regulation of its expression between physiological regulators of colonic epithelial maturation that are chemopreventive for colon cancer and/or exert antitumorigenic effects in colon cancer cells cultured in vitro and a pharmacological agent with similar actions. Sulindac failed to induce a block to transcriptional elongation after stimulation of transcriptional initiation, leading to elevated c-myc mRNA levels. Because high levels of c-myc induces apoptosis in cells that are blocked in the cell cycle (21 , 22) , inappropriately high expression may underlie, at least in part, the long-term toxic effects of sulindac therapy observed in colon cancer patients, such as mucosal ulceration (6) .

It has been demonstrated recently that even brief inactivation of c-myc leads to a sustained regression of a neoplastic phenotype in a mouse model of osteogenic sarcoma (16) . This emphasizes the potential importance of the mechanism described here, through which butyrate and 1{alpha},25-dihydroxyvitamin D3 may act as chemopreventive agents for colon cancer. Furthermore, the technology described here, which permits highly sensitive detection of transcriptional events that result in down-regulated expression, is more generally a novel and potentially important approach for evaluating the effects of chemopreventive and chemotherapeutic treatments on the expression of c-myc and other genes critical in tumorigenesis. The use of spectrally distinct probes, especially when used in different combinations, can permit both the evaluation of multiple genes at a single-cell level (13) and multiple parameters of the transcriptional regulation of these genes, such as initiation and elongation as demonstrated here. Rapid, high-throughput transcriptional monitoring of drug effects could, when correlated with specific outcomes, become a valuable prognostic indicator for patient material.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grants CA81326, CA92713, and PO 13330 (to L. H. A.) and Grants R33CA83208 and T32GM07491 (to J. M. L. and R. H. S.) Back

2 To whom requests for reprints should be addressed, at Albert Einstein Cancer Center, Department of Oncology, Montefiore Medical Center, Hofheimer 509, 111 East 210th Street, Bronx, NY 10467. Phone: (718) 920-2093; Fax: (718) 882-4464; E-mail: awilson{at}montefiore.org Back

3 The abbreviations used are: TCF, T-cell factor; DAPI, 4',6-diamidino-2-phenylindole; FISH, fluorescence in situ hybridization; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TSA, trichostatin A; APC, adenomatous polyposis coli. Back

4 A detailed protocol of the method is available at http://protocols.singerlab.org/. Back

5 The description of the protocol used for hybridization, preparation, and storage of slides is available at http://protocols.singerlab.org/. Back

