Cancer Research Grants  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tolba, K. A.
Right arrow Articles by Rosenblatt, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tolba, K. A.
Right arrow Articles by Rosenblatt, J. D.
[Cancer Research 62, 6545-6551, November 15, 2002]
© 2002 American Association for Cancer Research


Experimental Therapeutics

Herpes Simplex Virus (HSV) Amplicon-mediated Codelivery of Secondary Lymphoid Tissue Chemokine and CD40L Results in Augmented Antitumor Activity1

Khaled A. Tolba2, William J. Bowers, Jacquelyn Muller, Vickie Housekneckt, Rita E. Giuliano, Howard J. Federoff and Joseph D. Rosenblatt

James P. Wilmot Cancer Center [K. A. T., J. M., V. H.], Departments of Medicine [K. A. T.], Neurology [W. J. B., H. J. F.], Microbiology and Immunology [H. J. F.], and the Center for Aging and Developmental Biology [W. J. B., R. E. G., H. J. F.], University of Rochester School of Medicine and Dentistry, Rochester, New York 14642, and Sylvester Comprehensive Cancer Center, University of Miami, Miami, Florida 33136 [J. D. R.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Development of effective antitumor immune responses depends on timely interactions of effector cells. A bimodal approach that involves coexpression of chemokines and costimulatory molecules within the tumor bed may elaborate a more optimal antitumor response. One candidate includes secondary lymphoid tissue chemokine (SLC), which promotes the colocalization of naïve, nonpolarized memory T cells and dendritic cells (DCs) within lymph nodes and Peyer’s patches. CD40L-mediated DC activation could induce maturation, enhance antigen presentation, and facilitate priming of the recruited naïve T cells. To this end, the antitumor activity of SLC and CD40L expressed singly or in combination using the herpes simplex virus (HSV)-derived amplicon was examined in two murine models: A20, a B-cell lymphoma, and CT-26, an adenocarcinoma. Administration of amplicons encoding SLC (HSV-SLC) into s.c. tumors established previously resulted in heavy infiltration of CD4+ and CD8+ T cells, and DCs, and the generation of cytolytic T-cell activity. Combined transduction of either tumor with HSV-SLC and HSV-CD40L resulted in a more enhanced antitumor activity that was CD8+ T cell-dependent than observed with either vector alone. mRNA expression of the Th1 markers IFN-{gamma}, perforin, and interleukin 12 was detectable only in transduced regressing tumors. In addition to identifying a potent antitumor immune strategy, we show that amplicon-mediated SLC and CD40L delivery may mimic lymph node conditions necessary for priming naïve T cells within the tumor bed, and demonstrate the importance of DC activation status on antigen presentation and cytokine expression for priming of newly recruited T cells.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The elaboration of functional immune responses requires fine-tuned interactions of multiple immune effector cell types, including APCs3 and different subsets of T cells. Because of the low progenitor frequency and short half-life of any particular APC, the process of APC/T-cell interaction is designated to occur at specific anatomical locations, the secondary lymphoid organs (1 , 2) . To maximize the probability that a particular antigen-loaded APC will encounter its cognate antigen-specific T cell, an organizational hierarchy has evolved to couple the migratory abilities of different cellular subsets to their functional role in an immune response. This is mediated through the capacity of different tissues either constitutively or in response to extrinsic stimuli to release an array of chemokines and a highly flexible capacity to up- or down-regulate receptors corresponding to these chemokines (3 , 4) .

Antigen capture, processing, and presentation to naïve T cells within the LN are prime examples of this highly coordinated trafficking process. Important components of this process are immature DCs that survey peripheral tissues and capture antigen before honing to secondary lymphoid tissues (5) . Efficient retrieval and transport of DCs into T cell-rich areas of the LN are central to the development of an immune response and are primarily mediated by two chemokines, SLC (6) and ELC (7) , which engage a single receptor, CCR7. During the transition from peripheral tissue to the LN, DCs undergo maturation and become more efficient at presenting antigen to T cells. This maturation process includes enhanced expression of the CCR7 receptor and renders mature DCs highly responsive to the SLC gradient (8, 9, 10) . In the T-cell area of the LN, DCs encounter two types of T cells also expressing the CCR7 receptor, naïve T cells and a subset of memory T cells known as central memory (Tcm) that can be readily activated on exposure to recall antigens captured by DCs (11) . The SLC/CCR7 axis is crucial for the T-cell/DC interaction in T-cell areas of the LN and generation of an immune response. This has been confirmed in mice deficient for either SLC (12) or CCR7 expression (13) .

