Cancer Research Versailles No Abst Metabolism and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naoki, K.
Right arrow Articles by Meyerson, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naoki, K.
Right arrow Articles by Meyerson, M.
[Cancer Research 62, 7001-7003, December 1, 2002]
© 2002 American Association for Cancer Research

Molecular Biology and Genetics

Missense Mutations of the BRAF Gene in Human Lung Adenocarcinoma1

Katsuhiko Naoki, Tzu-Hsiu Chen, William G. Richards, David J. Sugarbaker and Matthew Meyerson2

Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 02115 [K. N., T-H. C., M. M.], and Department of Surgery, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts 02115 [W. G. R., D. J. S.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Mutations of the BRAF protein serine/threonine kinase gene have recently been identified in a variety of human cancers, most notably melanomas. We sought to determine the frequency of BRAF mutations in human lung cancer pathogenesis. Analysis of BRAF sequence from 127 primary human lung adenocarcinomas revealed mutations in two tumor specimens, one in exon 11 (G465V), and a second in exon 15 (L596R). These specimens belong to the same adenocarcinoma subgroup as defined by clustering of gene expression data. BRAF may provide a target for anticancer chemotherapy in a subset of lung adenocarcinoma patients.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Lung carcinoma is the leading cause of cancer death in the United States and worldwide, claiming more than 150,000 lives each year in the United States alone (1) . Current therapies for lung carcinoma remain inadequate; only an average of 15% of patients survive as long as 5 years from diagnosis. The development of targeted therapy for cancer-specific molecular alterations has led to significant clinical advances, such as the use of the c-Abl tyrosine kinase inhibitor, imatinib mesylate, for treatment of chronic myelogenous leukemia (2) . Genome-wide screens for gene alterations in lung carcinoma should provide new therapeutic opportunities for this disease.

Adenocarcinoma is the most common histological class of lung carcinoma, and its relative incidence is increasing (3) . Activating mutations of the KRAS proto-oncogene are known to occur in roughly 30% of human lung adenocarcinomas (4 , 5) . The pathway linking receptor tyrosine kinases to the Ras family to the Raf serine-threonine kinase to the mitogen-activated protein kinase cascade is critical for cell proliferation and is frequently activated in human cancers (6) . Thus it is important to look for mutations of other members of this pathway in lung adenocarcinoma, in addition to KRAS.

A recent study revealed activating mutations in the BRAF kinase gene in over 60% of melanomas and a broad range of other human cancers (7) . In particular, Davies et al. (7) found BRAF missense mutations in 4 of 35 lung adenocarcinoma cell lines tested (11%), but not in 14 primary lung cancers analyzed. Because of the possibility of therapeutic inhibition of the BRAF kinase in lung cancer, it is important to determine the frequency of BRAF mutations in primary lung adenocarcinomas.

We have recently analyzed a set of 127 human lung adenocarcinomas by gene expression profiling and unsupervised clustering (8) . Here we report 2 cases with BRAF missense mutations of 127 lung adenocarcinomas tested.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS AND DISCUSSION
 REFERENCES
 
Specimens and RNA.
Lung adenocarcinoma samples and RNA preparation methods have been described previously (8) . We used 127 of 139 samples from the previous report, excluding 12 samples suspected to be metastases of extrapulmonary origin.

RT-PCR,3 Genomic DNA PCR, and DNA Sequencing.
Total RNA from lung cancer specimens was used to generate cRNA by in vitro transcription (8) . cRNA samples were amplified by RT-PCR of BRAF exon 11 and exon 15 using specific primers [exon 11, TACCTGGCTCACTAACTAACGTG (forward) and CACATGTCGTGTTTTCCTGAG (reverse); exon 15, ACT GCACAGGGCATGGATTAC (forward) and AATTCATACAGAACAATCCCAAA (reverse)]. PCR primers were designed to amplify target exons plus approximately 50-bp flanking exonic sequences in both upstream and downstream directions.

RT-PCR was performed using Superscript One-Step RT-PCR with Platinum Taq kit (Life Technologies, Inc., Gaithersburg, MD). A single 50-µl RT-PCR reaction mix contained 1 µg of cRNA, 3 mM MgSO4, 100 pmol of each primer, and 1 µl of reverse transcriptase/Platinum Taq mix. RT-PCR was carried out in a GeneAmp PCR system 9700 (Applied Biosystems) as follows: after 30 min of cDNA synthesis at 50°C and 2 min of denaturation at 94°C, samples were subjected to 35 cycles of amplification, consisting of 15 s at 94°C, 30 s at 61°C, and 1 min at 72°C, with a final additional extension step at 72°C for 7 min.

We also analyzed KRAS codon 12, 13, and 61 mutations using cRNA samples with RT-PCR. Amplification was done using specific primers (forward, CGGGAGAGAGGCCTGCTGA; reverse, CCACTTGTACTAGTATGCCTTAAGAA). Conditions are the same as those described above, except for an annealing temperature of 55°C.

For samples with mutations detected at the cDNA level, we isolated genomic DNA from frozen specimens of both tumor and uninvolved normal lung controls, using the QIAamp DNA Mini Kit (Qiagen, Chatsworth, CA) according to the manufacturer’s instructions. Using primers designed to amplify BRAF exons 11 and 15 from genomic DNA (7) , 100 ng of genomic DNA were amplified using standard PCR protocol.

RT-PCR and PCR products were visualized by 2% agarose gel electrophoresis and purified using QIA quick purification kit (Qiagen) according to the manufacturer’s instructions. Purified products were subjected to primer extension sequencing (9) in both forward and reverse directions, by either the Molecular Biology Core Facility at Dana-Farber Cancer Institute or Seqwright Inc. (Houston, TX). Sequences were examined using Sequencher software (Gene Codes Corp., Inc.).

As positive and negative controls, we sequenced the BRAF gene in four lung carcinoma cell lines. We detected the missense mutations that were reported previously (7) . The NCI-H1395 cell line has a G1403C (G468A) mutation in BRAF exon 11, whereas the NCI-H2087 cell line has a C1786G (L596V) mutation in exon 15. The other two cell lines, CaLu1 and NCI-H1437, did not have BRAF mutations in these exons.

Expression Analysis.
Gene expression values were compared between the two BRAF mutant adenocarcinomas and the 57 lung adenocarcinomas known to be wild-type for BRAF and KRAS sequence, using the dChip program (10) . We used the following criteria to select genes specific for the BRAF mutant tumors: (a) minimum fold change (BRAF mutant versus wild-type) >2.0; (b) minimum lower bound of fold change (90% confidence bound) >1.25; and (c) minimum mean difference in arbitrary Affymetrix expression units (8) >100.


   RESULTS AND DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
REFERENCES
 
To detect mutations in the BRAF gene in primary lung adenocarcinomas, we sequenced exons 11 and 15 from the 127 lung adenocarcinomas characterized by gene expression analysis (8) . These exons were chosen because all reported BRAF mutations were within them (7) .

Among the primary lung adenocarcinomas, we detected a lower frequency of BRAF mutations than had been reported in the cell lines: 2 of 127 adenocarcinomas (1.6%). One human lung adenocarcinoma (AD210) has the missense mutation G1394T (G465V) in exon 11 (Fig. 1A)Citation ; no mutation was detected in the corresponding normal lung tissue (Fig. 1B)Citation . In a second human lung adenocarcinoma (AD238), we found the missense mutation T1787G (L596R) in exon 15 (Fig. 1C)Citation ; again, this sequence is wild-type in the uninvolved lung from the same patient (Fig. 1D)Citation . Both of these mutations had been previously reported in human cancer, G465V in a lung adenocarcinoma cell line and L596R in a primary ovarian cancer (7) .



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Mutations in the BRAF gene. A and B, a point mutation was identified in exon 11 of one human lung adenocarcinoma sample, AD210T (G1394T/G465V), which is not present in a normal lung tissue sample from the same patient, AD210N. C and D, a point mutation was identified in exon 15 of sample AD238T (T1787G/L596R), which is not present in the corresponding normal lung tissue sample, AD238N.

 
Because KRAS is frequently mutated in lung adenocarcinoma, we compared the frequency of BRAF mutations with KRAS mutations and with gene expression-defined tumor classes (8) for the same samples (Table 1)Citation . The frequency of KRAS mutations in the 89 samples sequenced for KRAS was 33.7%, similar to that reported in the literature; in these samples, BRAF and KRAS mutations were not present in the same tumor specimen.


View this table:
[in this window]
[in a new window]

  		Table 1 BRAF and KRAS mutations in lung adenocarcinoma

 
Comparison with gene expression patterns revealed that both tumors with BRAF mutants were clustered in group I of our expression analysis (Fig. 2)Citation . Histologically, both tumors showed moderately differentiated adenocarcinoma, and both patients had stage I tumors. Whereas this clustering is intriguing, the sample size is too small at present to determine whether BRAF-mutant tumors represent a distinct subset of lung adenocarcinomas. It is worth noting that analysis of oligonucleotide array gene expression data did not reveal any significant differences in BRAF expression between mutant and wild-type tumors. However, the BRAF-mutant tumors are characterized by high relative expression levels of multiple genes in this sample set (Table 2)Citation ; these include the adenosine A2a receptor, several B lymphocyte and/or plasma cell genes, and cyclin D1. It is interesting to note that cyclin D1, itself a transforming oncoprotein, has been reported to be downstream of oncogenic Raf signaling pathways in several independent studies (11, 12, 13, 14, 15) . Obviously, the sample size is small, and any conclusions about expression correlates of BRAF mutation must remain tentative.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Dendrogram of lung adenocarcinoma with reference to BRAF mutation. A, expression-defined adenocarcinoma subclasses (8) . There are four major clusters (C1-C4) and three groups with weaker association (group I-III). Samples of colon metastasis (CM) and normal lung (NL) were not included in this BRAF mutation search. B, enlarged view of group I. The two samples with BRAF mutation (AD210 and AD238) were both included in group I. Please note that this figure is adapted from Ref. 8 .

 

View this table:
[in this window]
[in a new window]

  		Table 2 BRAF mutant-specific genesa,b

 
In summary, we have found 2 cases with BRAF missense mutation in 127 human lung adenocarcinomas. Although the percentage of lung adenocarcinomas with BRAF mutation in lung cancer patients is relatively low compared with melanomas and colon carcinomas (7 , 16) , if BRAF inhibitors are found to be effective in these tumors, they should be also considered for treatment of BRAF-mutant lung adenocarcinomas. Furthermore, even 1.6% of lung adenocarcinoma would represent well over 1,000 patients per year in the United States, a significant group in terms of public health importance. Several Raf inhibitors have been recently discovered and entered into clinical trials (17, 18, 19) .

Furthermore, the presence of both KRAS and BRAF mutations in lung adenocarcinoma suggests that other members or the receptor tyrosine kinase/Ras/Raf/mitogen-activated protein kinase cascade should be evaluated for mutations in these tumors.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the National Cancer Institute, the Thoracic Foundation, and Novartis Pharmaceuticals. Back

2 To whom requests for reprints should be addressed, at Department of Medical Oncology, Dana-Farber Cancer Institute, Room M430, 44 Binney Street, Boston, MA 02115. Phone: (617) 632-4768; Fax: (617) 632-5998; E-mail: matthew_meyerson{at}dfci.harvard.edu Back

3 The abbreviation used is: RT-PCR, reverse transcription-PCR. Back

Received 10/ 8/02. Accepted 10/17/02.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Jemal A., Thomas A., Murray T., Thun M. Cancer statistics, 2002. CA Cancer J. Clin., 52: 23-47, 2002.[Abstract/Free Full Text]
  2. Druker B. J., Talpaz M., Resta D. J., Peng B., Buchdunger E., Ford J. M., Lydon N. B., Kantarjian H., Capdeville R., Ohno-Jones S., Sawyers C. L. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N. Engl. J. Med., 344: 1031-1037, 2001.[Abstract/Free Full Text]
  3. Travis W. D., Travis L. B., Devesa S. S. Lung cancer. Cancer (Phila.), 75: 191-202, 1995.[Medline]
  4. Rodenhuis S., van de Wetering M. L., Mooi W. J., Evers S. G., van Zandwijk N., Bos J. L. Mutational activation of the K-ras oncogene. A possible pathogenetic factor in adenocarcinoma of the lung. N. Engl. J. Med., 317: 929-935, 1987.[Abstract]
  5. Kwiatkowski D. J., Harpole D. H., Jr., Godleski J., Herndon J. E. N., Shieh D. B., Richards W., Blanco R., Xu H. J., Strauss G. M., Sugarbaker D. J. Molecular pathologic substaging in 244 stage I non-small-cell lung cancer patients: clinical implications. J. Clin. Oncol., 16: 2468-2477, 1998.[Abstract]
  6. Peyssonnaux C., Eychene A. The Raf/MEK/ERK pathway: new concepts of activation. Biol. Cell, 93: 53-62, 2001.[Medline]
  7. Davies H., Bignell G. R., Cox C., Stephens P., Edkins S., Clegg S., Teague J., Woffendin H., Garnett M. J., Bottomley W., Davis N., Dicks E., Ewing R., Floyd Y., Gray K., Hall S., Hawes R., Hughes J., Kosmidou V., Menzies A., Mould C., Parker A., Stevens C., Watt S., Hooper S., Wilson R., Jayatilake H., Gusterson B. A., Cooper C., Shipley J., Hargrave D., Pritchard-Jones K., Maitland N., Chenevix-Trench G., Riggins G. J., Bigner D. D., Palmieri G., Cossu A., Flanagan A., Nicholson A., Ho J. W., Leung S. Y., Yuen S. T., Weber B. L., Seigler H. F., Darrow T. L., Paterson H., Marais R., Marshall C. J., Wooster R., Stratton M. R., Futreal P. A. Mutations of the BRAF gene in human cancer. Nature (Lond.), 417: 949-954, 2002.[Medline]
  8. Bhattacharjee A., Richards W. G., Staunton J., Li C., Monti S., Vasa P., Ladd C., Beheshti J., Bueno R., Gillette M., Loda M., Weber G., Mark E. J., Lander E. S., Wong W., Johnson B. E., Golub T. R., Sugarbaker D. J., Meyerson M. Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc. Natl. Acad. Sci. USA, 98: 13790-13795, 2001.[Abstract/Free Full Text]
  9. Sanger F., Coulson A. R. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol., 94: 441-448, 1975.[Medline]
  10. Li C., Wong W. H. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc. Natl. Acad. Sci. USA, 98: 31-36, 2001.[Abstract/Free Full Text]
  11. Liu J. J., Chao J. R., Jiang M. C., Ng S. Y., Yen J. J., Yang-Yen H. F. Ras transformation results in an elevated level of cyclin D1 and acceleration of G1 progression in NIH 3T3 cells. Mol. Cell. Biol., 15: 3654-3663, 1995.[Abstract]
  12. Lavoie J. N., L’Allemain G., Brunet A., Muller R., Pouyssegur J. Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by the p38/HOGMAPK pathway. J. Biol. Chem., 271: 20608-20616, 1996.[Abstract/Free Full Text]
  13. Kerkhoff E., Rapp U. R. Induction of cell proliferation in quiescent NIH 3T3 cells by oncogenic c-Raf-1. Mol. Cell. Biol., 17: 2576-2586, 1997.[Abstract]
  14. Woods D., Parry D., Cherwinski H., Bosch E., Lees E., McMahon M. Raf-induced proliferation or cell cycle arrest is determined by the level of Raf activity with arrest mediated by p21Cip1. Mol. Cell. Biol., 17: 5598-5611, 1997.[Abstract]
  15. Gille H., Downward J. Multiple ras effector pathways contribute to G1 cell cycle progression. J. Biol. Chem., 274: 22033-22040, 1999.[Abstract/Free Full Text]
  16. Rajagopalan H., Bardelli A., Lengauer C., Kinzler K. W., Vogelstein B., Velculescu V. E. Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature (Lond.), 418: 934 2002.[Medline]
  17. Lyons J. F., Wilhelm S., Hibner B., Bollag G. Discovery of a novel Raf kinase inhibitor. Endocr. Relat. Cancer, 8: 219-225, 2001.[Abstract]
  18. Cripps M. C., Figueredo A. T., Oza A. M., Taylor M. J., Fields A. L., Holmlund J. T., McIntosh L. W., Geary R. S., Eisenhauer E. A. Phase II randomized study of ISIS 3521 and ISIS 5132 in patients with locally advanced or metastatic colorectal cancer: a National Cancer Institute of Canada Clinical Trials Group Study. Clin. Cancer Res., 8: 2188-2192, 2002.[Abstract/Free Full Text]
  19. Coudert B., Anthoney A., Fiedler W., Droz J. P., Dieras V., Borner M., Smyth J. F., Morant R., de Vries M. J., Roelvink M., Fumoleau P. Phase II trial with ISIS 5132 in patients with small-cell (SCLC) and non-small cell (NSCLC) lung cancer. A European Organization for Research and Treatment of Cancer (EORTC) Early Clinical Studies Group report. Eur. J. Cancer, 37: 2194-2198, 2001.



This article has been cited by other articles:


Home page
 Eur Respir JHome page
E. Brambilla and A. Gazdar
Pathogenesis of lung cancer signalling pathways: roadmap for therapies
Eur. Respir. J., June 1, 2009; 33(6): 1485 - 1497.
[Abstract] [Full Text] [PDF]

Home page
 Am J Clin PatholHome page
R. De Oliveira Duarte Achcar, M. N. Nikiforova, and S. A. Yousem
Micropapillary Lung Adenocarcinoma: EGFR, K-ras, and BRAF Mutational Profile
Am J Clin Pathol, May 1, 2009; 131(5): 694 - 700.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. A. Pratilas, A. J. Hanrahan, E. Halilovic, Y. Persaud, J. Soh, D. Chitale, H. Shigematsu, H. Yamamoto, A. Sawai, M. Janakiraman, et al.
Genetic Predictors of MEK Dependence in Non-Small Cell Lung Cancer
Cancer Res., November 15, 2008; 68(22): 9375 - 9383.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. Yamamoto, H. Shigematsu, M. Nomura, W. W. Lockwood, M. Sato, N. Okumura, J. Soh, M. Suzuki, I. I. Wistuba, K. M. Fong, et al.
PIK3CA Mutations and Copy Number Gains in Human Lung Cancers
Cancer Res., September 1, 2008; 68(17): 6913 - 6921.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
M. Shinozaki, S. J. O'Day, M. Kitago, F. Amersi, C. Kuo, J. Kim, H.-J. Wang, and D. S.B. Hoon
Utility of Circulating B-RAF DNA Mutation in Serum for Monitoring Melanoma Patients Receiving Biochemotherapy
Clin. Cancer Res., April 1, 2007; 13(7): 2068 - 2074.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
K. M. Haigis, I. I. Wistuba, and J. M. Kurie
Lung premalignancy induced by mutant B-Raf, what is thy fate? To senesce or not to senesce, that is the question
Genes & Dev., February 15, 2007; 21(4): 361 - 366.
[Full Text] [PDF]

Home page
 Genes Dev.Home page
D. Dankort, E. Filenova, M. Collado, M. Serrano, K. Jones, and M. McMahon
A new mouse model to explore the initiation, progression, and therapy of BRAFV600E-induced lung tumors
Genes & Dev., February 15, 2007; 21(4): 379 - 384.
[Abstract] [Full Text] [PDF]

Home page
 J. Mol. Diagn.Home page
I.-J. Kim, H. C. Kang, S. G. Jang, S.-A Ahn, H.-J. Yoon, and J.-G. Park
Development and Applications of a BRAF Oligonucleotide Microarray
J. Mol. Diagn., February 1, 2007; 9(1): 55 - 63.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
G. J. Riely, K. A. Politi, V. A. Miller, and W. Pao
Update on Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer
Clin. Cancer Res., December 15, 2006; 12(24): 7232 - 7241.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Kobayashi, T. Shimamura, S. Monti, U. Steidl, C. J. Hetherington, A. M. Lowell, T. Golub, M. Meyerson, D. G. Tenen, G. I. Shapiro, et al.
Transcriptional Profiling Identifies Cyclin D1 as a Critical Downstream Effector of Mutant Epidermal Growth Factor Receptor Signaling
Cancer Res., December 1, 2006; 66(23): 11389 - 11398.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Chem.Home page
M. R. James, T. Dumeni, M. S. Stark, D. L. Duffy, G. W. Montgomery, N. G. Martin, and N. K. Hayward
Rapid Screening of 4000 Individuals for Germ-line Variations in the BRAF Gene
Clin. Chem., September 1, 2006; 52(9): 1675 - 1678.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. K. Thomas, B. Weir, and M. Meyerson
Genomic approaches to lung cancer.
Clin. Cancer Res., July 15, 2006; 12(14): 4384s - 4391s.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
D. H. Johnson
Targeted therapies in combination with chemotherapy in non-small cell lung cancer.
Clin. Cancer Res., July 15, 2006; 12(14): 4451s - 4457s.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
M. A. Jackson, I. Lea, A. Rashid, S. D. Peddada, and J. K. Dunnick
Genetic Alterations in Cancer Knowledge System: Analysis of Gene Mutations in Mouse and Human Liver and Lung Tumors
Toxicol. Sci., April 1, 2006; 90(2): 400 - 418.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
M. R. Sapio, D. Posca, G. Troncone, G. Pettinato, L. Palombini, G. Rossi, G. Fenzi, and M. Vitale
Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA)
Eur. J. Endocrinol., February 1, 2006; 154(2): 341 - 348.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Toyooka, M. Tokumo, H. Shigematsu, K. Matsuo, H. Asano, K. Tomii, S. Ichihara, M. Suzuki, M. Aoe, H. Date, et al.
Mutational and Epigenetic Evidence for Independent Pathways for Lung Adenocarcinomas Arising in Smokers and Never Smokers
Cancer Res., February 1, 2006; 66(3): 1371 - 1375.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. Davies, C. Hunter, R. Smith, P. Stephens, C. Greenman, G. Bignell, J. Teague, A. Butler, S. Edkins, C. Stevens, et al.
Somatic Mutations of the Protein Kinase Gene Family in Human Lung Cancer
Cancer Res., September 1, 2005; 65(17): 7591 - 7595.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
Y.-Z. Feng, T. Shiozawa, T. Miyamoto, H. Kashima, M. Kurai, A. Suzuki, and I. Konishi
BRAF Mutation in Endometrial Carcinoma and Hyperplasia: Correlation with KRAS and p53 Mutations and Mismatch Repair Protein Expression
Clin. Cancer Res., September 1, 2005; 11(17): 6133 - 6138.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
T. Shibata, S. Uryu, A. Kokubu, F. Hosoda, M. Ohki, T. Sakiyama, Y. Matsuno, R. Tsuchiya, Y. Kanai, T. Kondo, et al.
Genetic Classification of Lung Adenocarcinoma Based on Array-Based Comparative Genomic Hybridization Analysis: Its Association with Clinicopathologic Features
Clin. Cancer Res., September 1, 2005; 11(17): 6177 - 6185.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Shimamura, A. M. Lowell, J. A. Engelman, and G. I. Shapiro
Epidermal Growth Factor Receptors Harboring Kinase Domain Mutations Associate with the Heat Shock Protein 90 Chaperone and Are Destabilized following Exposure to Geldanamycins
Cancer Res., July 15, 2005; 65(14): 6401 - 6408.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. M. Akula, P. W. Ford, A. G. Whitman, K. E. Hamden, B. A. Bryan, P. P. Cook, and J. A. McCubrey
B-Raf-dependent expression of vascular endothelial growth factor-A in Kaposi sarcoma-associated herpesvirus-infected human B cells
Blood, June 1, 2005; 105(11): 4516 - 4522.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
W. Pao and V. A. Miller
Epidermal Growth Factor Receptor Mutations, Small-Molecule Kinase Inhibitors, and Non-Small-Cell Lung Cancer: Current Knowledge and Future Directions
J. Clin. Oncol., April 10, 2005; 23(11): 2556 - 2568.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. C. Ma, R. Jagadeeswaran, S. Jagadeesh, M. S. Tretiakova, V. Nallasura, E. A. Fox, M. Hansen, E. Schaefer, K. Naoki, A. Lader, et al.
Functional Expression and Mutations of c-Met and Its Therapeutic Inhibition with SU11274 and Small Interfering RNA in Non-Small Cell Lung Cancer
Cancer Res., February 15, 2005; 65(4): 1479 - 1488.
[Abstract] [Full Text] [PDF]

Home page
 Cold Spring Harb Symp Quant BiolHome page
H. VARMUS, W. PAO, K. POLITI, K. PODSYPANINA, and Y.-C.N. DU
Oncogenes Come of Age
Cold Spring Harb Symp Quant Biol, January 1, 2005; 70(0): 1 - 9.
[Abstract] [PDF]

Home page
 Cold Spring Harb Symp Quant BiolHome page
R.K. THOMAS, H. GREULICH, Y. YUZA, J.C. LEE, T. TENGS, W. FENG, T.-H. CHEN, E. NICKERSON, J. SIMONS, M. EGHOLM, et al.
Detection of Oncogenic Mutations in the EGFR Gene in Lung Adenocarcinoma with Differential Sensitivity to EGFR Tyrosine Kinase Inhibitors
Cold Spring Harb Symp Quant Biol, January 1, 2005; 70(0): 73 - 81.
[Abstract] [PDF]

Home page
 INT J SURG PATHOLHome page
P. Smyth, S. Finn, S. Cahill, E. O'Regan, R. Flavin, J. J. O'Leary, and O. Sheils
ret/PTC and BRAF Act as Distinct Molecular, Time-Dependant Triggers in a Sporadic Irish Cohort of Papillary Thyroid Carcinoma
International Journal of Surgical Pathology, January 1, 2005; 13(1): 1 - 8.
[Abstract] [PDF]

Home page
 Cancer Res.Home page
M. Bentires-Alj, J. G. Paez, F. S. David, H. Keilhack, B. Halmos, K. Naoki, J. M. Maris, A. Richardson, A. Bardelli, D. J. Sugarbaker, et al.
Activating Mutations of the Noonan Syndrome-Associated SHP2/PTPN11 Gene in Human Solid Tumors and Adult Acute Myelogenous Leukemia
Cancer Res., December 15, 2004; 64(24): 8816 - 8820.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
J. Lima, V. Trovisco, P. Soares, V. Maximo, J. Magalhaes, G. Salvatore, M. Santoro, T. Bogdanova, M. Tronko, A. Abrosimov, et al.
BRAF Mutations Are Not a Major Event in Post-Chernobyl Childhood Thyroid Carcinomas
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4267 - 4271.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
J. G. Paez, P. A. Janne, J. C. Lee, S. Tracy, H. Greulich, S. Gabriel, P. Herman, F. J. Kaye, N. Lindeman, T. J. Boggon, et al.
EGFR Mutations in Lung Cancer: Correlation with Clinical Response to Gefitinib Therapy
Science, June 4, 2004; 304(5676): 1497 - 1500.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Ikenoue, Y. Hikiba, F. Kanai, J. Aragaki, Y. Tanaka, J. Imamura, T. Imamura, M. Ohta, H. Ijichi, K. Tateishi, et al.
Different Effects of Point Mutations within the B-Raf Glycine-Rich Loop in Colorectal Tumors on Mitogen-Activated Protein/Extracellular Signal-Regulated Kinase Kinase/Extracellular Signal-Regulated Kinase and Nuclear Factor {kappa}B Pathway and Cellular Transformation
Cancer Res., May 15, 2004; 64(10): 3428 - 3435.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
E. Puxeddu, S. Moretti, R. Elisei, C. Romei, R. Pascucci, M. Martinelli, C. Marino, N. Avenia, E. D. Rossi, G. Fadda, et al.
BRAFV599E Mutation Is the Leading Genetic Event in Adult Sporadic Papillary Thyroid Carcinomas
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2414 - 2420.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
K. Fransen, M. Klintenas, A. Osterstrom, J. Dimberg, H.-J. Monstein, and P. Soderkvist
Mutation analysis of the BRAF, ARAF and RAF-1 genes in human colorectal adenocarcinomas
Carcinogenesis, April 1, 2004; 25(4): 527 - 533.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Ikenoue, Y. Hikiba, F. Kanai, Y. Tanaka, J. Imamura, T. Imamura, M. Ohta, H. Ijichi, K. Tateishi, T. Kawakami, et al.
Functional Analysis of Mutations within the Kinase Activation Segment of B-Raf in Human Colorectal Tumors
Cancer Res., December 1, 2003; 63(23): 8132 - 8137.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
D. Rimoldi, S. Salvi, D. Lienard, F. J. Lejeune, D. Speiser, L. Zografos, and J.-C. Cerottini
Lack of BRAF Mutations in Uveal Melanoma
Cancer Res., September 15, 2003; 63(18): 5712 - 5715.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
F. Cruz III, B. P. Rubin, D. Wilson, A. Town, A. Schroeder, A. Haley, T. Bainbridge, M. C. Heinrich, and C. L. Corless
Absence of BRAF and NRAS Mutations in Uveal Melanoma
Cancer Res., September 15, 2003; 63(18): 5761 - 5766.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
H. Namba, M. Nakashima, T. Hayashi, N. Hayashida, S. Maeda, T. I. Rogounovitch, A. Ohtsuru, V. A. Saenko, T. Kanematsu, and S. Yamashita
Clinical Implication of Hot Spot BRAF Mutation, V599E, in Papillary Thyroid Cancers
J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4393 - 4397.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. Wang, J. M. Cunningham, J. L. Winters, J. C. Guenther, A. J. French, L. A. Boardman, L. J. Burgart, S. K. McDonnell, D. J. Schaid, and S. N. Thibodeau
BRAF Mutations in Colon Cancer Are Not Likely Attributable to Defective DNA Mismatch Repair
Cancer Res., September 1, 2003; 63(17): 5209 - 5212.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. L. Chan, W. Zhao, Cancer Genome Project, S. Y. Leung, and S. T. Yuen
BRAF and KRAS Mutations in Colorectal Hyperplastic Polyps and Serrated Adenomas
Cancer Res., August 15, 2003; 63(16): 4878 - 4881.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
X. Xu, R. M. Quiros, P. Gattuso, K. B. Ain, and R. A. Prinz
High Prevalence of BRAF Gene Mutation in Papillary Thyroid Carcinomas and Thyroid Tumor Cell Lines
Cancer Res., August 1, 2003; 63(15): 4561 - 4567.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. Kumar, S. Angelini, K. Czene, I. Sauroja, M. Hahka-Kemppinen, S. Pyrhonen, and K. Hemminki
BRAF Mutations in Metastatic Melanoma: A Possible Association with Clinical Outcome
Clin. Cancer Res., August 1, 2003; 9(9): 3362 - 3368.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naoki, K.
Right arrow Articles by Meyerson, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naoki, K.
Right arrow Articles by Meyerson, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online