| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Laboratory for Experimental Medicine and Endocrinology, Gasthuisberg, Catholic University of Leuven, B-3000 Leuven, Belgium
| ABSTRACT |
|---|
|
|
|---|
abrogates the inhibitory effects of PTEN expression and restores FAS promoter activity. Taken together, these results demonstrate that inactivation of PTEN and subsequent activation of the PI3k/Akt kinase pathway may play an important role in the overexpression of the FAS protein in cancer cells. | Introduction |
|---|
|
|
|---|
As part of our studies to additionally elucidate the molecular mechanisms underlying the overexpression of lipogenic enzymes in cancer cells, we have used LNCaP prostate cancer cells as a paradigm of FAS-overexpressing PTEN-null cancer cells and have addressed the question to which extent inactivation of the PTEN tumor suppressor and subsequent activation of the PI3k/Akt pathway may contribute to the observed overexpression of FAS.
| Materials and Methods |
|---|
|
|
|---|
Immunoblot Analysis.
LNCaP cells were plated in 60-mm dishes at a density of 106 cells/dish and treated as indicated. For immunoblot analysis cells were washed and lysed in a reducing SDS sample buffer (62.5 mM Tris pH 6.8, 2% SDS, 0.715 M 2-mercaptoethanol, 8.7% glycerol). Protein concentrations were determined on diluted samples using a bicinchoninic acid procedure (Pierce Biochemical Company, Rockford, IL). Equal amounts of protein were separated on an SDS-polyacrylamide gel and blotted onto a polyvinylidene difluoride membrane for FAS (Roche, Mannheim, Germany) or onto Hybond enhanced chemiluminescence membranes for all of the other antibodies (Amersham International, Buckinghamshire, United Kingdom). Membranes were blocked in a Tris-buffered saline solution with 5% nonfat dry milk and incubated with antibodies against Akt (Biosource International, Camarillo, CA), S473-phosphorylated Akt (Biosource), PTEN (Cell Signaling Technology, Beverly, MA), cytokeratin 18 (Dako, Glostrup, Denmark), or FAS. This latter antiserum was prepared in rabbits using purified FAS from SKBR-3 breast cancer cells as antigen and specifically recognizes the Mr 265,000 FAS protein. Immunoreactive signals were detected by incubation with horseradish peroxidase-conjugated secondary antibodies (Dako) followed by chemiluminescent detection of immunoreactive proteins (Renaissance; New England Nuclear, Dreiech, Germany).
RNA Preparation and Analysis.
LNCaP cells were seeded in 60-mm dishes at a density of 106 cells/dish. The next day, medium was replaced and cells were treated as indicated in the legends to the figures. Plates were washed with Dulbeccos PBS (Invitrogen), snap-frozen in liquid nitrogen, and stored at -80°C. Total RNA was prepared using the guanidine/CsCl ultracentrifugation method (18)
. Northern blot analysis for FAS expression was carried out as described before (7)
. Equal loading of RNA was verified by hybridization with a probe for 18 S rRNA (7)
. This same procedure was followed to assess the expression of luciferase mRNA in transient transfections. A luciferase-specific probe was prepared from the pGL3b vector (Promega).
FAS Promoter-Reporter Studies.
LNCaP cells were plated on day 0 in 60-mm dishes in RPMI 1640 containing 10% FCS at a density of 1 x 106 cells/dish. The next day transfection mixtures were prepared. For each plate, 2 ml of serum-free DMEM (Invitrogen) was supplemented with 23 µg of the FAS promoter-reporter construct described before (8)
. Where indicated, 0.5 µg of expression constructs encoding wild type PTEN (pSG5L-HA-PTENwt), mutant PTEN (pSG5L-HA-PTEN-G129E and pSGL5-HA-PTEN-G129R), Akt (pLNCX-HA-Akt), my-Akt (pLNCX-HA-myrAkt), or the corresponding empty vectors (pSG5L and pLNCX), all kindly provided by Dr. W. Sellers (Harvard Medical School, Boston, MA; Ref. 19
), were added. After the addition of 9 µl of Transfast (Promega, Madison, WI) the transfection mixture was incubated for 15 min at room temperature. Cells were washed with serum-free medium, the transfection mixture was added, and cultures were incubated for 30 min in the CO2 incubator. RPMI 1640 (3 ml) with 10% FCS was added. On day 3, medium was replaced. The next day, cells were washed with PBS and lysed in 500 µl of passive lysis buffer (Promega). Aliquots of 15 µl of cleared lysate were assayed for luciferase activity by using a luciferase reporter assay kit from Promega and a Berthold Microlumat LB 96P luminometer. Similar experiments were carried out in the presence of an expression vector encoding GFP (pEGFP; Clontech, Palo Alto, CA), to monitor potential changes in the number of transfected cells after transfection with PTEN. Expression of recombinant PTEN and Akt forms was assessed through immunoblot analysis with an antibody against the hemagglutinin (HA) epitope encoded for by the expression constructs (19)
.