We hypothesized that local elaboration of SLC would be effective in augmenting antitumor immune responses, in part by promoting the recruitment of naïve T cells and colocalization of such T cells with mature APCs. In this report, we studied the antitumor activity of SLC alone and in combination with the CD40L costimulatory ligand. CD40L, a member of the TNF superfamily, is a type II transmembrane glycoprotein transiently expressed on antigen-activated CD4+ T cells. Acting through its receptor CD40, CD40L plays a central role in activating APCs including DCs, monocytes, and B cells, and initiation of antigen-specific immune responses (14) . SLC and CD40L were administered to mice using an HSV amplicon vector, a gene delivery platform shown previously to be amenable for tumor immunotherapy (15 , 16) . Using two different murine tumor models, we examined the immune effector cell infiltrate, cytokine mRNA expression within the tumor bed, and the antitumor responses that resulted from high-level SLC and/or CD40L expression within the tumor environment.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Amplicon Packaging.
A20 and CT-26 cells were grown in vitro in RPMI 1640 (DMEM for CT-26) medium supplemented with 10% FCS, penicillin (50 units/ml), streptomycin (50 µg/ml), L-glutamine (2 mM/ml), and ß-mercaptoethanol (50 µM/ml), and maintained in culture at 37°C at 5% CO2 atmosphere. The cDNA for murine SLC and CD40 were cloned into the HSV amplicon plasmid, HSVPrPUC (17) . HSVlac, a ß-galactosidase-expressing control amplicon, has been described previously (18) . HSV amplicon vectors were packaged and titered as described previously (15) .

Detection of SLC Produced by A20 Tumor Cells.
A20 cells were transduced with HSVlac, HSV-SLC at an MOI of 3, or left nontransduced, and 48 h later supernatant was collected for ELISA using polyclonal rabbit antimouse SLC as a capture antibody and biotinylated polyclonal rabbit antimouse SLC antibody for detection (both from R&D Systems, Minneapolis, MN). The biological activity of secreted SLC was confirmed in a two-chamber transmigration assay using naïve T cells purified from BALB/c mice spleens. T cells (107) were suspended in RPMI 1640 with 10% FCS and added to the top chambers of triplicate wells of a Transwell plate (Costar, Cambridge, MA). Supernatants from untreated A20 cells, or A20 cells transduced with HSVlac or HSV-SLC at an MOI of 3, as well recombinant SLC protein at 100 ng/ml were added in triplicates to the bottom chamber of the Transwell plate. After a 4-h incubation, transmigrating T cells were collected from the bottom chamber and enumerated.

IHC for CD4+ and CD8+ T Cells.
Established A20 tumors were left nontransduced or transduced with HSVlac or HSV-SLC (3.5 x 106 amplicon particles), and 96 h later the mice were sacrificed and tumors dissected, embedded in OCT, and snap-frozen in liquid nitrogen. Tissue sections (10 µm) were fixed in acetone and incubated in 1% H2O2 for 15 min before adding goat serum to block nonspecific binding. The slides were washed in PBS three times before adding specific hamster antimouse CD4- or CD8-specific primary antibody (BD PharMingen, San Diego, CA) for 1 h. This incubation was followed by addition of biotinylated goat antihamster secondary antibody (Vector Laboratories, Burlingame, CA), and developed by streptavidin-peroxidase (ABC kit; Vector Laboratories). Enzymatic reaction conditions used to detect antibody staining were performed as suggested by the manufacturer.

Tumor Establishment and Vector Injection.
A20 and CT-26 cells were cultured in vitro as described above, and subsequently 106 cells were injected s.c. into the right and/or left flank of 6–8-week-old BALB/c mice (Jackson Laboratory). Developing tumors were monitored twice weekly by measuring tumor diameter. Tumors were injected with HSV-SLC, HSV-CD40L, or a combination of both amplicons, or control HSVlac when the tumors reached a diameter of 5 mm. HSV amplicon stocks were diluted in PBS before injection, and 100 µl containing 3.5 x 106 amplicons was used in the direct intratumoral inoculations. Mock treatment controls received intratumoral injections of sterile PBS.

FACS Analysis of Tumor-infiltrating T Cells and DCs.
Established A20 tumors were either left nontransduced or transduced with HSVlac or HSV-SLC (3.5 x 106 amplicon particles), and 96 h later the mice were sacrificed. Each tumor was dissociated into a single cell suspension and washed twice in PBS. Fc receptors were blocked using Fc-Block CD16/CD32 antibody (BD PharMingen), and cells were stained with phycoerythrin-labeled anti-CD4 (GK1.5), anti-CD8a (53–5.8), and anti-CD11c (HL3; all from BD PharMingen). Labeled cells were studied by FACS analysis for T cells and DC infiltration using a FACScan flow-cytometer and CellQuest software (BD Bioscience, Mountain View, CA).

CTL Assay.
Splenocytes were harvested from mice that had eradicated their tumors in response to delivery of HSV-SLC, HSV-CD40L, or a combination of both amplicons, as well as from control mice treated with HSVlac or mock-treated. Red blood cells were lysed using AKC buffer, and the splenocytes were washed before being incubated with irradiated A20 cells at a ratio of 4:1 for 6 days in RPMI 1640 supplemented with 10% FCS and glutamine penicillin streptomycin (no IL-2 added). CTL activity was assayed using a standard chromium release assay by incubating the splenocytes with 51Cr-labeled A20 cells in triplicates wells of a V-shaped 96-well plate at the following E:T ratios (60:1, 20:1, 6:1, 2:1, and 1:1). After a 4-h incubation, the supernatant was collected, and radioactivity was measured using a gamma counter.

T-Cell Subset Depletion.
For CD4+ and CD8+ T-cell depletion, mice were injected i.p. with 100 µg of anti-CD4 (clone Gk 1.5) or anti-CD8 (clone 53–6.7) in 100 µl of PBS (both antibodies from PharMingen) 5 days before tumor inoculation. This resulted in >95% depletion of the respective T-cell subset for >2 weeks (data not shown).