Received 5/29/02. Accepted 9/18/02.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Erisman M. D., Rothberg P. G., Diehl R. E., Morse C. C., Spandorfer J. M., Astrin S. M. Deregulation of c-myc gene expression in human colon carcinoma is not accompanied by amplification or rearrangement of the gene. Mol. Cell. Biol., 5: 1969-1976, 1985.[Abstract/Free Full Text]
  2. Morin P. J., Sparks A. B., Korinek V., Barker N., Clevers H., Vogelstein B., Kinzler K. W. Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science (Wash. DC), 275: 1787-1790, 1997.[Abstract/Free Full Text]
  3. He T. C., Sparks A. B., Rago C., Hermeking H., Zawel L., da Costa L. T., Morin P. J., Vogelstein B., Kinzler K. W. Identification of c-MYC as a target of the APC pathway. Science (Wash. DC), 281: 1509-1512, 1998.[Abstract/Free Full Text]
  4. McIntyre A., Gibson P. R., Young G. P. Butyrate production from dietary fiber and protection against large bowel cancer in a rat model. Gut, 34: 386-391, 1993.[Abstract/Free Full Text]
  5. Augenlicht L. H., Bordonaro M., Heerdt B. G., Mariadason J., Velcich A. Cellular mechanisms of risk and transformation. Ann. NY Acad. Sci., 889: 20-31, 1999.[Abstract/Free Full Text]
  6. Subbaramaiah K., Zakim D., Weksler B. B., Dannenberg A. J. Inhibition of cyclooxygenase: a novel approach to cancer prevention. Proc. Soc. Exp. Med., 216: 201-210, 1997.
  7. Bordonaro M., Mariadason J. M., Aslam F., Heerdt B. G., Augenlicht L. H. Butyrate-induced apoptotic cascade in colonic carcinoma cells: modulation of the ß-catenin-Tcf pathway and concordance with effects of sulindac and trichostatin A but not curcumin. Cell Growth Differ., 10: 713-720, 1999.[Abstract/Free Full Text]
  8. Heruth D. P., Zirnstein G. W., Bradley J. F., Rothberg P. G. Sodium butyrate causes an increase in the block to transcriptional elongation in the c-myc gene in SW837 rectal carcinoma cells. J. Biol. Chem., 268: 20466-20472, 1993.[Abstract/Free Full Text]
  9. Taylor C. W., Kim Y. S., Childress-Fields K. E., Yeoman L. C. Sensitivity of nuclear c-myc levels and induction to differentiation-inducing agents in human colon tumor cell lines. Cancer Lett., 62: 95-105, 1992.[Medline]
  10. Keene R. G., Mueller A., Landick R., London L. Transcriptional pause, arrest and termination sites for RNA polymerase II in mammalian N- and c-myc genes. Nucleic Acids Res., 27: 3173-3182, 1999.[Abstract/Free Full Text]
  11. Lawrence J. B., Singer R. H., Marselle L. M. Highly localized tracks of specific transcripts within interphase nuclei visualized by in situ hybridization. Cell, 57: 493-502, 1989.[Medline]
  12. Femino A. M., Fay F. S., Fogarty K., Singer R. H. Visualization of single RNA transcripts in situ. Science (Wash. DC), 280: 585-590, 1998.[Abstract/Free Full Text]
  13. Levsky J. M., Shenoy S. M., Pezo R. C., Singer R. H. Single-cell gene expression profiling. Science (Wash. DC), 297: 836-840, 2002.[Abstract/Free Full Text]
  14. Diaz G. D., Paraskeva C., Thomas M. G., Binderup L., Hague A. Apoptosis is induced by the active metabolite of vitamin D3 and its analogue EB1089 in colorectal adenoma and carcinoma cells: possible implications for prevention and therapy. Cancer Res., 60: 2304-2312, 2000.[Abstract/Free Full Text]
  15. Palmer H. G., Gonzalez-Sancho J. M., Espada J., Berciano M. T., Puig I., Baulida J., Quintanilla M., Cano A., de Herreros A. G., Lafarga M., Munoz A. Vitamin D(3) promotes the differentiation of colon carcinoma cells by the induction of E-cadherin and the inhibition of ß-catenin signaling. J. Cell Biol., 154: 369-387, 2001.[Abstract/Free Full Text]
  16. Jain M., Arvanitis C., Chu K., Dewey W., Leonhardt E., Trinh M., Sundberg C. D., Bishop J. M., Felsher D. W. Sustained loss of a neoplastic phenotype by a brief inactivation of. MYC. Science (Wash. DC), 297: 102-104, 2002.
  17. Kislauskis E. H., Li Z., Singer R. H., Taneja K. L. Isoform-specific 3' untranslated sequences sort {alpha}-cardiac and ß-cytoplasmic actin messenger RNAs to different cytoplasmic compartments. J. Cell Biol., 123: 165-172, 1993.[Abstract/Free Full Text]
  18. Richter M., Weiss M., Weinberger I., Furstenberger G., Marian B. Growth inhibition and induction of apoptosis in colorectal tumor cells by cyclooxygenase inhibitors. Carcinogenesis (Lond.), 22: 17-25, 2001.[Abstract/Free Full Text]
  19. Mariadason J. M., Corner G. A., Augenlicht L. H. Genetic reprogramming in pathways of colonic cell maturation induced by short chain fatty acids: comparison with trichostatin A, sulindac, and curcumin and implications for chemoprevention of colon cancer. Cancer Res., 60: 4561-4572, 2000.[Abstract/Free Full Text]
  20. Yoshida M., Kijima M., Akita M., Beppu T. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J. Biol. Chem., 265: 17174-17179, 1990.[Abstract/Free Full Text]
  21. Evan G. I., Wyllie A. H., Gilbert C. S., Littlewood T. D., Land H., Brooks M., Waters C. M., Penn L. Z., Hancock D. C. Induction of apoptosis in fibroblasts by c-myc protein. Cell, 69: 119-128, 1992.[Medline]
  22. Arango D., Corner G. A., Wadler S., Catalano P. J., Augenlicht L. H. c-myc/p53 interaction determines sensitivity of human colon carcinoma cells to 5-fluoruracil in vitro and in vivo. Cancer Res., 61: 4910-4915, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Nutr.Home page
Y. S. Kim and J. A. Milner
Dietary Modulation of Colon Cancer Risk
J. Nutr., November 1, 2007; 137(11): 2576S - 2579S.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. O. Hassa, S. S. Haenni, C. Buerki, N. I. Meier, W. S. Lane, H. Owen, M. Gersbach, R. Imhof, and M. O. Hottiger
Acetylation of Poly(ADP-ribose) Polymerase-1 by p300/CREB-binding Protein Regulates Coactivation of NF-{kappa}B-dependent Transcription
J. Biol. Chem., December 9, 2005; 280(49): 40450 - 40464.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Tong, L. Yin, S. Joshi, D. W. Rosenberg, and C. Giardina
Cyclooxygenase-2 Regulation in Colon Cancer Cells: MODULATION OF RNA POLYMERASE II ELONGATION BY HISTONE DEACETYLASE INHIBITORS
J. Biol. Chem., April 22, 2005; 280(16): 15503 - 15509.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. G. Heerdt, M. A. Houston, A. J. Wilson, and L. H. Augenlicht
The Intrinsic Mitochondrial Membrane Potential ({Delta}{psi}m) Is Associated with Steady-State Mitochondrial Activity and the Extent to Which Colonic Epithelial Cells Undergo Butyrate-mediated Growth Arrest and Apoptosis
Cancer Res., October 1, 2003; 63(19): 6311 - 6319.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. J. Wilson, D. Arango, J. M. Mariadason, B. G. Heerdt, and L. H. Augenlicht
TR3/Nur77 in Colon Cancer Cell Apoptosis
Cancer Res., September 1, 2003; 63(17): 5401 - 5407.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
L. H. Augenlicht, A. Velcich, L. Klampfer, J. Huang, G. Corner, M. Aranes, C. Laboisse, B. Rigas, M. Lipkin, K. Yang, et al.
Application of Gene Expression Profiling to Colon Cell Maturation, Transformation and Chemoprevention
J. Nutr., July 1, 2003; 133(7): 2410S - 2416.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilson, A. J.
Right arrow Articles by Augenlicht, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilson, A. J.
Right arrow Articles by Augenlicht, L. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online