Adenoviral Expression of PTEN.
The Adeno-X Tet-Off expression system was obtained from Clontech. A PCR fragment encompassing the coding region of the PTEN gene was generated using a forward primer 5' GAAGGATCCAC-CATGACAGCCATCATCAAAGAG adapted with a BamHI site (italicized) and the reverse primer 5'GAATCTAGATCAGACTTTTGTAATTTGTGTATGCTG containing an XbaI site (italicized). After digestion with BamHI and XhoI the fragment was ligated into the pTRE-Shuttle vector. Integrity of the construct was verified by restriction digestion and DNA sequence analysis. To create the phosphatase-death PTEN-G129R construct, codon 129 was mutated using the Quikchange site-directed mutagenesis kit from Stratagene (La Jolla, CA). The Tet-responsive expression cassette from the recombinant pTRE-Shuttle plasmids was excised using I-CeuI and PI-SceI, and ligated into the predigested Adeno-X viral DNA. Recombinant Adeno-X viral DNA was propagated in Escherichia coli, linearized by digestion with PacI, and transfected into low passage HEK 293 cells. To produce high-titer adenovirus stocks, HEK 293 cells were infected with recombinant virus, and growth medium was collected when most of the cells had detached. LNCaP cells were plated in 60-mm dishes at a density of 106 cells/dish. Two days later, cells were coinfected with the Tet-responsive recombinant virus and with the tetracyclin-controlled transactivator virus, Adeno-X Tet-Off, at a multiplicity of infection of
5 plaque-forming units of each virus strain/cell. After incubation for 2 h in the CO2 incubator at 37°C, the virus-containing medium was removed and fresh growth medium (MEM
+ 10% Tet-approved FCS from Clontech) was added. Where indicated, Dox (Clontech) was added to a final concentration of 1 µg/ml. Later (42 h), cells were harvested and protein extracts were made for immunoblot analysis as described above.
| Results |
|---|
|
|
|---|
|
|
To confirm that inactivation of the PI3k is responsible for the decrease in FAS expression, we cotransfected LNCaP cells with an expression construct encoding PTEN. PTEN is a dual action phosphatase dephosphorylating both 3'phosphoinositides (thus catalyzing the reverse reaction of PI3k) and phosphoproteins (20)
. To distinguish between these two actions we used constructs encoding mutant forms of PTEN, which lack only the lipid phosphatase function (PTEN-G129E) or lack both lipid and protein phosphatase functions (PTEN-G129R). As shown in Fig. 3A
, reintroduction of wild-type PTEN resulted in a 2.53-fold reduction in FAS promoter-reporter activity. In contrast, none of the mutated PTEN proteins showed any inhibition of FAS promoter-reporter activity, despite equally efficient expression of the different PTEN forms (data not shown). To exclude that the inhibitory effects on luciferase activity are caused by PTEN-induced apoptosis and subsequent cell loss (21)
, similar transfection experiments were carried out in the presence of an expression vector encoding GFP. Although limited changes in the number of GFP-positive cells were noticed (data not shown), these effects could not fully account for the observed reduction of FAS promoter-reporter activity induced by expression of PTEN.
|
Because Akt is one of the main downstream effectors of PI3k and because inhibition of PI3k or reintroduction of wild-type PTEN blocks activation of Akt in LNCaP cells (see Figs. 1
and 3B
), we were interested to see whether Akt functions as the downstream effector of PI3k action on FAS expression. To answer this question we examined whether Akt could reverse the inhibitory effect of PTEN. To introduce active Akt into LNCaP cells, we used an expression vector encoding a myr-Akt. This form is constitutively active irrespective of the phosphatidylinositol 3,4,5-triphosphate levels. As shown in Fig. 4
, expression of constitutively active Akt completely reversed the inhibitory effects of PTEN on FAS promoter-reporter activity. As expected, wild-type Akt, which is supposed to be poorly active in the presence of functional PTEN, had only slight effects. To exclude that these effects on luciferase activity are because of general changes in protein translation and/or stability of the luciferase protein, luciferase expression was examined also at the mRNA level. Consistent with an earlier report (17)
, transfection with PTEN and/or Akt resulted in similar effects at the mRNA level as at the level of luciferase activity (data not shown).