RT-PCR Analysis of Intratumoral Cytokine Gene Expression.
Regressing A20 tumors obtained from animals treated with local injection of HSV-SLC, HSV-CD40L, or a combination of HSV-SLC plus HSV-CD40L amplicons, and nonregressing tumors from control animals treated with either HSVlac or untransduced tumors were dissected and lysed for RNA extraction, and whole tumor RNA was isolated. After DNase treatment (Life Technologies, Inc.), 5 µg of total RNA were used to generate first strand cDNA using oligodeoxythymidylic acid (Pharmacia, Uppsala, Sweden) as a primer and Superscript II (Life Technologies, Inc.) for reverse transcription. Two µl of the reverse transcription reaction was used as a PCR template using the following set of primers: ß-actin: 5' GTTGCTATCCAGGCTGTGCT, 3' CGGATGTCCACGTCACAC TT; T-cell receptor {delta} chain: 5' CCTGCAATACCAGCGTCATGC, 3' GAACCTCAGCAGCCC CAGAAG; perforin: 5': CAGAATGCAAGCAGAAGCACA AG, 3': GGTGGAGTGGAGGTTTTTGTA CC; IFN-{gamma}: 5': CATTGAAAGCCTAGAAAG TCT G, 3': CTCATGAATGCATCCTTTTTC G; IL-12 p35: 5': GATCATGAAGACATCACACGG, 3': AGAATGATCTGCTGATGGTTG; and IL-12 p40: 5': ATGTGTCCTCAGAAGCTAACCATC, 3': AACCGTCCGGAGTAATTTGGTGCT. PCR was performed under the following conditions: 94°C for 5 min followed by 30 cycles (25 for ß-actin) of 1 min denaturation at 94°C, 30 s annealing at 59°C, and 1 min amplification at 72°C followed by 10 min extension at 72°C.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We hypothesized that local elaboration of SLC expression in the tumor bed would result in enhanced antitumor immune responses because of recruitment of APC influx. To confirm sensitivity of tumor cells to transduction by HSV amplicons, A20 cells were transduced in vitro with HSV amplicons, and expression of SLC was confirmed by ELISA (Table 1)Citation and that of CD40L by flow-cytometry (data not shown). The chemotactic activity of amplicon-expressed SLC was demonstrated in a two-chamber transmigration assay (Fig. 1)Citation . Two ml of supernatant from transduced A20 cultures (containing roughly 10 ng/ml of amplicon-derived SLC) was added to each well, whereas recombinant SLC (100 ng/ml; R&D Systems) was used as a positive control. We noted consistently that SLC generated by amplicon-transduced A20 cells was more biologically active in the two-chamber transmigration assay than the reconstituted recombinant protein that was produced in Escherichia coli. This observation may reflect differential post-translational modification of the two SLC sources.


View this table:
[in this window]
[in a new window]

 
Table 1 Concentration of SLC in supernatants of A20 tumor cell cultures 48 h after transduction with either HSVlac or HSV-SLC

 


View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. In vitro transmigration in response to HSV-SLC transduced A20 B-lymphoma cells. Supernatant samples from nontransduced A20 cells or A20 cells transduced for 48 h with either HSVlac or HSV-SLC at an MOI of 3 were added to the lower chamber of a transmigration plate. T cells (107) were added to the upper chamber, and 4 h later transmigrating cells were collected from the lower chamber and enumerated. Recombinant SLC (rSLC) was used as a positive control in this assay; bars, ±SD (n = 3).

 
To examine the immune cell recruitment activity of HSV-SLC in vivo, pre-established A20 and CT-26 tumors in BALB/c mice were injected with HSVlac, HSV-SLC, or were mock transduced, and 48 and 96 h later, animals were sacrificed and studied by IHC for infiltrating CD4+ and CD8+ T cells. IHC analysis illustrated that qualitatively higher numbers of CD4+ and CD8+ T cells were recruited into tumors injected with HSV-SLC than observed in the mock and HSVlac-injected tumors (Fig. 2)Citation . A modest increase in CD4+ and CD8+ T-cell density was seen in HSVlac-injected tumors as compared with mock-infused tumors possibly because of an inflammatory reaction generated by HSV amplicon infusion (19) . Quantitation of infiltrating DCs, and CD4+ and CD8+ T-cell numbers was performed using flow cytometric analysis of single-cell suspensions generated from these treated tumors (Table 2)Citation . We observed significantly higher numbers of CD11c+ DCs in HSV-SLC-injected tumors as compared with mock and HSVlac-injected tumors. Additionally, we confirmed the increase in CD4+ and CD8+ T-cell infiltration as visualized by IHC for HSV-SLC (Table 2)Citation .



