Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium  Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goulet, B.
Right arrow Articles by Nepveu, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goulet, B.
Right arrow Articles by Nepveu, A.
[Cancer Research 62, 6625-6633, November 15, 2002]
© 2002 American Association for Cancer Research


Molecular Biology and Genetics

Characterization of a Tissue-specific CDP/Cux Isoform, p75, Activated in Breast Tumor Cells1

Brigitte Goulet, Peter Watson, Madeleine Poirier, Lam Leduy, Ginette Bérubé, Sarkis Meterissian, Paul Jolicoeur and Alain Nepveu2

Molecular Oncology Group [B. G., M. P., L. L., G. B., A. N.] and Department of Surgical Oncology [M. P., S. M.], McGill University Health Center, Montreal, Quebec, QC H3A 1A1; Departments of Biochemistry [B. G., A. N.], Medicine [A. N.], and Oncology [A. N.], McGill University, Montreal, Quebec, QC H3A 1A1; Department of Pathology & Physiology, Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, R3E-0W3 [P. W.]; and Laboratory of Molecular Biology, Clinical Research Institute of Montreal, Department of Microbiology and Immunology, Université de Montréal, and Experimental Medicine, McGill University, Montreal, Quebec H2W-1R7 [P. J.], Canada


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Two isoforms of the CCAAT-displacement protein/cut homeobox (CDP/Cux) transcription factor have been characterized thus far. The full length protein, p200, which contains four DNA binding domains, transiently binds to DNA and carries the CCAAT-displacement activity. The p110 isoform is generated by proteolytic processing at the G1-S transition and is capable of stable interaction with DNA. Here we demonstrate the existence of a shorter CDP/Cux isoform, p75, which contains only two DNA binding domains, Cut repeat 3 and the Cut homeodomain, and binds more stably to DNA. CDP/Cux p75 was able to repress a reporter carrying the promoter for the cyclin-dependent kinase inhibitor p21 gene and to activate a DNA polymerase {alpha} gene reporter. Expression of CDP/Cux p75 involved a novel mechanism: transcription initiation within intron 20. The intron 20-initiated mRNA (I20-mRNA) was expressed at higher level in the thymus and in CD4+/CD8+ and CD4+ T cells. I20-mRNA was expressed only weakly or not at all in normal human mammary epithelial cells and normal breast tissues but was detected in many breast tumor cells lines and breast tumors. In invasive tumors a significant association was established between higher I20-mRNA expression and a diffuse infiltrative growth pattern (n = 41, P = 0.0137). In agreement with these findings, T47D breast cancer cells stably expressing p75 could not form tubule structures in collagen but rather developed as solid undifferentiated aggregates of cells. Taken together, these results suggest that aberrant expression of the CDP/Cux p75 isoform in mammary epithelial cells may be associated with the process of tumorigenesis in breast cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CDP/Cux3 belongs to a family of transcription factors present in all metazoans and involved in the control of proliferation and differentiation (reviewed in Ref. 1 ). In Drosophila melanogaster, many phenotypes were found to be caused by insertion of transposable insulator sequences that interfered with the function of tissue-specific enhancers (2, 3, 4, 5, 6) . The affected tissues included the wings (cut wing), legs, external sense organs, Malpighian tubules, tracheal system, and some structures in the central nervous systems (2 , 7, 8, 9, 10, 11, 12, 13, 14) . In higher vertebrates, there are two CDP/Cux genes called CDP-1 and CDP-2 in human and Cux-1 and Cux-2 in mouse and chicken (15, 16, 17) . Whereas Cux-2 is expressed primarily in nervous tissues, Cux-1 is present in most tissues (15 , 18 , 19) . The cux-1 gene has been the subject of three gene-targeting studies. The cux-1 knockout mice displayed phenotypes in various organs, including curly whiskers, growth retardation, delayed differentiation of lung epithelia, altered hair follicle morphogenesis, male infertility, and a deficit in T and B cells (19, 20, 21, 22) . In contrast to the small size of the cux-1 knock-out mice, transgenic mice expressing Cux-1 under the control of the cytomegalovirus enhancer/promoter displayed multiorgan hyperplasia and organomegaly (23) . Thus, from genetic studies both in Drosophila and the mouse, it is clear that the CDP/Cux/Cut gene plays an important role in the development and homeostasis of several tissues.

In tissue culture, the expression and activity of CDP/Cux has been associated with cellular proliferation (24, 25, 26) , the repression of genes that are turned on in terminally differentiated cells (27, 28, 29, 30, 31, 32) , and the regulation of matrix attachment regions (33, 34, 35, 36, 37) . CDP/Cux/Cut proteins may contain two to four DNA binding domains. All proteins contain at least a Cut homeodomain (HD) and either one to three Cut repeats (CR1, CR2, and CR3). The cut superclass of homeobox genes has been divided into three classes: CUX, ONECUT and SATB (38) . While the Drosophila Cut, human CDP, and mouse Cux genes contain three Cut repeats in each species, there is also a ONECUT gene containing a single Cut repeat (15 , 16 , 39, 40, 41) . SATB1 includes two Cut repeat-like domains and a divergent Cut-like homeodomain (42) . The term CDP/Cux will be used in the remainder of this manuscript to designate mammalian proteins that contain three Cut repeats and a Cut HD.

Individual Cut repeats cannot bind to DNA on their own but need to cooperate with a second Cut repeat or with the Cut HD (43) . Two CDP/Cux DNA binding activities have been reported in cells. CDP/Cux p200 binds transiently to DNA like the CR1CR2 domains and carries the CCAAT-displacement activity (15 , 31 , 43 , 44) . At the G1-S transition of the cell cycle, proteolytic cleavage of p200 generates CDP/Cux p110, which contains CR2CR3HD and exhibits distinct DNA binding specificity and kinetics (45) . In particular, p110 is able to make a stable interaction with DNA.

In this study, we describe a novel CDP/Cux isoform, p75, that is encoded by an I20-mRNA. Interestingly, this novel isoform displays DNA binding properties distinct from that of the previously characterized p200 and p110 CDP/Cux isoforms. Although expression of the I20-mRNA is restricted to certain tissues or cells, we found that its expression was activated in breast tumor cell lines and in primary human breast tumors. These results, together with the finding that the p110 isoform is expressed at a higher level in uterine leiomyomas, suggest that alternative mechanisms may be selected in cancer cells to favor expression of short CDP/Cux isoforms (46) .


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
RNA Preparation.
RNA was prepared using Trizol purchased from Life Technologies, Inc. according to manufacturer’s instructions and treated with RNase free DNase at 37°C for 30 min.

RNase Mapping.
The riboprobes were prepared as described previously (47) . Forty µg of total RNA were annealed to 8 x 105 cpm of labeled riboprobe at 54°C for 16 h in 80% formamide (0.4 M NaCl, 0.4 M piperazine-N,N-bis [2-ethanesulfonic acid; PIPES (pH 6.4)], 1 mM EDTA). RNA-RNA hybrids were digested with 30 units of RNase T2 (Life Technologies, Inc.)/ml at 37°C for 1 h. Hybrids were then precipitated with 20 µg of tRNA, 295 µl of 4 M guanidine thiocyanate, and 590 µl of isopropanol. Pellets were resuspended in 80% formamide, 1x Tris-borate EDTA and 0.1% xylene cyanol + bromphenol blue, denatured, and electrophoresed on 4% acrylamide-8M urea gel.