|
| Discussion |
|---|
|
|
|---|
Our finding that LY294002 completely abolishes FAS protein expression while causing a more limited (24-fold) decrease in FAS promoter-reporter activity and in steady state mRNA levels (23-fold), suggests that PI3k/Akt acts at the transcriptional level with additional effects at the protein level. Transcriptional effects may in part be because of activation of specific lipogenic transcription factors such as sterol-regulatory element-binding protein-1 (SREBP-1). This transcription factor has been shown previously to be activated by PI3k and Akt in hepatocytes, and is involved in the activation of tumor-associated FAS transcription by androgens and by growth factors (7, 8, 9, 10, 11, 12
, 22, 23, 24)
. However, preliminary studies aimed at the additional elucidation of this mechanism revealed that deletion of the SREBP-binding site in the FAS promoter only partially abolishes the effects of LY294002 and of PTEN (data not shown). This suggests that additional and perhaps more general effects on transcription may be involved. This latter hypothesis is supported by earlier findings that many apparently unrelated promoters are affected by PTEN and by the PI3k/Akt kinase pathway in LNCaP cells (14
, 17)
. In regard to the additional effects of PI3k/Akt at the protein level, it is worth mentioning that regulators of protein translation are among the downstream targets of the PI3k/Akt pathway (13
, 25) . Modulation of these regulators may affect FAS protein levels through a more general effect on protein translation. However, FAS seems to be affected more severely than several other proteins (e.g., Akt, CK18; see Figs. 1
and 3B
). This suggests that FAS is more sensitive to these effects than other proteins or that also other mechanisms, more selectively affecting FAS protein levels (e.g., phosphorylation-induced protein stabilization), are involved.
Whatever the exact mechanism by which the PI3k/Akt pathway activates FAS expression in LNCaP cells, to the best of our knowledge, this is the first direct demonstration of a link between the activation of a specific signal transduction pathway and overexpression of FAS expression in cancer cells. To which extent this pathway ultimately contributes to the overexpression of FAS in various cancers in vivo awaits additional investigation. One possible strategy to pursue this question is to look for correlations between activation of the PI3k/Akt pathway and increased FAS protein expression in clinical cancer samples by immunohistochemistry.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by cancer research grants from FB Insurance and VIVA, the "Geconcerteerde Onderzoeksactie van de Vlaamse Gemeenschap," the Fund for Scientific Research-Flanders (Belgium), the "Belgische Federatie tegen Kanker," and the Interuniversity Poles of Attraction Programme-Belgian State, Prime Ministers Office, Federal Office for Scientific, Technical and Cultural Affairs. T. V. d. S. is a research assistant of the Fund for Scientific Research-Flanders (Belgium). ![]()
2 To whom requests for reprints should be addressed, at LEGENDO, Onderwijs en Navorsing, Gasthuisberg, Herestraat 49, B-3000 Leuven, Belgium. Phone: 32-16-34-59-80; Fax: 32-16-34-59-34; E-mail: Johan.Swinnen{at}med.kuleuven.ac.be ![]()
3 The abbreviations used are: FAS, fatty acid synthase; PI3k, phosphatidylinositol 3'-kinase; GFP, green fluorescent protein; Dox, doxycycline; myr-Akt, myristoylated form of Akt; HA hemagglutinin; SREBP, sterol regulatory element-binding protein. ![]()
Received 10/ 9/01. Accepted 12/ 5/01.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. L. Little, F. B. Wheeler, C. Koumenis, and S. J. Kridel Disruption of crosstalk between the fatty acid synthesis and proteasome pathways enhances unfolded protein response signaling and cell death Mol. Cancer Ther., December 1, 2008; 7(12): 3816 - 3824. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Plathow and W. A. Weber Tumor Cell Metabolism Imaging J. Nucl. Med., June 1, 2008; 49(Suppl_2): 43S - 63S. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Xiao, Y. Su, R. C. M. Simmen, and F. A. Simmen Dietary soy protein inhibits DNA damage and cell survival of colon epithelial cells through attenuated expression of fatty acid synthase Am J Physiol Gastrointest Liver Physiol, April 1, 2008; 294(4): G868 - G876. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Furuta, S. K. Pai, R. Zhan, S. Bandyopadhyay, M. Watabe, Y.