View larger version (101K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Immunohistochemical assessment of CD4+ and CD8+ T cells infiltrating A20 tumors in response to amplicon-delivered SLC. Nontransduced A20 tumors (A and D) and A20 tumors transduced 48 h earlier with either HSVlac (B and E) or HSV-SLC (C and F) were sectioned and immunocytochemically stained for CD4+ T cells (A–C) and CD8+ T cells (D–F). The magnification at which the photomicrographs were obtained was x40.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Percentage of tumor-infiltrating CD4+, CD8+ T cells, and CD11c+DCs as a result of intratumoral infusion of HSV amplicon vectors expressing SLC or the ß-galactosidase reporter gene product

 
Antitumor Activity of HSV-SLC and HSV-CD40L.
The ability of HSV-SLC to enhance antitumor immune responses was subsequently assessed using two in vivo tumor types, the A20 B-cell lymphoma and the CT-26 adenocarcinoma models. As a point of reference, we compared the antitumor activity of SLC with a previously described amplicon expressing the CD40L costimulatory ligand (HSV-CD40L). CD40L plays a central role in activating APCs including DCs, monocytes, and B cells, and initiation of antigen-specific immune responses. Pre-established A20 and CT-26 tumors were injected directly with HSVlac, HSV-SLC, or HSV-CD40L twice a week, or were left nontreated. Tumor size was monitored twice a week, and mice were sacrificed when tumor size exceeded 20 mm in one diameter or if the animal showed signs of distress. In mice bearing A20 tumors, 4 of 5 mice treated with HSV-SLC eradicated their tumors, whereas 5 of 6 mice eradicated their A20 tumor after treatment with HSV-CD40L (Fig. 3A)Citation . In contrast, of the mice receiving HSVlac or mock treatment exhibited progressive tumor growth resulting in their eventual sacrifice (Fisher’s exact test, P < 0.05). Similarly, in the CT-26 tumor model treatment with HSV-SLC or HSV-CD40L resulted in a significantly reduced growth rate as compared with that observed in mice receiving HSVlac or untreated mice (Fig. 3BCitation ; Fisher’s exact test, P < 0.05).



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Antitumor activity of HSV-SLC and HSV-CD40L. Pre-established A20 (A) or CT-26 (B) tumors were transduced with HSVlac, HSV-SLC, HSV-CD40L, or left untreated, and tumor growth was monitored twice a week. In the A20 tumor model, 80 and 83% of HSV-SLC- or HSV-CD40L-treated mice, respectively, eradicated their tumors. In CT-26 tumors, treatment with HSV-SLC or HSV-CD40L appeared to slow the rate of tumor growth as compared with mice in the two control groups. bars, ±SD.

 
Cooperative Antitumor Activity of Combined HSV-SLC and HSV-CD40L Administration.
Because a primary function of SLC is to recruit DCs, and CD40L activates APCs including DCs, we reasoned that local expression of CD40L on tumor cells via an amplicon vector would activate recruited DCs. To test this hypothesis, we treated A20 and CT-26 tumor-bearing mice with HSVlac, HSV-SLC, HSV-CD40L, or with a combination of HSV-SLC and HSV-CD40L amplicons in a 1:1 ratio. In mice with unilateral A20 tumors, given the high frequency of tumor eradication in response to intratumoral injection of HSV-SLC or HSV-CD40L, we could not demonstrate an added benefit of the SLC/CD40L combination in unilaterally implanted and injected tumors (Fig. 4ACitation ; {chi}2 = 0.433 (2 degrees of freedom), P = 0.81). In mice that had cleared the A20 tumors after amplicon infusion, a contralateral tumor rechallenge was performed. This rechallenge represented one means to examine elicitation of systemic antitumoral immunity. On day 40 of the experiment, mice were rechallenged contralaterally with 106 A20 cells. Again, we were unable to demonstrate an added benefit of the SLC/CD40L combination.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Cooperative antitumor activity of HSV-SLC and HSV-CD40L in the A20 tumor model. Unilateral (A) and bilateral (B) A20 tumors were implanted in BALB/c mice, and the right-sided tumors received intratumoral injections of HSVlac, HSV-SLC, HSV-CD40L, a combination of HSV-SLC and HSV-CD40L, or were left untreated, and tumor growth/size was monitored twice a week. For unilateral tumors, no additional benefit was gained when combining HSV-CD40L and HSV-SLC as compared with either vector alone. In bilateral tumors, the combination of HSV-SLC and HSV-CD40L was associated with significantly improved survival.

 
In a separate study paradigm, bilateral A20 tumors were established, and mice subsequently received unilateral intratumoral injections of HSV-SLC and/or HSV-CD40L. Animals treated with a combination of HSV-SLC plus HSV-CD40L exhibited significantly improved survival profiles as compared with treatment with either HSV-SLC or HSV-CD40L alone (Fig. 4BCitation ; Fisher’s exact test, P = 0.03). A statistically significant difference was also observed between treatment with either HSV-SLC or HSV-CD40L as compared with either of the two control arms (Fig. 4BCitation ; Fisher’s exact test, P < 0.05). In mice bearing CT-26 tumors, the combination of HSV-SLC plus HSV-CD40L was successful at eradicating tumor in 3 of 6 tumor-bearing mice, whereas the single amplicon vector treatments reduced the tumor size but did not eradicate any pre-established tumors (Fig. 5)Citation . This CT-26 tumor survival data trended toward improvement with the combination of HSV-SLC and HSV-CD40L, as compared with either HSV-SLC or HSV-CD40L alone, but did not reach statistical significance (Fisher’s exact test, P = 0.1).



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Cooperative antitumor activity of HSV-SLC and HSV-CD40L in the CT-26 tumor model. CT26 tumors were implanted on the right flank of BALB/c mice, and 5 groups of 6 mice per arm received HSVlac, HSV-SLC, HSV-CD40L, a combination of HSV-SLC and HSV-CD40L, or were left untreated, and tumor growth/size was monitored twice a week. Three of 6 mice treated with the combination of HSV-SLC and HSV-CD40L eradicated their tumors, whereas 1 mouse in the HSV-SLC group also eradicated its tumor. The remaining mice that were treated with either HSV-SLC or HSV-CD40L did not completely resolve their tumors but did experience a longer survival outcome than animals in the two control groups.

 
To investigate the roles of CD4+ and CD8+ T-cell subsets in HSV-SLC/HSV-CD40L-mediated tumor regression, groups of BALB/c mice were depleted of CD4+ or CD8+ T-cell subsets, and 5 days later were inoculated with A20 tumors. A20 tumors exhibited similar growth kinetics in CD4+ and CD8+ T cell-depleted mice as seen in normal BALB/c mice (Fig. 6Citation ; data not shown). When tumor size reached 5 mm, groups of mice (4 per arm) were treated with HSVlac, HSV-SLC, HSV-CD40L, a combination of HSV-SLC/HSV-CD40L, or were mock treated, and tumor size was measured twice weekly. As Fig. 6ACitation illustrates, CD4+ T-cell depletion did not negatively impact the antitumor activity of HSV-SLC, HSV-CD40L, or the combination of HSV-SLC/HSV-CD40L, where 3 of 4 mice had eradicated their tumors. However, CD8+ T-cell depletion significantly diminished antitumor activity, as only 1 of 4 mice eradicated their tumor after treatment with HSV-SLC, HSV-CD40L, or the combination of HSV-SLC/HSV-CD40L (Fig. 6B)Citation . In aggregate, these data indicate that the antitumor effects exhibited by amplicon-mediated SLC and/or CD40L treatments require CD8+ T-cell function.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Effect of CD4+ and CD8+ T-cell depletion on HSV-SLC- and/or HSV-CD40L-mediated antitumor activity. A20 tumors were implanted into the right flank of CD4+ (A) or CD8+ (B) T cell-depleted mice and treated with HSVlac, HSV-SLC, HSV-CD40L, a combination of HSV-SLC/HSV-CD40L, or were mock treated and followed for 9 weeks.

 
Generation of CTL Activity from Splenocytes of Responding Mice.
Because the T-cell depletion studies indicated that CD8+ T cells were responsible for the observed antitumor activity, we subsequently determined whether tumor-specific CTL function was present. To that end, splenocytes from A20 and CT-26 tumor-bearing mice receiving HSV-SLC and/or HSV-CD40L, as well as from mice in the two control arms, were assayed for CTL activity in a standard chromium release assay. As shown in Fig. 7Citation , mice receiving HSV-SLC, HSV-CD40L, or both amplicons exhibited enhanced CTL activity as compared with those mice that had received HSVlac or mock treatment.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Generation of CTL activity in mice that had eradicated A20 and CT-26 tumors. Splenocytes from tumor-bearing and tumor-free mice were primed in vitro for 6 days before incubation with 51Cr-labeled A20 (A) or CT-26 (B) target cells in a 51Cr-release CTL assay. The data from 1 representative animal from each experimental group are plotted.

 
Study of Cytokine mRNA Expression Profiles in Regressing Tumors.
To additionally characterize the in situ-generated immune response, we purified RNA from tumors excised from mice in each of the treatment arms and performed RT-PCR for the detection of several cytokines. We were able to amplify the {delta}-chain of CD3 in all of the tumor samples indicating the presence of infiltrating T cells and also detected mRNA encoding the p35 subunit of IL-12, which is constitutively expressed by most cells including APCs and natural killer cells (Fig. 8)Citation . Only regressing tumors treated with HSV-SLC, HSV-CD40L, or a combination of both amplicons expressed detectable mRNA levels for IFN-{gamma}, perforin, and the inducible p40 subunit of IL-12 (Fig. 8)Citation . In aggregate, these data indicate that local elaboration of SLC and/or CD40L via an amplicon vector leads to the induction of a Th1-like cascade and activation of T cells that culminates in the generation of a potent antitumor response.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. RT-PCR analysis of intratumoral cytokine gene expression after amplicon administration. Mice that had received A20 tumor cell implantations were infused with HSVlac, HSV-SLC, HSV-CD40L, a combination of HSV-SLC and HSV-CD40L, or were left untreated. Seven days later the animals were sacrificed, total RNA extracted, reverse transcribed, and used as a template for PCR for CD3 {delta}-chain, perforin, IFN-{gamma}, the IL-12 p35 and p40 subunits, and the internal control ß-actin.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation of an antitumor immune response is a complex process dependent on coordinate interaction of different subsets of effector cells. DCs play a central role in this event through a series of functions including antigen capture, processing, up-regulation of costimulatory signal, and migration to lymphoid tissue that culminates in antigen presentation to the T cell (20) . This process is orchestrated through timely expression of different subsets of chemokines and their cognate receptors on DCs, which is closely linked to the DC maturation stage (21 , 22) . The latter is influenced by signals arising from bacterial and viral by-products of inflammation, cytokines, and costimulatory signals derived from monocytes, T cells, stromal cells, and DCs within the local microenvironment (22, 23, 24) .

Previous work demonstrated that SLC chemotactic activity for DCs and T cells could be harnessed to generate antitumor immune responses (25, 26, 27) . We reasoned that such an activity could be additionally improved on by in situ activation of recruited DCs via local expression of CD40L. Physiologically, SLC serves to guide mature antigen-loaded DCs from peripheral tissues to the T-cell area of the LN where two subsets of T cells, naïve and central memory T cells, reside. Local elaboration of SLC within the tumor bed could theoretically reproduce the LN conditions shown to be conducive for effective T-cell priming. We asked specifically whether DC-mediated CD8+ T-cell priming within the tumor could be enhanced additionally by the extrinsic provision of CD40L.

It is well established that DCs require CD4+ T-cell help to properly cross-prime CD8+ T cells, a process dependent on stimulation of the CD40 receptor on DCs by transiently expressed CD40L from CD4+ T cells (28) . This "licensing" step is crucial in determining the outcome of the DC/CD8+ T-cell interaction: whether it leads to priming or the induction of tolerance. CD40L also provides the primary stimulus for induction of IL-12 by maturing DCs (29, 30, 31) , a feature that sets CD40L apart from most other maturation stimuli such as TNF-{alpha}, IL-1, or FasL. Animals injected with HSV-SLC alone successfully mounted an antitumor immune response although to a lesser degree than that observed with the combination treatment of HSV-SLC and HSV-CD40L. In the absence of HSV-CD40L infusion, DCs are dependent on native proinflammatory stimuli (TNF-{alpha} and IL-1) within the tumor for maturation, possibly arising from the codelivered HSV helper virus that has been shown previously to induce local inflammation (32) .

On the basis of these results, we suggest the following model to illustrate the sequence of events triggered by transduction with HSV amplicons encoding SLC and/or CD40L. Initial treatment of the A20 or CT-26 tumors with the HSV amplicon triggers an inflammatory response possibly mediated by the virus itself. This is reflected in the modest increase in numbers of infiltrating CD4+ and CD8+ T cells in tumors injected with HSVlac over nontransduced tumors (Fig. 2)Citation . Proinflammatory cytokines (TNF-{alpha} and IL-1) and chemokines released in that setting can up-regulate adhesion molecules on endothelial cells that recruit neutrophils, macrophages, and immature DCs (33, 34, 35) . In tumors treated with HSV-SLC, incremental numbers of CCR7+ T cells and mature DCs are recruited as well (Fig. 2Citation ; Table 2Citation ). Although mature DCs are less efficient at capturing antigen, they are an abundant source of inflammatory chemokines including macrophage inflammatory protein 1{alpha}, macrophage inflammatory protein 1ß, MCP-1, -2, -4, and RANTES (36) . These chemokines may establish a positive feed forward loop that can additionally recruit immature DCs, monocytes, and natural killer cells beyond what is initially mediated by viral by-products. The ensuing positive reinforcement could provide for adequate capture and presentation of tumor antigens.

As mentioned above, two subsets of T cells express the CCR7 receptor and are responsive to SLC recruitment, namely naïve T cells and central memory T cells. Whereas the CCR7+ central memory T cells are readily activated after brief interaction with APCs into effector T cells, naïve T cells require more prolonged T-cell receptor signaling and costimulation to develop into effector T cells (11) . It is plausible that the antitumor activity of HSV-SLC is derived primarily from priming and expansion of the central memory T-cell subset. In mice treated with the combination of HSV-SLC and HSV-CD40L, the availability of high-level CD40L expression optimizes DC maturation and partially reproduces the LN conditions necessary for naïve T-cell transition into effector cells, as the latter might contribute to the augmented antitumor effect seen with combination treatment.

In summary, our work outlines a comprehensive immune therapy strategy applicable for both hematologic and solid tumors based on cooperative interaction of multiple effector cell types. This strategy may overcome functional immune impairment observed in patients with advanced malignancy by facilitating the recruitment, activation, and expansion of naïve and central memory T cells.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a Lymphoma Research Foundation Award and Wilmot Foundation for Cancer Research fellowship (to K. A. T.), NIH 1RO1CA87978-01, NIH-1R01CA74273, Leukemia/Lymphoma Society Translational Research Award (to J. D. R. and K. A. T.), NIH R01-NS36420A (to H. J. F.), and the Rochester Nathan Shock Center for Excellence. Back

2 To whom requests for reprints should be addressed, at James P. Wilmot Cancer Center, 601 Elmwood Avenue, Rochester, NY 14642. Phone: (585) 275-2222, extension 2825; Fax: (585) 273-1051; E-mail: ktolba{at}mac.com Back

3 The abbreviations used are: APC, antigen-presenting cell; LN, lymph node; DC, dendritic cell; SLC, secondary lymphoid tissue chemokine; ELC, EBV-induced molecule 1 ligand chemokine; TNF, tumor necrosis factor; IL, interleukin; HSV, herpes simplex virus; MOI, multiplicity of infection; FACS, fluorescence-activated cell sorter; RT-PCR, reverse transcription-PCR; IHC, immunohistochemistry. Back

Received 6/13/02. Accepted 9/20/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Goodnow C. C. Chance encounters and organized rendezvous. Immunol. Rev., 156: 5-10, 1997.[Medline]
  2. Steinman R. M., Pack M., Inaba K. Dendritic cells in the T-cell areas of lymphoid organs. Immunol. Rev., 156: 25-37, 1997.[Medline]
  3. Moser B., Loetscher P. Lymphocyte traffic control by chemokines. Nat. Immunol., 2: 123-128, 2001.[Medline]
  4. Sallusto F., Mackay C. R., Lanzavecchia A. The role of chemokine receptors in primary, effector, and memory immune responses. Annu. Rev. Immunol., 18: 593-620, 2000.[Medline]
  5. Mellman I., Steinman R. M. Dendritic cells: specialized and regulated antigen processing machines. Cell, 106: 255-258, 2001.[Medline]
  6. Saeki H., Moore A., Brown M., Hwang S. Cutting edge: secondary lymphoid-tissue chemokine (SLC) and CC chemokine receptor 7 (CCR7) participate in the emigration pathway of mature dendritic cells from the skin to regional lymph nodes. J. Immunol., 162: 2472-2475, 1999.[Abstract/Free Full Text]
  7. Baekkevold E. S., Yamanaka T., Palframan R. T., Carlsen H. S., Reinholt F. P., von Andrian U. H., Brandtzaeg P., Haraldsen G. The CCR7 ligand elc (CCL19) is transcytosed in high endothelial venules and mediates T cell recruitment. J. Exp. Med., 193: 1105-1112, 2001.[Abstract/Free Full Text]
  8. Chan V. W., Kothakota S., Rohan M. C., Panganiban-Lustan L., Gardner J. P., Wachowicz M. S., Winter J. A., Williams L. T. Secondary lymphoid-tissue chemokine (SLC) is chemotactic for mature dendritic cells. Blood, 93: 3610-3616, 1999.[Abstract/Free Full Text]
  9. Hirao M., Onai N., Hiroishi K., Watkins S. C., Matsushima K., Robbins P. D., Lotze M. T., Tahara H. CC chemokine receptor-7 on dendritic cells is induced after interaction with apoptotic tumor cells: critical role in migration from the tumor site to draining lymph nodes. Cancer Res., 60: 2209-2217, 2000.[Abstract/Free Full Text]
  10. Kellermann S. A., Hudak S., Oldham E. R., Liu Y. J., McEvoy L. M. The CC chemokine receptor-7 ligands 6Ckine and macrophage inflammatory protein-3 ß are potent chemoattractants for in vitro- and in vivo-derived dendritic cells. J. Immunol., 162: 3859-3864, 1999.[Abstract/Free Full Text]
  11. Sallusto F., Lenig D., Forster R., Lipp M., Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature (Lond.), 401: 708-712, 1999.[Medline]
  12. Gunn M., Kyuwa S., Tam C., Kakiuchi T., Matsuzawa A., Williams L., Nakano H. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J. Exp. Med., 189: 451-460, 1999.[Abstract/Free Full Text]
  13. Forster R., Schubel A., Breitfeld D., Kremmer E., Renner-Muller I., Wolf E., Lipp M. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell, 99: 23-33, 1999.[Medline]
  14. Grewal I., Flavell R. CD40 and CD154 in cell-mediated immunity. Annu. Rev. Immunol., 16: 111-135, 1998.[Medline]
  15. Kutubuddin M., Federoff H., Challita-Eid P., Halterman M., Day B., Atkinson M., Planelles V., Rosenblatt J. Eradication of pre-established lymphoma using herpes simplex virus amplicon vectors. Blood, 93: 643-654, 1999.[Abstract/Free Full Text]
  16. Toda M., Martuza R. L., Kojima H., Rabkin S. D. In situ cancer vaccination: an IL-12 defective vector/replication-competent herpes simplex virus combination induces local and systemic antitumor activity. J. Immunol., 160: 4457-4464, 1998.[Abstract/Free Full Text]
  17. Geller A., Keyomarsi K., Bryan J., Pardee A. An efficient deletion mutant packaging system for defective herpes simplex virus vectors: potential applications to human gene therapy and neuronal physiology. Proc. Natl. Acad. Sci. USA, 87: 8950-8954, 1990.[Abstract/Free Full Text]
  18. Geller A., Freese A. Infection of cultured central nervous system neurons with a defective herpes simplex virus 1 vector results in stable expression of Escherichia coli ß-galactosidase. Proc. Natl. Acad. Sci. USA, 87: 1149-1153, 1990.[Abstract/Free Full Text]
  19. Geschwind M., Kessler J., Geller A., Federoff H. Transfer of the nerve growth factor gene into cell lines and cultured neurons using a defective herpes simplex virus vector. Transfer of the NGF gene into cells by a HSV-1 vector. Brain Res. Mol. Brain Res., 24: 327-335, 1994.[Medline]
  20. Banchereau J., Steinman R. M. Dendritic cells and the control of immunity. Nature (Lond.), 392: 245-252, 1998.[Medline]
  21. Sallusto F., Lanzavecchia A. Understanding dendritic cell and T-lymphocyte traffic through the analysis of chemokine receptor expression. Immunol. Rev., 177: 134-140, 2000.[Medline]
  22. Allavena P., Sica A., Vecchi A., Locati M., Sozzani S., Mantovani A. The chemokine receptor switch paradigm and dendritic cell migration: its significance in tumor tissues. Immunol. Rev., 177: 141-149, 2000.[Medline]
  23. Sozzani S., Allavena P., D’Amico G., Luini W., Bianchi G., Kataura M., Imai T., Yoshie O., Bonecchi R., Mantovani A. Differential regulation of chemokine receptors during dendritic cell maturation: a model for their trafficking properties. J. Immunol., 161: 1083-1086, 1998.[Abstract/Free Full Text]
  24. Sozzani S., Allavena P., Vecchi A., Mantovani A. The role of chemokines in the regulation of dendritic cell trafficking. J. Leukoc. Biol., 66: 1-9, 1999.[Abstract]
  25. Sharma S., Stolina M., Luo J., Strieter R., Burdick M., Zhu L., Batra R., Dubinett S. Secondary lymphoid tissue chemokine mediates T cell-dependent antitumor responses in vivo. J. Immunol., 164: 4558-4563, 2000.[Abstract/Free Full Text]
  26. Vicari A., Ait-Yahia S., Chemin K., Mueller A., Zlotnik A., Caux C. Antitumor effects of the mouse chemokine 6Ckine/SLC through angiostatic and immunological mechanisms. J. Immunol., 165: 1992-2000, 2000.[Abstract/Free Full Text]
  27. Kirk C., Hartigan-O’Connor D., Nickoloff B., Chamberlain J., Giedlin M., Aukerman L., Mule J. T cell-dependent antitumor immunity mediated by secondary lymphoid tissue chemokine: augmentation of dendritic cell-based immunotherapy. Cancer Res., 61: 2062-2070, 2001.[Abstract/Free Full Text]
  28. Albert M. L., Sauter B., Bhardwaj N. Dendritic cells acquire antigen from apoptotic cells and induce class I-restricted CTLs. Nature (Lond.), 392: 86-89, 1998.[Medline]
  29. Macatonia S., Hosken N., Litton M., Vieira P., Hsieh C., Culpepper J., Wysocka M., Trinchieri G., Murphy K., O’Garra A. Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J. Immunol., 154: 5071-5079, 1995.[Abstract]
  30. Cella M., Scheidegger D., Palmer-Lehmann K., Lane P., Lanzavecchia A., Alber G. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med., 184: 747-752, 1996.[Abstract/Free Full Text]
  31. Koch F., Stanzl U., Jennewein P., Janke K., Heufler C., Kampgen E., Romani N., Schuler G. High level IL-12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J. Exp. Med., 184: 741-746, 1996.[Abstract/Free Full Text]
  32. Krisky D., Wolfe D., Goins W., Marconi P., Ramakrishnan R., Mata M., Rouse R., Fink D., Glorioso J. Deletion of multiple immediate-early genes from herpes simplex virus reduces cytotoxicity and permits long-term gene expression in neurons. Gene Ther., 5: 1593-1603, 1998.[Medline]
  33. Groves R., Allen M., Ross E., Barker J., MacDonald D. Tumour necrosis factor {alpha} is pro-inflammatory in normal human skin and modulates cutaneous adhesion molecule expression. Br. J. Dermatol., 132: 345-352, 1995.[Medline]
  34. Groves R., Ross E., Barker J., Ross J., Camp R., MacDonald D. Effect of in vivo interleukin-1 on adhesion molecule expression in normal human skin. J. Investig. Dermatol., 98: 384-387, 1992.[Medline]
  35. Haraldsen G., Kvale D., Lien B., Farstad I., Brandtzaeg P. Cytokine-regulated expression of E-selectin, intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) in human microvascular endothelial cells. J. Immunol., 156: 2558-2565, 1996.[Abstract]
  36. Sallusto F., Palermo B., Lenig D., Miettinen M., Matikainen S., Julkunen I., Forster R., Burgstahler R., Lipp M., Lanzavecchia A. Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur. J. Immunol., 29: 1617-1625, 1999.[Medline]



This article has been cited by other articles:


Home page
J. Virol.Home page
C.-m. Liang, C.-p. Zhong, R.-x. Sun, B.-b. Liu, C. Huang, J. Qin, S. Zhou, J. Shan, Y.-k. Liu, and S.-l. Ye
Local Expression of Secondary Lymphoid Tissue Chemokine Delivered by Adeno-Associated Virus within the Tumor Bed Stimulates Strong Anti-Liver Tumor Immunity
J. Virol., September 1, 2007; 81(17): 9502 - 9511.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Huang, T. Tatsumi, E. Pizzoferrato, N. Vujanovic, and W. J. Storkus
Nitric Oxide Sensitizes Tumor Cells to Dendritic Cell-Mediated Apoptosis, Uptake, and Cross-Presentation
Cancer Res., September 15, 2005; 65(18): 8461 - 8470.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Porosnicu, A. Mian, and G. N. Barber
The Oncolytic Effect of Recombinant Vesicular Stomatitis Virus Is Enhanced by Expression of the Fusion Cytosine Deaminase/Uracil Phosphoribosyltransferase Suicide Gene
Cancer Res., December 1, 2003; 63(23): 8366 - 8376.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tolba, K. A.
Right arrow Articles by Rosenblatt, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tolba, K. A.
Right arrow Articles by Rosenblatt, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online