Reverse Transcriptase-PCR.
Reverse transcriptase-PCR was performed on Human Multiple Tissue cDNA (MTC) of normalized, first-strand cDNA preparations derived from different adult human tissues, purchased directly from Clonetech. cDNA from mouse tissues, thymocytes, breast tumor cell lines, and breast tumor samples (from the Manitoba Breast Tumor Bank) were prepared using SuperscriptII RNaseH-Reverse Transcriptase (Life Technologies, Inc.) according to the manufacturer’s instructions.

Primers used: Fi20 (human nt -40 to -18 within intron 20) GCTATTTTCAGGCACGGTTTCTC; B22 (human nt 3630–3609 and mouse nt 3345–3324): TCCACATTGTTGGGGTCGTTC; F19 (human nt 3021–3041): AGAAAGGCCGAGAACCCTTCA; Fi20m (mouse nt -111 to -88): CGACGGTCCCCTTCTGGAATGG; and F18 (mouse nt 2411–2447): CAAGCGCTGAGTCCC.

Primers were labeled in a final volume of 50 µl, containing 5 µl of 10x kinase buffer [70 mM Tris-HCl (pH 7.6), 10 mM MgCl2, and 5 mM DTT], 15 units of T4 polynucleotide kinase, and 0.8 mCi [{gamma} 32P]ATP and incubated at 37°C for 1 h. The labeled primer was then run through a Sephadex G25 spun column. PCR was performed in a final volume of 30 µl, containing 1 ng of cDNA, 1.5 mM MgCl2, 3 µl of standard 10x PCR buffer [200 mM Tris-HCl (pH 8.4), 500 mM KCl], 0.45 µM of each primer, 0.12 mM dNTPs, and 1 unit of Taq polymerase (Life Technologies, Inc.). An initial step of 4 min at 95°C was followed by 25 cycles of 45 s of denaturation at 95°C, 50 s of annealing at 61°C, and 60 s of extension at 72°C, followed by a final extension step of 7 min at 72°C. Pilot tests have been done to make sure the PCR reaction does not reach its plateau (data not shown).

Cell Culture.
HeLa, HEL, 293, and NIH3T3 cells were cultured in DMEM medium supplemented with 10% FBS. The breast tumor cell lines, MCF7, MDA231, MDA468, T47D, Hs578T, MDA435s, and BT549 cells were cultured in DMEM medium supplemented with 5% FBS. SkBr3 cells were cultured in DMEM medium supplemented with 10% FBS. MDA 436 cells were cultured in Leibovitz medium supplemented with 15% FBS and 10 µg/ml insulin. MCF 10A and MCF 12A cells were cultured in 50% DMEM-F12 medium supplemented with 5% HS, 10 µg/ml insulin (Life Technologies, Inc.), 0.5 µg/ml hydrocortisol (Sigma), 0.1 µg/ml cholera enterotoxin (Life Technologies, Inc.), and 20 ng/ml epidermal growth factor (Boehringer Mannheim). HMECs were purchased from Clonetics and cultured using the manufacturer’s medium and instructions. Transfections were done using ExGene500 (MBI Fermentas) according to manufacturer’s instructions.

T47D Collagen Assay.
T47D cells were transfected with 10 µg of pMX or pMX-p75 along with 1 µg of pSV-NEO. Stable-expressing lines were selected for 3 weeks with 400 µg/ml G418 (Life Technologies, Inc.). Tubule forming assay was performed by adding 2 x 105 cells/ml into 1.3 mg/ml collagen in DMEM supplemented with 5% FBS as described previously (48 , 49) . Cells were cultured for 10 days. Tubules were visualized using a Retiga 1300 digital camera (Qimaging, Burnaby, British Columbia, Canada) and a Zeiss AxioVert 135 microscope with a x10 objective (Carl Zeiss Canada Ltd., Toronto, Ontario, Canada). Cells in collagen were then fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned (8 µM). Sections were stained with H&E. Images were acquired using PixCell II LCM system (Arcturus Engineering, Inc., Mountain View, CA) using a x40 objective.

Preparation of Nuclear Cell Extract.
Nuclear extracts were prepared as described previously (43) .

Preparation of Mouse Thymus Extract.
Thymus protein extracts were prepared by homogenization in buffer X [50 mM HEPES (pH 7.9), 0.4 M NaCl, 4 mM NaF, 4 mM NaVO3, 0.2 mM EDTA, 0.2 mM EGTA, 0.1% NP40, 10% glycerol, and protease inhibitors] (Roche).

Expression and Purification of CDP/Cux Fusion Proteins.
The bacterial expression vectors pET-15b (Novagen) expressing CR2CR3HD and CR3HD were introduced into the BL21(DE3) of Escherichia coli and induced with isopropyl-1-thio-ß-D-galactopyranoside. The fusion proteins were purified by affinity chromatography using procedures provided by the suppliers.

EMSA.
EMSA were performed, and kinetics and affinity of DNA binding were measured as described previously (43 , 45) .

Luciferase Assay.
This assay was performed as described previously (45) .

Immunofluorescence.
NIH3T3 cells were plated on a coverslip and transfected with 5 µg of pMX-p75-HA. Two days later, cells were fixed with 100% of methanol for 2 min. After two washes with 1x PBS, cells were quenched for 10 min in 50 mM NH4Cl, solubilized for 10 min (95% PBS +5% FBS +0.5% Triton X-100) and incubated with {alpha}hematoglutinin (HA) (1:10000) for 1 h at room temperature. After extensive washing, the secondary antibody (antimouse alexa 488 1:1000) was incubated for 30 min at room temperature in the dark. Cells were visualized using a Retiga 1300 digital camera (Qimaging, Burnaby, British Columbia, Canada) and a Zeiss AxioVert 135 microscope with a x63 objective. Images were analyzed using Northern Eclipse version 6.0 (Empix Imaging, Mississauga, Ontario, Canada).

Plasmid Construction.
The DNA sequence of all plasmids is available upon request. For the expression of human intron 20-mRNA, PCR amplification was performed using at the 5' end a primer that contains XhoI and NotI sites linked to sequences from intron 20, ACTGCTCGAGCGGCCGCTTTTAGCAGAATGCCCTCATG, and at the 3' end a primer corresponding to nt 3862–3841 of HSCDP (accession no. M74099), GTTTTTGGTGACGGGTATGGC. The product was digested with XhoI and BstXI (nt 3625 of HSCDP) and ligated together with a BstXI-NotI fragment that includes nt 3625 to 4551 of HSCDP. A NotI fragment was then introduced into the corresponding site of the pcDNA3.1 vector (InVitrogen), and a XhoI-NotI fragment was inserted intro the pMX139 vector.

Human Breast Cancer Specimen Analysis.
A cohort of 41 invasive ductal carcinomas was selected from the Manitoba Breast Tumor Bank with two subgroups. All cases are processed uniformly to produce matched mirror image paraffin and frozen tissue blocks. Tumor pathology and characteristics can therefore be assessed directly in high-quality paraffin sections from tissue immediately adjacent to frozen tissue sections used for RNA extraction and reverse transcriptase-PCR analysis (50) . The first group comprised invasive ductal carcinomas (n = 21) showing large cohesive clusters of tumor cells forming nests or glandular arrangements, without a diffuse or infiltrating growth pattern. The second subgroup (n = 21) comprised invasive tumors selected for a diffuse infiltrating growth pattern. These included Mixed Ductal & Lobular Carcinomas (n = 9) with a significant lobular component or a lobular pattern of growth but with either focal glandular formation and/or ductal type cytological features and invasive lobular carcinomas (n = 11; Refs. 51 , 52 ).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A CDP/Cux mRNA Is Initiated within Intron 20 and Is Expressed in a Tissue-specific Manner.
RNase mapping using a riboprobe containing exons 19, 20, and 21 generated a smaller protected fragment than anticipated with RNA samples from certain sources, notably HeLa cells and placenta (Fig. 1A)Citation . This result indicated the existence of an alternative CDP/Cux transcript that contains exon 21 but not exon 20. The 5' end of the novel transcript was cloned from placenta by the method of rapid amplification of cDNA ends using as reverse primers two successive oligonucleotides from exon 21. DNA sequencing analysis showed that the sequence upstream of exon 21 originated from intron 20 and extended at least 500 nt upstream of the intron 20/exon 21 junction. To exclude the possibility that genomic DNA that was still present in our RNA preparations, reverse-transcriptase-PCR analysis was performed using as forward primers oligonucleotides from exon 19 or intron 20 and as a reverse primer, an oligonucleotide from exon 22. First-strand cDNA preparations derived from different adult human tissues (Clonetech) were used as a source of material (Fig. 1C)Citation . We obtained fragments of 609 bp with the exons 19 and 22 primers and of 474 with the intron 20 and exon 22 primers. The latter corresponds to the size predicted for a mRNA containing sequences from intron 20, exon 21, and exon 22. This result confirmed the existence of a CDP/Cux mRNA that initiates upstream of exon 21 and does not contain exon 20. Reverse transcriptase-PCR analysis of mouse tissue RNAs confirmed that a similar transcript is expressed at higher levels in the placenta and thymus of the mouse (Fig. 2A)Citation . The I20-mRNA was expressed in mature and immature T cells but at higher levels in mature CD4+ than in mature CD8+ T cells (Fig. 2B)Citation . Altogether, these findings indicate that the I20-mRNA is expressed in a tissue and cell type-specific manner.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 1. Identification of a novel CDP/Cux transcript starting within intron 20. A, RNase mapping analysis was performed using a riboprobe encompassing exons 19 to 21 of the CUTL1 gene and total RNA samples from three cell lines (HeLa, HEL, and 293), placenta, and tRNA as a control. The undigested riboprobe as well as the major protected fragments are indicated by arrows. Shown below is a schematic representation of the riboprobe and the two protected fragments. The black bars on top of the probe indicate the position of CR2 and CR3 coding sequences. B, RNase mapping analysis was performed using a riboprobe derived from the CUTL1 intron 20 and total RNA samples from various cells lines, placenta, and tRNA as a control. C, CDP/Cux (top panel) and I20-mRNA (middle panel) were analyzed by reverse transcriptase-PCR using Human Multiple Tissue cDNA (MTC) of normalized, first-strand cDNA preparations derived from different adult human tissues (Clonetech) and the indicated oligonucleotides as primers (see "Materials and Methods"). GAPDH mRNA was used as a control for the quantity of mRNA/cDNA in each sample.

 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2. Identification of I20-mRNA in mouse tissues and mouse thymocytes. A, I20-mRNA was analyzed by reverse transcriptase-PCR using first-strand cDNA derived from various mouse tissues and the indicated oligonucleotides. The amplified fragments are 900 bp for the full length CDP/Cux mRNA and 600 bp for the I20-mRNA. GAPDH mRNA was used as a control for the quantity of mRNA/cDNA in each sample. B, I20-mRNA was analyzed by reverse transcriptase-PCR as described above using first-strand cDNA preparations derived double positive (CD4+/CD8+) or single positive (CD4+ or CD8+) mouse thymocytes.

 
Reverse transcriptase-PCR products of the expected sizes were obtained with forward primers situated ~500, 1500, 2500 nt upstream of exon 21 (data not shown). No product was obtained with oligonucleotides positioned 3000 and 3500 nt upstream of exon 21. RNase mapping analysis was then performed with a riboprobe containing nucleotides -2270 to -2978 upstream of exon 21. A unique protected fragment of ~200 nt was observed, suggesting that transcription may start at a position ~2.5 kbp upstream of the intron 20/exon 21 junction (Fig. 1B)Citation . We cannot, however, exclude the possibility that this position represents an alternative splice acceptor site. Altogether, our results define a novel CDP/Cux mRNA that is expressed in a tissue-specific manner and is initiated upstream of exon 21. We will refer to this novel transcript as the I20-mRNA.

I20-mRNA Encodes for a CDP/Cux Protein of Mr 75,000 that Localizes to the Nucleus and Binds to DNA.
The I20-mRNA contains a long 5'untranslated sequence followed by an open reading frame starting at the beginning of exon 21. An AUG codon is present at a position corresponding to nt 3224 of the HSCDP cDNA sequence. The sequence at this position, CCGAUGG, does not conform to the Kozak consensus. Yet, a protein was expressed in an in vitro transcription/translation system, and replacement of AUG for UUC completely eliminated translation (Fig. 2A)Citation . Transfection of NIH3T3 cells with a mouse I20-mRNA expression vector gave rise to a novel protein of Mr 75,000 that comigrated with a protein present in mouse thymus (Fig. 3B)Citation . This protein was detected with the COOH-terminal {alpha}1300 but not the {alpha}23 NH2-terminal CDP/Cux antibody (Fig. 3ACitation , Lane 3). In EMSAs, nuclear extracts from transfected NIH3T3 cells generated a retarded complex that could be supershifted with the {alpha}1300 CDP/Cux but not with an unrelated antibody (Fig. 3CCitation , Lanes 2–4). When NIH3T3 cells were transfected with a vector-expressing p75 with an influenza virus HA tag at its COOH-terminus, a specific signal was detected by indirect immunofluorescence in the nucleus of transfected NIH3T3 cells (Fig. 3D)Citation . Taken together, these results demonstrate that I20-mRNA codes for a CDP/Cux protein of Mr 75,000 that localizes to the nucleus and binds to DNA.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3. The I20-mRNA codes for a nuclear protein of Mr 75,000 that binds to ATCGAT. A, a cDNA fragment for the I20-mRNA was inserted into the pcDNA3.1 vector, and the first ATG was replaced for TTC. The resulting plasmids were tested in an in vitro transcription/translation system (Promega) in the presence of 35S-labeled methionine. B, the pcDNA3.1-p75 vector was introduced into NIH3T3 cells. Nuclear extracts from transfected NIH3T3 cells (5 µg) and total extracts from mouse thymus (500 µg) were analyzed in Western blots with anti-CDP/Cux 23 and 1300 antibodies. C, nuclear extracts from transfected NIH3T3 cells were analyzed in EMSA with the ATCGAT probe. Note that the small amount of proteins used from transfected cells precludes the detection of endogenous CDP/Cux proteins in immunoblots and EMSA. D, a HA-tagged was inserted at the COOH terminus of p75, and the resulting vector was introduced into NIH3T3 cells. Indirect immunofluorescence was performed using an HA antibody.

 
p75 Makes a more Stable Interaction with DNA than p110 and Displays Similar Transcriptional Properties in Reporter Assays.
The CDP/Cux p110 isoform contains CR2, CR3, and HD (CR2CR3HD), whereas the p75 isoform contains CR3 and HD (CR3HD). We compared the DNA binding properties of the two isoforms first using bacterially expressed his-tagged fusion proteins and then nuclear extracts from transfected mammalian cells. The purified CR2CR3HD and CR3HD his-tagged proteins exhibited similar DNA binding affinities, with apparent dissociation constants of (KD(app.)) of 0.7 and 1.1 10-9 M, respectively (Fig. 4ACitation , top panels). In contrast, their DNA binding kinetics were different. CR3HD bound more stably to DNA than CR2CR3HD (Fig. 4ACitation , bottom panels). In agreement with these findings, the off rate of p110 was 0.8 min and that of p75 was 6.15 min (Fig. 4B)Citation . These results indicate that CDP/Cux p75 makes a more stable interaction with DNA than the p110 isoform that is expressed in S phase. To investigate the transcriptional properties of p75 CDP/Cux, reporter assays were performed in parallel using either p110 or p75 as effectors. The results from several experiments indicated that both proteins, p110 and p75, were able similarly to repress the p21WAF1/CIP1 reporter and stimulate expression from the DNA pol {alpha} reporter (Fig. 5)Citation . Whether stimulation of gene expression involves direct activation or repression of a down-modulator is currently under investigation. In summary, p75 CDP/Cux localizes to the nucleus, binds to DNA, and is able to regulate transcription of target genes.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 4. p75 binds more stably to DNA than the proteolytically processed p110 isoform. A, the DNA binding affinity and stability were measured using purified His-tagged proteins containing two Cut repeats (CR2CR3HD), as in p110, or one Cut repeat (CR3HD), as in p75. Top panels, binding affinity: 10 pM of radiolabeled oligonucleotides containing the ATCGAT sequence were incubated with increasing concentrations of CR2CR3HD or CR3HD fusion proteins. The incubations took place at room temperature until the equilibrium was reached (15 min), and the samples were resolved by electrophoresis on a nondenaturing polyacrylamide gel. To obtain the apparent dissociation constant, KD(app), the percentage of free DNA (relative to the amount in the lane with no protein added) was plotted against the log of protein concentration. Bottom panels, off rates: 1 µg of the indicated fusion protein was incubated with radiolabeled oligonucleotides at room temperature until the equilibrium was reached (15 min). One thousand-fold molar excess of unlabeled oligonucleotides was added, and at the indicated time points aliquots of the mixture were taken and analyzed in EMSA. B, Hs578T cells were transfected with vectors expressing recombinant p110 and p75 CDP/Cux isoforms. Nuclear extracts were used to measure off rates as described above.

 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. p75 can repress the expression of a P21waf1/cip1 reporter and stimulate the expression of a DNA polymerase {alpha} reporter. NIH3T3 cells were transfected with 500 ng of a P21Cip1/Waf1/luciferase reporter construct (A) and Hs578T, with a DNA polymerase {alpha}/luciferase reporter (B), together with either an empty vector or a vector encoding for p110 or p75 CDP/Cux. Two days later, cytoplasmic extracts were prepared and processed to measure luciferase activity. Mean of six transfections are shown, and the results are expressed as relative light units (RLU) normalized to ß-galactosidase activity from an internal control.

 
I20-mRNA and p75 Are Weakly or Not Expressed in HMECs but Are Detected in Many Breast Tumor Cells Lines.
We analyzed expression of the CDP/Cux full length and I20-mRNAs in a panel of breast tumor cell lines and in HMECs. In RNase protection and reverse transcriptase-PCR assays, a fragment corresponding to the I20-mRNA was detected in some but not all breast tumor cell lines (Fig. 6, A and B)Citation . Similarly, Western blot analysis revealed that the Mr 75,000 protein was detected in some breast tumor cell lines but not in HMECs (Fig. 6C)Citation . We then compared expression of I20-mRNA in two pairs of cell lines. Expression of the I20-mRNA was higher in the tumorigenic Hs578T cell line than in its nontumorigenic counterpart, Hs578Bst (Fig. 6DCitation , left panel; Ref. 53 ). A similar comparison in a pair of immortalized and notch-transformed mammary epithelial cell lines of mouse origin, HC11 and notch-HC11 (54) , also showed that the mouse CDP/Cux I20-mRNA was expressed at a higher level in the transformed line (Fig. 6DCitation , right panel). Taken together, these findings suggest that expression of the CDP/Cux I20-mRNA and p75 protein is activated in some breast cancer cells.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 6. I20-mRNA is detected in breast tumor cell lines but weakly or not in normal HMECs. A, RNase mapping analysis was performed using a riboprobe encompassing exons 19 to 21 of the CUTL1 gene (as described in Fig. 1ACitation ) and total RNA samples from breast tumor cell lines and a primary culture of HMECs. The undigested riboprobe as well as the major protected fragments are indicated by arrows. A schematic representation of the riboprobe and the two protected fragments is shown in Fig. 1ACitation . B, CDP/Cux (top panel) and I20-mRNA (middle panel) were analyzed by reverse transcription-PCR using total RNA from breast tumor cell lines and HMECs. The assay was performed as described in Fig. 1CCitation . GAPDH mRNA was used as a control for the quantity of mRNA/cDNA in each sample. C, Twenty-five µg of nuclear extracts from breast tumor cell lines and HMEC were analyzed in Western blots using anti-CDP/Cux 1300 and 409 antibodies. As controls to identify the p75 protein, 5 µg of nuclear extracts were taken from pcDNA3.1-p75-transfected NIH3T3 (lane p75). Coomassie-blue staining of the membranes are shown to compare the amounts of proteins in each sample. The epitopes recognized by the 1300 and 409 antibodies are shown in Fig. 3Citation . D, reverse transcription-PCR analysis of full length and I20 CDP/Cux mRNA in a pair of immortalized and transformed cell lines of human origin, Hs578Bst and Hs578T (left panel), and of mouse origin, HC11 and notch-HC11 (right panel). The assay was performed as in Fig. 1CCitation for the human cell lines and as in Fig. 2Citation for the mouse cell lines, except that the two forward primers were included together with the same backward primer.

 
T47D-p75 Stable Cell Lines Do Not Form Tubules in Collagen.
To evaluate whether p75 may be able to confer to mammary epithelial cells properties that are associated with cellular transformation, we generated T47D cell lines stably expressing p75. Although T47D cells are derived from a breast tumor, they have retained the capability to differentiate and form tubules in collagen (48 , 49) . For this reason, they represent a good cellular model in which to investigate the effect of putative oncogenes. Interestingly, we observed that the T47D clones expressing p75 could no longer form tubules in collagen (Fig. 7, A and B)Citation . Moreover, the colonies generated by the p75-T47D clones were not hollow cysts but instead compact aggregates of cells that were devoid of a central lumen (Fig. 7C)Citation . These results indicate that upon forced expression of CDP/Cux p75, T47D cells loose their ability to form an organized epithelial sheet.



View larger version (84K):
[in this window]
[in a new window]
 
Fig. 7. T47D cell line stably expressing p75 cannot form tubule in collagen. A, cells from the T47D breast tumor cell line were transfected with pMX-p75 or the empty vector, pMX139, along with a neomycin-expressing vector. After a 3-week selection in the presence of G-418, stably transfected cell clones were expanded and analyzed for p75 CDP/Cux expression by Western blotting with the CDP/Cux1300 antibodies. A diagram of the p75 expression vector is shown below. B, Stably transfected T47D clones were analyzed for tubulogenesis in collagen assay. Tubules and cysts were photographed as described in "Materials and methods" using a x10 objective. C, H&E staining of T47D-pMX-p75 clone D cysts sectioned from paraffin were visualized as described in "Materials and Methods" using a x40 objective. The other clones showed the same morphology.

 
The I20-mRNA Is Expressed in some Breast Carcinomas but not in Normal Breast Tissue.
Using reverse transcriptase-PCR analysis, the I20-mRNA was not detected in RNA isolated from a reduction mammoplasty tissue sample from a woman without known breast pathology (Fig. 8ACitation , right panel). This result is in accordance with the findings that the I20-mRNA was not expressed in normal mouse mammary glands (Fig. 2A)Citation . However, a strong I20-mRNA signal was observed in three cases of breast cancer, tumors C8921D, A168A, and C8961B (Fig. 8ACitation , left panel). Two of these tumors, C8921D and C8961B, are lobular carcinomas, whereas A168A was classified as a mixed ductal-lobular carcinoma but with a very diffuse growth pattern. All other tumors showing low or no I20-mRNA expression were classified as ductal carcinomas.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 8. Reverse transcriptase-PCR analysis of CDP/Cux mRNA expression in normal breast tissue and breast tumor. A, total mRNA was isolated from a panel of 14 human breast tumors. Reverse transcriptase-PCR was performed with either the F19 and B22 primers (top panel) or the Fi20 and B22 primers (bottom panel). Equal mRNA/cDNA amounts were verified using GAPDH mRNA amplification as a control. B, similar reverse transcriptase-PCR assays were performed using RNA isolated from a reduction mammoplasty tissue sample from three women without known breast pathology. C, total mRNA was isolated from a panel of 32 human breast tumors divided in three classes: invasive lobular carcinomas; invasive ductal and lobular mixed carcinomas; and invasive ductal carcinomas. Reverse transcriptase-PCR was performed as described in A.

 
Higher I20-mRNA Expression in Invasive Carcinoma Is Associated with a more Diffuse Growth Pattern and the Lack of Tubular Differentiation.
The above results raised the possibility that I20-mRNA expression may be associated with a more diffuse growth pattern. To further examine this hypothesis, we analyzed CDP/Cux mRNA expression in an expanded panel of invasive carcinomas that were selected on the basis of their classification as either ductal, lobular, or mixed lobular/ductal carcinomas. Higher I20-mRNA expression levels were significantly associated with invasive lobular and invasive mixed lobular/ductal carcinomas compared with invasive ductal carcinomas [mean (SD), lobular and mixed; n = 20, 115,200 (84,770) versus ductal n = 21, 45,510 (43,360), P = 0.0137, Mann Whitney test] (55) . These results suggest that the I20-mRNA is expressed at a higher level in a subset of breast tumors that exhibit a more diffuse growth pattern compared with tumors that exhibit the ability to form cohesive clusters and tubules. These results are in agreement with our tissue culture assays showing that mammary epithelial cells lose their ability to form tubules in collagen upon forced expression of the I20-mRNA.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The full length Mr 200,000 CDP/Cux protein was previously found to be proteolytically processed in S phase to generate an NH2-terminally truncated isoform of Mr 110,000 (45) . Here, we showed that an alternate mechanism can serve to generate an NH2-terminally truncated isoform of Mr 75,000: transcription initiation within an intron. Thus, alternative mechanisms can serve to generate NH2-terminally truncated CDP/Cux isoforms (Fig. 9)Citation . We speculate that the existence of two modes of regulation enables the production of short Cut proteins in response to different signaling or developmental cues. Interestingly, whereas the ONECUT genes contain only one Cut repeat, it appears that the more complex Cux genes have the potential to encode proteins with either one (p75), two (p110), or three Cut repeats (p200). We favor the opinion that there is a functional advantage associated with the ability to express proteins with variable numbers of Cut repeats. Various combinations of Cut repeats and the Cut homeodomain were found to exhibit different DNA binding properties (43 , 56, 57, 58, 59) . CDP/Cux p200 and p110 clearly displayed distinct DNA binding and transcriptional properties (43 , 45) . The difference between p110 and p75 appears to be more subtle. We have not detected differences in binding affinity or specificity, but DNA binding was found to be more stable in the case of p75. This property could make of p75 a more potent transcription factor than p110. The two isoforms were found to behave similarly in a reporter assay (Fig. 5)Citation , but it is possible that subtle differences would not be revealed in transient assays where proteins are overexpressed. Another potential difference between p75 and p110 concerns the proteins with which they can interact because the presence or absence of Cut repeat 2 may allow interaction with different partners. Future studies should investigate the protein-protein interaction capabilities of the various CDP/Cux isoforms.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9. Schematic representation of the CUTL1 gene and some of its mRNAs and proteins. The exon/intron structure of the gene is shown at the top. Below are two CDP/Cux mRNAs, the full length mRNA and the I20-mRNA, as well as the proteins encoded by these mRNAs: p200, p110, and p75. Note that two mechanisms can be used to generate NH2-terminally truncated CDP/Cux isoforms: proteolytic processing of p200 to generate p110 or transcription initiation at a start site within intron 20 to produce p75. We speculate that the existence of two modes of regulation enables the production of short Cut proteins in response to different signals or developmental cues.

 
We have shown that forced expression of CDP/Cux p75 isoform in T47D cells inhibited the formation of tubules in a tissue culture assay and that elevated I20-mRNA expression in breast tumors was associated with a more diffuse infiltrative growth pattern and the lack of tubule structures (Figs. 7Citation and 8Citation ). These findings would warrant a more extensive study to verify whether CDP/Cux I20-mRNA or p75 protein expression could be used in the future as a molecular marker to augment grading of breast tumors. Interestingly, activated forms of the Notch4 receptors were previously shown to prevent branching morphogenesis in mammary epithelial cells (60 , 61) . That Notch and CDP/Cux p75 can confer similar phenotypes onto mammary epithelial cells raises the possibility that the receptor and the transcription factor function in the same pathway. This notion is in agreement with the reported interactions between the notch pathway and cut in Drosophila melanogaster (reviewed in Ref. 1 ). Indeed, a number of genetic studies indicated that activation of the Notch pathways leads to the induction of Cut, which would function as a downstream effector of this pathway (8 , 62, 63, 64, 65, 66) . It will be interesting to verify whether a similar connection exists in the mammary gland between Notch and CDP/Cux and, if so, which of the CDP/Cux isoform functions downstream of the Notch signaling pathway. Activation of the Notch pathway in human cancers has thus far been documented only in T-cell leukemia (67) . However, both the murine Notch1 and Notch4/int3 have been found to represent common sites of provirus integration in mouse mammary tumors (54 , 68) . Moreover, recombinant truncated Notch proteins were shown to transform HC11 and MCF-10A mammary epithelial cells in vitro (54 , 69) . These findings raise the possibility that activation of the Notch pathway might also take place in some human breast cancers but would avoid detection by the currently available tools (70) . In this respect, the confirmation of CDP/Cux as a downstream targets of Notch in higher vertebrates could provide a molecular marker for Notch activation in human cancers.


    ACKNOWLEDGMENTS
 
We thank Ginette Massé for her expert technical assistance in the separation of T-cell populations by fluorescence-activated cell sorting and Jo-Ann Bader for her expertise in paraffin embedding, sectioning, and H&E staining.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This research was funded by an operating grant from the Canadian Breast Cancer Research Initiative (to A. N.). A. N. is the recipient of a scholarship from Le Fonds de la Recherche en Santé du Québec. B. G. was the recipient of a studentship from the Research Institute of the McGill University Health Center. Back

2 To whom requests for reprints should be addressed, at 687 Pine Ave West, Montreal, Quebec, H3A 1A1 Canada. Phone: (514) 842-1231, ext. 35842; Fax: (514) 843-1478; E-mail: alain{at}molonc.mcgill.ca Back

3 The abbreviations used are: CDP/Cux, CCAAT-displacement protein/cut homeobox; HD, homeodomain; I20-mRNA, intron 20-initiated mRNA; nt, nucleotide; HMEC, human mammary epithelial cell; EMSA, electrophoretic mobility shift assay; HA, hematoglutinin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back

Received 5/ 9/02. Accepted 9/20/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nepveu A. Role of the multifunctional CDP/Cut/Cux homeodomain transcription factor in regulating differentiation, cell growth, and development. Gene (Amst.), 270: 1-15, 2001.[Medline]
  2. Jack J., Dorsett D., Delotto Y., Liu S. Expression of the cut locus in the Drosophila wing margin is required for cell type specification and is regulated by a distant enhancer. Development (Camb.), 113: 735-747, 1991.[Abstract]
  3. Jack J., DeLotto Y. Structure and regulation of a complex locus: the cut gene of Drosophila. Genetics, 139: 1689-1700, 1995.[Abstract]
  4. Modolell J., Bender W., Meselson M. Drosophila melanogaster mutations suppressible by the suppressor of Hairy-wing are insertions of a 7.3-kilobase mobile element. Proc. Natl. Acad. Sci. USA, 80: 1678-1682, 1983.[Abstract/Free Full Text]
  5. Cai H. N., Levine M. The gypsy insulator can function as a promoter-specific silencer in the Drosophila embryo. EMBO J., 16: 1732-1741, 1997.[Medline]
  6. Dorsett D. Distance-independent inactivation of an enhancer by the suppressor of Hairy-wing DNA-binding protein of Drosophila. Genetics, 134: 1135-1144, 1993.[Abstract]
  7. Jack J. W. Molecular organization of the cut locus of Drosophila melanogaster. Cell, 42: 869-876, 1985.[Medline]
  8. Jack J., DeLotto Y. Effect of wing scalloping mutations on cut expression and sense organ differentiation in the Drosophila wing margin. Genetics, 131: 353-363, 1992.[Abstract]
  9. Liu S., McLeod E., Jack J. Four distinct regulatory regions of the cut locus and their effect on cell type specification in Drosophila. Genetics, 127: 151-159, 1991.[Abstract]
  10. Liu S., Jack J. Regulatory interactions and role in cell type specification of the Malpighian tubules by the cut, Kruppel, and caudal genes of Drosophila. Dev. Biol., 150: 133-143, 1992.[Medline]
  11. Bodmer R., Barbel S., Shepherd S., Jack J. W., Jan L. Y., Jan Y. N. Transformation of sensory organs by mutations of the cut locus of D. melanogaster. Cell, 51: 293-307, 1987.[Medline]
  12. Blanc R. The production of wing scalloping in Drosophila melanogaster. Univ. Calif. Publ. Zool., 49: 1942.
  13. Braun W. The effect of puncture on the developing wing of several mutants of Drosophila melanogaster. J. Exp. Zool., 84: 325-350, 1942.
  14. Hertweck H. Anatomie und variabilitaet des nerven-systems und der sinneorgane von Drosophila melanogaster. J. Exp. Zool, 139: 559-663, 1931.
  15. Neufeld E. J., Skalnik D. G., Lievens P. M., Orkin S. H. Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut. Nat. Genet, 1: 50-55, 1992.[Medline]
  16. Valarche I., Tissier-Seta J. P., Hirsch M. R., Martinez S., Goridis C., Brunet J. F. The mouse homeodomain protein Phox2 regulates Ncam promoter activity in concert with Cux/CDP and is a putative determinant of neurotransmitter phenotype. Development (Camb.), 119: 881-896, 1993.[Abstract]
  17. Quaggin S. E., Vandenheuvel G. B., Golden K., Bodmer R., Igarashi P. Primary structure, neural-specific expression, and chromosomal localization of Cux-2, a second murine homeobox gene related to Drosophila cut. J. Biol. Chem., 271: 22624-22634, 1996.[Abstract/Free Full Text]
  18. Andres V., Nadal-Ginard B., Mahdavi V. Clox, a mammalian homeobox gene related to Drosophila cut, encodes DNA-binding regulatory proteins differentially expressed during development. Development (Camb.), 116: 321-334, 1992.[Medline]
  19. Ellis T., Gambardella L., Horcher M., Tschanz S., Capol J., Bertram P., Jochum W., Barrandon Y., Busslinger M. The transcriptional repressor CDP (Cutl1) is essential for epithelial cell differentiation of the lung and the hair follicle. Genes Dev., 15: 2307-2319, 2001.[Abstract/Free Full Text]
  20. Sinclair A. M., Lee J. A., Goldstein A., Xing D., Liu S., Ju R., Tucker P. W., Neufeld E. J., Scheuermann R. H. Lymphoid apoptosis and myeloid hyperplasia in CCAAT displacement protein mutant mice. Blood, 98: 3658-3667, 2001.[Abstract/Free Full Text]
  21. Luong M. X., van der Meijden C. M., Xing D., Hesselton R., Monuki E. S., Jones S. N., Lian J. B., Stein J. L., Stein G. S., Neufeld E. J., van Wijnen A. J. Genetic ablation of the CDP/Cux protein C terminus results in hair cycle defects and reduced male fertility. Mol. Cell. Biol, 22: 1424-1437, 2002.[Abstract/Free Full Text]
  22. Tufarelli C., Fujiwara Y., Zappulla D. C., Neufeld E. J. Hair defects and pup loss in mice with targeted deletion of the first cut repeat domain of the Cux/CDP homeoprotein gene. Dev. Biol., 200: 69-81, 1998.[Medline]
  23. Ledford A. W., Brantley J. G., Kemeny G., Foreman T. L., Quaggin S. E., Igarashi P., Oberhaus S. M., Rodova M., Calvet J. P., Vanden Heuvel G. B. Deregulated expression of the homeobox gene Cux-1 in transgenic mice results in down-regulation of p27(kip1) expression during nephrogenesis, glomerular abnormalities, and multiorgan hyperplasia. Dev. Biol., 245: 157-171, 2002.[Medline]
  24. Holthuis J., Owen T. A., van Wijnen A. J., Wright K. L., Ramsey-Ewing A., Kennedy M. B., Carter R., Cosenza S. C., Soprano K. J., Lian J. B., Stein J. L., Stein G. S. Tumor cells exhibit deregulation of the cell cycle histone gene promoter factor HiNF-D. Science (Wash. DC), 247: 1454-1457, 1990.[Abstract/Free Full Text]
  25. van Wijnen A. J., Choi T. K., Owen T. A., Wright K. L., Lian J. B., Jaenisch R., Stein J. L., Stein G. S. Involvement of the cell cycle-regulated nuclear factor HiNF-D in cell growth control of a human H4 histone gene during hepatic development in transgenic mice. Proc. Natl. Acad. Sci. USA, 88: 2573-2577, 1991.[Abstract/Free Full Text]
  26. Coqueret O., Berube G., Nepveu A. The mammalian Cut homeodomain protein functions as a cell-cycle-dependent transcriptional repressor which down-modulates P21(Waf1/Cip1/Sdi1) in S phase. EMBO J., 17: 4680-4694, 1998.[Medline]
  27. Pattison S., Skalnik D. G., Roman A. CCAAT displacement protein, a regulator of differentiation-specific gene expression, binds a negative regulatory element within the 5' end of the human papillomavirus type 6 long control region. J. Virol., 71: 2013-2022, 1997.[Abstract]
  28. Lawson N. D., Khannagupta A., Berliner N. Isolation and characterization of the cdna for mouse neutrophil collagenase: demonstration of shared negative regulatory pathways for neutrophil secondary granule protein gene expression. Blood, 91: 2517-2524, 1998.[Abstract/Free Full Text]
  29. van Gurp M. F., Pratap J., Luong M., Javed A., Hoffmann H., Giordano A., Stein J. L., Neufeld E. J., Lian J. B., Stein G. S., van Wijnen A. J. The CCAAT displacement protein/cut homeodomain protein represses osteocalcin gene transcription and forms complexes with the retinoblastoma protein-related protein p107 and cyclin A. Cancer Res., 59: 5980-5988, 1999.[Abstract/Free Full Text]
  30. O’Connor M. J., Stunkel W., Koh C. H., Zimmermann H., Bernard H. U. The differentiation-specific factor CDP/Cut represses transcription and replication of human papillomaviruses through a conserved silencing element. J. Virol., 74: 401-410, 2000.[Abstract/Free Full Text]
  31. Skalnik D. G., Strauss E. C., Orkin S. H. CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter. J. Biol. Chem., 266: 16736-16744, 1991.[Abstract/Free Full Text]
  32. Teerawatanasuk N., Skalnik D. G., Carr L. G. CCAAT displacement protein (CDP/cut) binds a negative regulatory element in the human tryptophan hydroxylase gene. J. Neurochem., 72: 29-39, 1999.[Medline]
  33. Liu J., Bramblett D., Zhu Q., Lozano M., Kobayashi R., Ross S. R., Dudley J. P. The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression. Mol. Cell. Biol., 17: 5275-5287, 1997.[Abstract]
  34. Banan M., Rojas I. C., Lee W. H., King H. L., Harriss J. V., Kobayashi R., Webb C. F., Gottlieb P. D. Interaction of the nuclear matrix-associated region (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR element (L2a) in an upstream regulatory region of the mouse CD8a gene. J. Biol. Chem., 272: 18440-18452, 1997.[Abstract/Free Full Text]
  35. Chattopadhyay S., Whitehurst C. E., Chen J. A nuclear matrix attachment region upstream of the T-cell receptor ß gene enhancer binds Cux/CDP and SATB1 and modulates enhancer-dependent reporter gene expression but not endogenous gene expression. J. Biol. Chem., 273: 29838-29846, 1998.[Abstract/Free Full Text]
  36. Wang Z., Goldstein A., Zong R. T., Lin D., Neufeld E. J., Scheuermann R. H., Tucker P. W. Cux/CDP homeoprotein is a component of NF-muNR and represses the immunoglobulin heavy chain intronic enhancer by antagonizing the bright transcription activator. Mol. Cell. Biol., 19: 284-295, 1999.[Abstract/Free Full Text]
  37. Stunkel W., Huang Z., Tan S. H., O’Connor M. J., Bernard H. U. Nuclear matrix attachment regions of human papillomavirus type 16 repress or activate the E6 promoter, depending on the physical state of the viral DNA. J. Virol., 74: 2489-2501, 2000.[Abstract/Free Full Text]
  38. Burglin T. R., Cassata G. Loss and gain of domains during evolution of cut superclass homeobox genes. Int. J. Dev. Biol., 46: 115-123, 2002.
  39. Blochlinger K., Bodmer R., Jack J., Jan L. Y., Jan Y. N. Primary structure and expression of a product from cut, a locus involved in specifying sensory organ identity in Drosophila. Nature (Lond.), 333: 629-635, 1988.[Medline]
  40. Lemaigre F. P., Durviaux S. M., Truong O., Lannoy V. J., Hsuan J. J., Rousseau G. G. Hepatocyte nuclear factor 6, a transcription factor that contains a novel type of homeodomain and a single Cut domain. Proc. Natl. Acad. Sci. USA, 93: 9460-9464, 1996.[Abstract/Free Full Text]
  41. Lannoy V. J., Burglin T. R., Rousseau G. G., Lemaigre F. P. Isoforms of hepatocyte nuclear factor-6 differ in DNA-binding properties, contain a bifunctional homeodomain, and define the new ONECUT class of homeodomain proteins. J. Biol. Chem., 273: 13552-13562, 1998.[Abstract/Free Full Text]
  42. Dickinson L. A., Dickinson C. D., Kohwi-Shigematsu T. An atypical homeodomain in SATB1 promotes specific recognition of the key structural element in a matrix attachment region. J. Biol. Chem., 272: 11463-11470, 1997.[Abstract/Free Full Text]
  43. Moon N. S., Berube G., Nepveu A. CCAAT displacement activity involves Cut repeats 1 and 2, not the Cut homeodomain. J. Biol. Chem., 275: 31325-31334, 2000.[Abstract/Free Full Text]
  44. Barberis A., Superti-Furga G., Busslinger M. Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter. Cell, 50: 347-359, 1987.[Medline]
  45. Moon N. S., Premdas P., Truscott M., Leduy L., Berube G., Nepveu A. S phase-specific proteolytic cleavage is required to activate stable DNA binding by the CDP/Cut homeodomain protein. Mol. Cell. Biol., 21: 6332-6345, 2001.[Abstract/Free Full Text]
  46. Moon N. S., Zeng W. R., Premdas P., Santaguida M., Bérubé G., Nepveu A. Expression of N-terminally truncated isoforms of CDP/Cux is increased in human uterine leiomyomas. Int. J. Cancer, 100: 429-432, 2002.[Medline]
  47. Zeng R. W., Soucie E., Sung Moon N., Martin-Soudant N., Bérubé G., Leduy L., Nepveu A. Exon/intron structure and alternative transcripts of the CUTL1 gene. Gene (Amst.), 241: 75-85, 2000.[Medline]
  48. Keely P. J. Ras and Rho protein induction of motility and invasion in T47D breast adenocarcinoma cells. Methods Enzymol., 333: 256-266, 2001.[Medline]
  49. Keely P. J., Fong A. M., Zutter M. M., Santoro S. A. Alteration of collagen-dependent adhesion, motility, and morphogenesis by the expression of antisense {alpha} 2 integrin mRNA in mammary cells. J. Cell Sci., 108 (Pt. 2): 595-607, 1995.[Abstract]
  50. Hiller T., Snell L., Watson P. H. Microdissection RT-PCR analysis of gene expression in pathologically defined frozen tissue sections. Biotechniques, 21: 38-40, 42, 44, 1996.[Medline]
  51. Pereira H., Pinder S. E., Sibbering D. M., Galea M. H., Elston C. W., Blamey R. W., Robertson J. F., Ellis I. O. Pathological prognostic factors in breast cancer. IV: Should you be a typer or a grader? A comparative study of two histological prognostic features in operable breast carcinoma. Histopathology, 27: 219-226, 1995.[Medline]
  52. Ellis I. O., Galea M., Broughton N., Locker A., Blamey R. W., Elston C. W. Pathological prognostic factors in breast cancer. II. Histological type. Relationship with survival in a large study with long-term follow-up. Histopathology, 20: 479-489, 1992.[Medline]
  53. Hackett A. J., Smith H. S., Springer E. L., Owens R. B., Nelson-Rees W. A., Riggs J. L., Gardner M. B. Two syngeneic cell lines from human breast tissue: the aneuploid mammary epithelial (Hs578T) and the diploid myoepithelial (Hs578Bst) cell lines. J. Natl. Cancer Inst. (Bethesda), 58: 1795-1806, 1977.
  54. Dievart A., Beaulieu N., Jolicoeur P. Involvement of Notch1 in the development of mouse mammary tumors. Oncogene, 18: 5973-5981, 1999.[Medline]
  55. Mann H. B., Whitney D. R. On a test of whether one of two random variables is stochastically larger than the other. Ann. Math. Stat., 18: 50-60, 1947.
  56. Harada R., Berube G., Tamplin O. J., Denis-Larose C., Nepveu A. DNA-binding specificity of the cut repeats from the human cut-like protein. Mol. Cell. Biol., 15: 129-140, 1995.[Abstract]
  57. Harada R., Dufort D., Denis-Larose C., Nepveu A. Conserved cut repeats in the human cut homeodomain protein function as DNA binding domains. J. Biol. Chem., 269: 2062-2067, 1994.[Abstract/Free Full Text]
  58. Aufiero B., Neufeld E. J., Orkin S. H. Sequence-specific DNA binding of individual Cut repeats of the human CCAAT displacement/Cut homeodomain protein. Proc. Natl. Acad. Sci. USA, 91: 7757-7761, 1994.[Abstract/Free Full Text]
  59. Andres V., Chiara M. D., Mahdavi V. A new bipartite DNA-binding domain: cooperative interaction between the cut repeat and homeo domain of the cut homeo proteins. Genes Dev., 8: 245-257, 1994.[Abstract/Free Full Text]
  60. Uyttendaele H., Soriano J. V., Montesano R., Kitajewski J. Notch4 and Wnt-1 proteins function to regulate branching morphogenesis of mammary epithelial cells in an opposing fashion. Dev. Biol., 196: 204-217, 1998.[Medline]
  61. Soriano J. V., Uyttendaele H., Kitajewski J., Montesano R. Expression of an activated Notch4(int-3) oncoprotein disrupts morphogenesis and induces an invasive phenotype in mammary epithelial cells in vitro. Int. J. Cancer, 86: 652-659, 2000.[Medline]
  62. Neumann C. J., Cohen S. M. A hierarchy of cross-regulation involving Notch, wingless, vestigial and cut organizes the dorsal/ventral axis of the Drosophila wing. Development (Camb.), 122: 3477-3485, 1996.[Abstract]
  63. Thomas U., Jonsson F., Speicher S. A., Knust E. Phenotypic and molecular characterization of SerD, a dominant allele of the Drosophila gene Serrate. Genetics, 139: 203-213, 1995.[Abstract]
  64. Micchelli C. A., Rulifson E. J., Blair S. S. The function and regulation of cut expression on the wing margin of Drosophila: Notch, Wingless and a dominant negative role for Delta and Serrate. Development (Camb.), 124: 1485-1495, 1997.[Abstract]
  65. de Celis J. F., Garcia-Bellido A., Bray S. J. Activation and function of Notch at the dorsal-ventral boundary of the wing imaginal disc. Development (Camb.), 122: 359-369, 1996.[Abstract]
  66. Doherty D., Feger G., Younger-Shepherd S., Jan L. Y., Jan Y. N. Delta is a ventral to dorsal signal complementary to Serrate, another Notch ligand, in Drosophila wing formation. Genes Dev., 10: 421-434, 1996.[Abstract/Free Full Text]
  67. Ellisen L. W., Bird J., West D. C., Soreng A. L., Reynolds T. C., Smith S. D., Sklar J. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 66: 649-661, 1991.[Medline]
  68. Gallahan D., Callahan R. The mouse mammary tumor associated gene INT3 is a unique member of the NOTCH gene family (NOTCH4). Oncogene, 14: 1883-1890, 1997.[Medline]
  69. Imatani A., Callahan R. Identification of a novel NOTCH-4/INT-3 RNA species encoding an activated gene product in certain human tumor cell lines. Oncogene, 19: 223-231, 2000.[Medline]
  70. Callahan R., Raafat A. Notch signaling in mammary gland tumorigenesis. J. Mammary Gland Biol. Neoplasia, 6: 23-36, 2001.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. Cadieux, R. Harada, M. Paquet, O. Cote, M. Trudel, A. Nepveu, and M. Bouchard
Polycystic Kidneys Caused by Sustained Expression of Cux1 Isoform p75
J. Biol. Chem., May 16, 2008; 283(20): 13817 - 13824.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Truscott, R. Harada, C. Vadnais, F. Robert, and A. Nepveu
p110 CUX1 Cooperates with E2F Transcription Factors in the Transcriptional Activation of Cell Cycle-Regulated Genes
Mol. Cell. Biol., May 15, 2008; 28(10): 3127 - 3138.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
B. Goulet, Y. Markovic, L. Leduy, and A. Nepveu
Proteolytic Processing of Cut Homeobox 1 by Neutrophil Elastase in the MV4;11 Myeloid Leukemia Cell Line
Mol. Cancer Res., April 1, 2008; 6(4): 644 - 653.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Truscott, J.-B. Denault, B. Goulet, L. Leduy, G. S. Salvesen, and A. Nepveu
Carboxyl-terminal Proteolytic Processing of CUX1 by a Caspase Enables Transcriptional Activation in Proliferating Cells
J. Biol. Chem., October 12, 2007; 282(41): 30216 - 30226.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
B. Goulet, L. Sansregret, L. Leduy, M. Bogyo, E. Weber, S. S. Chauhan, and A. Nepveu
Increased Expression and Activity of Nuclear Cathepsin L in Cancer Cells Suggests a Novel Mechanism of Cell Transformation
Mol. Cancer Res., September 1, 2007; 5(9): 899 - 907.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
U. Maitra, J. Seo, M. M. Lozano, and J. P. Dudley
Differentiation-Induced Cleavage of Cutl1/CDP Generates a Novel Dominant-Negative Isoform That Regulates Mammary Gene Expression
Mol. Cell. Biol., October 15, 2006; 26(20): 7466 - 7478.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Cadieux, S. Fournier, A. C. Peterson, C. Bedard, B. J. Bedell, and A. Nepveu
Transgenic Mice Expressing the p75 CCAAT-Displacement Protein/Cut Homeobox Isoform Develop a Myeloproliferative Disease-Like Myeloid Leukemia
Cancer Res., October 1, 2006; 66(19): 9492 - 9501.