-Y. Mo, S. Hirota, S. Hosobe, T. Tsukada, K. Miura, et al. Fatty Acid Synthase Gene Is Up-regulated by Hypoxia via Activation of Akt and Sterol Regulatory Element Binding Protein-1 Cancer Res., February 15, 2008; 68(4): 1003 - 1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Hegde, D. Rusnak, M. Bertiaux, K. Alligood, J. Strum, R. Gagnon, and T. M. Gilmer Delineation of molecular mechanisms of sensitivity to lapatinib in breast cancer cell lines using global gene expression profiles Mol. Cancer Ther., May 1, 2007; 6(5): 1629 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhou, W. F. Han, L. E. Landree, J. N. Thupari, M. L. Pinn, T. Bililign, E. K. Kim, A. Vadlamudi, S. M. Medghalchi, R. El Meskini, et al. Fatty Acid Synthase Inhibition Activates AMP-Activated Protein Kinase in SKOV3 Human Ovarian Cancer Cells Cancer Res., April 1, 2007; 67(7): 2964 - 2971. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. DeBerardinis, J. J. Lum, and C. B. Thompson Phosphatidylinositol 3-Kinase-dependent Modulation of Carnitine Palmitoyltransferase 1A Expression Regulates Lipid Metabolism during Hematopoietic Cell Growth J. Biol. Chem., December 8, 2006; 281(49): 37372 - 37380. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cheng, R. Snoek, F. Ghaidi, M. E. Cox, and P. S. Rennie Short Hairpin RNA Knockdown of the Androgen Receptor Attenuates Ligand-Independent Activation and Delays Tumor Progression Cancer Res., November 1, 2006; 66(21): 10613 - 10620. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lupu and J. A. Menendez Targeting Fatty Acid Synthase in Breast and Endometrial Cancer: An Alternative to Selective Estrogen Receptor Modulators? Endocrinology, September 1, 2006; 147(9): 4056 - 4066. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. P. Kuhajda Fatty Acid synthase and cancer: new application of an old pathway. Cancer Res., June 15, 2006; 66(12): 5977 - 5980. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, Y. Shi, V. L. Giranda, and Y. Luo Inhibition of the phosphatidylinositol 3-kinase/Akt pathway sensitizes MDA-MB468 human breast cancer cells to cerulenin-induced apoptosis. Mol. Cancer Ther., March 1, 2006; 5(3): 494 - 501. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z Culig, H Steiner, G Bartsch, and A Hobisch Mechanisms of endocrine therapy-responsive and -unresponsive prostate tumours Endocr. Relat. Cancer, June 1, 2005; 12(2): 229 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Brusselmans, R. Vrolix, G. Verhoeven, and J. V. Swinnen Induction of Cancer Cell Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity J. Biol. Chem., February 18, 2005; 280(7): 5636 - 5645. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Maeda, S. Nagata, C. D. Wolfgang, G. L. Bratthauer, T. K. Bera, and I. Pastan The T Cell Receptor {gamma} Chain Alternate Reading Frame Protein (TARP), a Prostate-specific Protein Localized in Mitochondria J. Biol. Chem., June 4, 2004; 279(23): 24561 - 24568. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. Webster-Cyriaque, C. C. Tomlinson, M. Yohe, and S. Kenney Fatty Acid Synthase Expression Is Induced by the Epstein-Barr Virus Immediate-Early Protein BRLF1 and Is Required for Lytic Viral Gene Expression J. Virol., April 15, 2004; 78(8): 4197 - 4206. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Kridel, F. Axelrod, N. Rozenkrantz, and J. W. Smith Orlistat Is a Novel Inhibitor of Fatty Acid Synthase with Antitumor Activity Cancer Res., March 15, 2004; 64(6): 2070 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rossi, E. Graner, P. Febbo, L. Weinstein, N. Bhattacharya, T. Onody, G. Bubley, S. Balk, and M. Loda Fatty Acid Synthase Expression Defines Distinct Molecular Signatures in Prostate Cancer Mol. Cancer Res., August 1, 2003; 1(10): 707 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. De Schrijver, K. Brusselmans, W. Heyns, G. Verhoeven, and J. V. Swinnen RNA Interference-mediated Silencing of the Fatty Acid Synthase Gene Attenuates Growth and Induces Morphological Changes and Apoptosis of LNCaP Prostate Cancer Cells Cancer Res., July 1, 2003; 63(13): 3799 - 3804. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. D. Camassei, R. Cozza, A. Acquaviva, A. Jenkner, L. Rava, R. Gareri, A. Donfrancesco, C. Bosman, P. Vadala, T. Hadjistilianou, et al. Expression of the Lipogenic Enzyme Fatty Acid Synthase (FAS) in Retinoblastoma and Its Correlation with Tumor Aggressiveness Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2399 - 2403. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |