Cancer Research Annual Meeting 2010 Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hartmann, A.
Right arrow Articles by Knuechel, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hartmann, A.
Right arrow Articles by Knuechel, R.
[Cancer Research 62, 809-818, February 1, 2002]
© 2002 American Association for Cancer Research

Molecular Biology and Genetics

Occurrence of Chromosome 9 and p53 Alterations in Multifocal Dysplasia and Carcinoma in Situ of Human Urinary Bladder1

Arndt Hartmann, Gudrun Schlake, Dirk Zaak, Edwin Hungerhuber, Alfons Hofstetter, Ferdinand Hofstaedter and Ruth Knuechel

Institute of Pathology, University of Regensburg, 93042 Regensburg (A. Ha., G. S., F. H., R. K.), and Department of Urology, Ludwig Maximilian University, 81377 Munich (D. Z., E. H., A. Ho.), Germany


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To define the genetic changes of flat urothelial lesions, carcinoma in situ (CIS) and moderate dysplasias (DII) were investigated for alterations in the two chromosomal regions most frequently involved in bladder cancer. Overall, 33 CIS and 16 DII from 21 patients were used to microdissect urothelium. Dual color fluorescence in situ hybridization (FISH) using gene locus probes of 9q22 (FACC), 9p21 (CDK), 17p13 (p53), and related centromeric probes was applied on interphase nuclei. In parallel, preamplified DNA of these samples was used for loss of heterozygosity (LOH) analyses with eight microsatellite markers on chromosomes 9p, 9q and 17p, and for sequencing of exons 5–9 of p53. Data indicated nearly identical deletion frequencies for chromosomes 9 and 17 for CIS (chromosome 9, 86%; p53, 84%). DII showed a lower deletion rate in comparison with CIS (chromosome 9, 75%; p53, 53%). A very high correlation between the results of FISH and LOH analyses was found. p53 mutations were detected in 12 of 15 patients (CIS, 72%; DII, 67%). In three of 16 patients with multifocal tumors, oligoclonal lesions were identified by LOH analyses, a finding further supported by sequencing of p53, by which two different p53 deletions were detected in two cases. In conclusion, data from microdissected flat urothelial lesions indicate that chromosome 9 deletions cannot be regarded as indicators of papillary growth, because they are found frequently in both types of flat lesions of the urothelium: those associated with papillary tumors and those that are not. The similar distribution and lower amount of genetic changes in DII render DII a possible precursor lesion of CIS.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CIS3 of the urothelium is known as an obligate precancerous lesion in the urinary tract, which is hard to see during standard white light endoscopy. When diagnosed histologically, it demands close follow-up and intravesical treatment with different strains of mycobacterium bovis (BCG) followed by cystectomy in case of progression to invasive disease (1) .

In search of a better tool to identify these lesions, photodynamic diagnosis with 5-ALA seems promising (2) . The fluorescence endoscopy after the instillation of 5-ALA shows red fluorescence, and not only in papillary tumors; there is also a marked circular red fluorescence in clinically inconspicuous areas of the bladder mucosa. Histological examination has identified many of these lesions as DII and CIS (3 , 4) and has led to an increase in the detection rate of flat lesions by 30% in comparison with white light endoscopy.

At the same time, flat urothelial lesions, including CIS, have been brought to an increased attention by a renewed classification of urothelial tumors (5) . This classification defines CIS as "a nonpapillary, i.e., flat lesion, in which the surface epithelium contains cells that are cytologically malignant." In contrast to the previous definition of a complete disorder of epithelial layers, not the whole thickness of the urothelium has to be involved for the diagnosis of CIS in the recent definition. Consequently, part of the former cases of DII will be diagnosed as CIS, and the grading of intraurothelial neoplasia will be reduced to 2 instead of 3 (6) with DII defined as low-grade intraurothelial neoplasia, and CIS as a synonym for high-grade intraurothelial neoplasia.

First retrospective clinical/histopathological studies seem to support the new classification (7 , 8) . However, the decision for treatment of the former DII identical to CIS has to be further validated by prospective clinical studies. The studies should be designed as long-term observations in which the mixed occurrences of papillary and flat lesions have to be considered and the rare primary low-grade/high-grade intraurothelial neoplasias should be separated from the frequent secondary lesions associated with invasive urothelial carcinomas (9) . In addition, further understanding of the molecular carcinogenesis will help elucidate the importance of specific genetic alterations in the development of intraurothelial neoplastic lesions to invasive cancer and possibly distinguish lesions that predict an aggressive course of the disease.

Clinical and molecular data suggest that urothelial carcinomas develop by different molecular pathways and arise de novo or originate from either superficial papillary tumors or flat intraurothelial neoplasia (i.e., CIS; Ref. 10 ). Cytogenetic and ploidy studies showed that CIS is frequently aneuploid and has complex chromosomal aberrations that are indistinguishable from invasive carcinoma in the majority of cases (11 , 12) . Looking at the recent knowledge of genetic changes in CIS, it is emphasized that it can be separated from the clinically different papillary tumor by low frequencies in chromosome 9 alterations and high frequencies of p53 deletions. This has led to the hypothesis of two genetically different but sometimes overlapping pathways for flat and consequently solid neoplasia versus initial papillary neoplasia with relative infrequent progression to invasive growth (for review, see, e.g., Refs. 10 , 13 ).

Only a few genetic data are found in the literature on DII as a potential precursor of CIS, showing frequent aneuploidy and diffuse overexpression of the cErbB2 oncoprotein (11 , 14) .

Whereas data on precursor lesions have mostly been deducted from knowledge of advanced tumors, recent technology provides tools to analyze small epithelial lesions genetically. Among others, Czerniak et al. (13) used microdissection of urothelial lesions and normal urothelium to perform LOH analysis in cystectomy specimens to trace the molecular carcinogenesis of bladder cancer. Whole genomic amplification of microdissected tissue (15) further allows us to compare different genetic methods such as FISH, deletion mapping by microsatellite analyses, and mutation analyses of specific genes from small lesions (16) . This approach revealed the first data on deletions in flat urothelial lesions as hyperplasias (17) , papillary hyperplasias (18) , and even normal urothelium of tumor patients (16 , 17) .

In the study presented here, we have focused on multifocal DII and CIS, detected with photodynamic diagnosis; 5-ALA. FISH, and LOH analyses of various loci on chromosomes 9 and 17 were performed for deletion detection. Direct sequencing of exons 5–9 of the p53 gene was carried out to characterize frequency and type of p53 mutations in CIS and DII. The biopsies were taken from cases with or without accompanying papillary tumors to test three hypotheses in this set of investigations: (a) CIS is a lesion genetically different from a papillary tumor; (b) genetic data validate that DII can be grouped with CIS; (c) there is no difference between flat neoplasia with accompanying (i.e., parallel) papillary tumor and flat neoplasia without papillary tumors.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Patient Material and Histopathological Diagnosis.
Patient material was obtained from a clinical trial evaluating the photodynamic diagnosis of bladder cancer as described previously (17 , 19) . Biopsies were taken from fluorescent lesions, immediately snap-frozen, and transported on dry ice. Histological diagnosis was established on serial frozen sections stained with H&E. All lesions were classified according to the previous WHO classification of urothelial neoplasm (20) . The study included DII and CIS, CIS regarded as synonymous for severe dysplasia. According to the recently published new WHO consensus classification of urothelial neoplasms in the urinary bladder (5) , some of the lesions classified as DII in the present study would be classified as CIS (high-grade intraurothelial neoplasia), because the involvement of the complete height of the urothelium for the diagnosis of CIS is no longer required. The dysplastic urothelial lesions investigated in our study showed clear features of cytological malignancy and could be distinguished from reactive urothelial alterations. For genetic evaluation, to provide histologically separate entities for analysis, only those dysplastic lesions were chosen that were not in direct contact with a CIS lesion.

Following these criteria, we analyzed a total of 36 CIS lesions and 16 DII from 21 patients. Patient data, including the localization of the lesions, follow-up information, and classification of simultaneous or consecutive accompanying lesions as papillary and invasive tumors, are presented in Table 1Citation . Furthermore, nine areas of normal urothelium without significant cystitis from six patients of our cohort were chosen for genetic analysis using FISH (Table 1)Citation .


View this table:
[in this window]
[in a new window]

  		Table 1 Histopathological and clinical data of 21 patients with flat intraurothelial lesions

 
Microdissection, Cell Dissociation and DNA Isolation.
From all of the biopsies, serial 15-µm sections were cut and stained with methylene blue for 15 s. Microdissection of urothelium from stromal cells using a needle under an inverted microscope (x40) was carried out by one of the pathologists (G. S., A. Ha.), assuring the presence of the urothelial alterations in the urothelium. For small lesions and those starting abruptly in the urothelium, laser microdissection was used (PALM, Microlaser Technologies, Bernried, Germany; Ref. 21 ) as described previously (22) . The microdissected samples contained at least 90% urothelial cells. Samples containing at least 500 cells for both DNA isolation and cell dissociation for FISH analysis were microdissected from consecutive sections. In the case of smaller lesions, samples only for FISH analysis were procured.

Cell dissociation was performed as described previously (17) . The cells were pelleted on silanized glass slides by standard microcentrifugation, fixed in freshly prepared methanol/acetic acid (3:1), air dried, and stored at -70°C for up to 4 months. DNA isolation was performed as described previously (15 , 19) . Normal DNA as reference for LOH analysis was isolated from 7.5 ml of EDTA blood using the Qiagen blood isolation kit (Qiagen, Hilden, Germany) or from microdissected stromal or muscle tissue of the urinary bladder.

FISH and Scoring of FISH Signals.
For enumeration of chromosomes 9 and 17, biotin-labeled centromere probes (D9Z1 and D17Z1; Oncor, Gaithersburg, MD) were used. Probes were combined with P1 probes obtained from the Lawrence Berkeley National Laboratory/University of California San Francisco Resource for Molecular Cytogenetics. The following probes were used: RMC09P007 for 9p21 (CDKI2/p16 locus), RMC09P008 for 9q22 (FACC locus), and RMC17P078 for 17p13 (p53 gene locus). DNA isolation and probe labeling was as described previously (17) .

The dual-color FISH staining technique was performed as described previously (17) . Briefly, cells on slides were denatured in 70% formamide/2x SCC (pH 7.0), at 75°C for 2.5 min. After dehydration in graded ethanol (70, 80, and 100%) for 2 min each, samples were treated with proteinase K (Sigma Chemical Co., St. Louis, MO) for 7 min at 37°C, followed again by ethanol dehydration. Proteinase K was used at a concentration of 0.4 µg/ml for all lesions except normal urothelium, requiring a concentration of 0.6–0.8 µg/ml for adequate nuclear suspensions. The hybridization mixture was denatured for 5 min at 75°C and subsequently reannealed for 40 min at 37°C. Ten µl of hybridization mixture [20–30 ng of gene-specific probe, 5–10 ng of unlabeled sonicated human placental DNA (Sigma Chemical Co.), 1 µl of centromeric probe (Oncor) in 50% formamide, 10% dextran sulfate and 2x SCC (pH 7.0)] were applied to each cytospin. Hybridization was overnight at 37°C.

For each hybridization, cytospins of cultured normal urothelial cells (Urotsa; Refs. 17 , 23 ) were included as controls for hybridization efficiency. The probes were visualized by immunostaining in three steps: (a) 10 µg/ml FITC-conjugated antidigoxigenin (Boehringer Mannheim); (b) 0.3 µg/ml FITC-conjugated antisheep IgG (Sigma Chemical Co.); and (c) 0.3 µg/ml Texas Red avidin (Vector, Burlingame, CA). Counterstaining was performed with DAPI in Vectashield mounting medium (Vector).

Cells were selected for scoring by morphological criteria. Clearly distinguishable small lymphocytes and granulocytes were disregarded, and all other cells were scored. Slides were evaluated only when more then 75% of the nuclei were interpretable. For the small flat lesions, a minimum of 60, and a maximum of 200, nuclei were counted. The range of counted cells in normal urothelium was 57–92 nuclei. After previous work had shown low interobserver variability in counting FISH signals (Ref. 17 and unpublished data),4 slides were investigated by one pathologist (G. S.) and every other slide was controlled by a second independent investigator (A. Ha. or R. K.). Values of >40% (equivalent, 2x mean ± SD) of total counted nuclei was used as a conservative definition for deletions of either of the gene loci investigated.

FISH data were also used for a preliminary evaluation of ploidy of lesions. The two hybridizations of the centromere probe of chromosome 9 and the centromeric probe of chromosome 17 were quantitated. When hybridization of centromeres showed >2 each per cell for centromere 17 and at the same time for centromere 9 in more than 10% of the cells investigated, the lesion was considered to have a nondiploid stem line, and was classified as nondiploid.

Whole Genomic Amplification and Microsatellite Analyses for LOH Detection.
Whole genomic amplification was carried out according to a protocol established in our laboratory applying an I-PEP-PCR (15 , 19) . Fifty % of the isolated DNA was used for the initial preamplification. After an independent whole genome amplification to exclude preferential allelic amplification and polymerase errors, the second one-half of the sample was used for confirmation of the LOH results and the p53 mutations. All of the LOH results and mutations without confirmation in the second PCR sample were excluded as polymerase errors in the PCR. I-PEP-PCR is a preamplification method based on totally degenerated 15mer primers, differing from the original PEP-PCR (24) in the following steps: (a) cell lysis in 10 µl of buffer containing 1x Expand High Fidelity buffer No. 2 (Boehringer Mannheim, Penzberg, Germany) including 4mg/ml Proteinase K plus 0.5% Tween 20 as detergent (Merck, Darmstadt, Germany); (b) use of 3.6 units of a mix of Taq polymerase and proofreading Pwo polymerase (Expand High Fidelity PCR System; Boehringer Mannheim) in whole genome amplification; and (c) an additional cyclical elongation step at 68°C for 30 s before the denaturation step at 94°C.

LOH analysis was performed as described previously (19) . Informative cases were scored as allelic losses when the intensity of a signal for a tumor allele was decreased to 50%, relative to the matched normal allele. MSI was defined as the occurrence of additional alleles in the tumor tissue compared with the normal DNA. All cases of allelic loss (LOH) and MSI were confirmed at least once. Primers were obtained from MWG Biotech GmbH. Primer sequences and annealing temperatures were as follows: p53Alu (17p13.1.): 5'AGGAGGTTGCAGTAAGCGGA-3' and 5'AACAGCTCCTTTAATGG-CAG-3' at 60°C (25) ; D9S304 (9p21): 5'GTGCACCTCTACACCCAGAC-3' and 5'TGTGC-CCACACACATCTATC-3' at 60°C; D9S1751 (Pky11, 9p21): 5'TTGTTGATTCTGCCTT-CAAAGTCTTTTAAC-3' and 5'CGTTAAGTCCTCTATTAC-ACAGAG-3' at 55°C (26) ; D9S2136 (Pky2, 9p21): 5'ATTCAACGAGTGGGATGAAG-3' and 5'TCCAGGTTGCTGCAA-ATGCC-3' at 56°C (26) ; D9S1748 (Pky3, 9p21): -3'CACCTCAGAAGTCAGTGAGT5' and 5'GTGCTTGAAATACACCTTTCC-3' at 55°C (26) ; D9S303 (9q21): 5'CAACAAAGCAA-GATCCCTTC-3' and 5'GGTACTTGGAAACTCTTGGC-3' at 55°C; D9S747 (9q32): 5'GCCATTATTGACTCTGGAAAAGAC-3' and 5'CAGGCTCTCAAAATATGAACAAAAT-3' at 56°C; D9S283 (9q22.1): 5'TGCTGGATTTCAGGTAGGG-3' and 5'ATGGTTATGCG-GGTGTATTTCTC-3' at 61°C.

Sequencing of the p53 Gene.
The p53 tumor suppressor gene was directly sequenced using single exon amplification after preamplification with I-PEP-PCR and subsequent cycle sequencing using an ABI 373 sequencer as described previously (15) . The analyses were restricted to exons 5–9 because ~85% of all p53 mutations are located in this region of the gene (27) .5 In brief, 2 µl of the I-PEP-PCR product was used as template for subsequent single exon amplification of exon 5–9 of the p53 gene (final volume, 50 µl; final concentration: 200 nmol/liter dNTPs, 1.25 units of Expand High Fidelity polymerase, 0.4 µmol/liter first-round PCR primers, 1.5–2 mmol/liter MgCl2). PCR was performed with an initial incubation of 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 54–60°C for 2 min, and 72°C for 3 min, with a final elongation for 10 min at 72°C. DNA (50–150ng) purified by polyethylene glycol precipitation [equal volume of PCR product and PEG-Mix containing 26% PEG8000, 0.6 mol/liter sodium acetate (pH 5.3), and 6.6 mmol/liter MgCl2] was taken for cycle sequencing in both directions using nested sequencing primers in a PTC200 MJR thermocycler (MJ Research; initial incubation at 96°C for 2 min, followed by 25 cycles of 96°C for 15 s, 48–50°C for 15 s, 60°C for 4 min) using the PRISM Ready Dye Terminator Cycle sequencing kit (Applied Biosystems GmbH, Weiterstadt, Germany) and an ABI373 sequencer according to the manufacturer‘s instructions. All of the mutations were confirmed in a second analysis with I-PEP-PCR, specific PCR, and sequencing in both directions.

Primer sequences and annealing temperatures were as follows (where P = PCR primer; S = sequencing primer; s = sense; a = antisense; and E5 = Exon 5): PsE5: 5'-TCACTTGTGCCCTGACTTTC-3'; PaE5: 5'-GGAAACCAGCCCTGTCGTC-3' (58°C); SsE5: 5'-CCTGACTTTCAACTCTG-3'; SaE5: 5'-AGCCCTGTCGTCTCTC-3' (48°C); PsE6: 5'-TCCCCAGGCCTCTGATTC-3'; PaE6: 5'-TAGGGAGTTCAAATAAGCAG-3' (54°C); SsE6: 5'-CCTCTGATTCCTCACTG-3'; SaE6: 5'-CACTGACAACCACCCTT-3' (50°C); PsE7: 5'-GCCTCCCCTGCTTGCCAC-3'; PaE7: 5'-GTCAGAGGCAAGCAGAGGC-3' (60°C); SsE7: 5'-TGCTTGCCACAGGTCT-3'; SaE7: 5'-CAGCAGGCCAGTGTGC-3' (48°C); PsE8: 5'-TAGACCTGATTTCCTTACTGC-3'; PaE8: 5'-GCATAACTGCACCCTTGGTC-3' (58°C); SsE8: 5'-TCCTTACTGCCCTTGC-3'; SaE8: 5'-CCCTTGGTCTCCTCCA-3' (50°C); PsE9: 5'-GGGTGCAGTTATGCCTCAG-3'; PaE9: 5'-AGACTGGAAACTTTCCACTTG-3' (58°C); SsE9: 5'-TTATGCCTCAGATTCACT-3'; SaE9: 5'-CTTTCCACTTGATAAGAG-3' (48°C).

Statistical Analyses.
In accordance with the advice of biostatisticians, we omitted statistical analyses of the molecular data because multiple lesions from each patient were not independent samples. Descriptive quantification was considered adequate for the cases investigated.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
DII and CIS are mostly small lesions that are found in a limited number of serial sections of a bladder biopsy. Thus, the results of the different methods applied could be obtained completely only for a subset of the lesions investigated (36 CIS and 16 DII; Table 2Citation and Fig. 1Citation ). Complete results were available for 21 CIS and 3 DII. For 11 CIS and 10 DII, only FISH data could be obtained, leaving no residual lesion for DNA extraction. In five CIS and three DII, initial microdissection for FISH failed to provide sufficient nuclei to obtain reliable hybridization results. In these cases, only LOH and p53 sequencing data were available.


View this table:
[in this window]
[in a new window]

  		Table 2 Results of the genetic analyses of flat intraurothelial lesions from 21 patientsa

 


View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Histology of flat intraurothelial lesions and typical results of FISH. a, DII with thickened urothelium, distinctly nuclear abnormalities marked especially on the right side of the lesion with enlarged and hyperchromatic nuclei and partial loss of stratification of the urothelium (case G1 without deletion in FISH analyses). b, CIS with highly atypical cells with marked enlargement and irregularity of the hyperchromatic nuclei and total loss of the stratification of the urothelium (lesion D2 with deletion on both chromosomes 9 and 17 and p53 mutation). c, CIS of the denuding subtype with few attached markedly atypic cells (case C1 with deletions on chromosomes 9 and 17 and two p53 mutations). This example illustrates the fact that genetic analyses of these lesions, after microdissection from serial sections, has to deal with very limited cell numbers. d, FISH analyses with the gene-specific probe on chromosome 9q22 (FACC) as green and the centromere-9 probe as red signals in the case G1 shown in a. There are two clear signals in each cell. There is moderate cell enlargement and relatively regular nuclei in this dysplasia in comparison with e. e, FISH analyses with the gene-specific probe on chromosomal arm 9p (9p21,p16) as green and the centromere 9 probe as red signal in the case D2 shown in b. There is a deletion with three centromere signals and 1–2 gene signals. The nuclei from this CIS case are enlarged. f, FISH analysis with the gene-specific probe on chromosomal arm 17p (17p13, p53) as green and the centromere 17 probe as red signal in the case C1 shown in c. A deletion with three centromere signals and two gene signals, and two centromere and one gene signal, in both depicted cells, respectively, can be seen. There are marked irregularities in the nuclear shape from this CIS case.

 
Deletions on chromosome 9 were detected in 30 (86%) of 35 CIS and in 12 (75%) of 16 DII. Whereas the majority of CIS [22 (63%) of 35] showed loss on both arms of chromosome 9, a lower number of losses was found in DII [2 (12%) of 16]. Deletions on one or more loci of chromosomal arm 9p were detected in 27 (77%) of 35 CIS and in 9 (56%) of 16 DII, and on the chromosomal arm 9q in 26 (74%) of 35 CIS and 5 (31%) of 16 DII (Fig. 2)Citation . Whereas deletions of 9q without involvement of 9p were found in only 4 (11%) of 35 CIS, and 3 (19%) of 16 DII, a higher frequency of isolated 9p deletions with intact 9q was found in DII [7 (44%) of 16] in comparison with CIS [4 (11%) of 35]. There was a progression of the size of the deletion on chromosome 9 in the development of the neoplastic lesions because 10 (62%) of 16 DII showed a deletion of one chromosome arm only, whereas a considerably lower portion of CIS [8 (23%) of 35] exhibited a partial deletion on chromosome 9. One case of CIS (T1) had to be excluded from the deletion analyses because no FISH results were available and microsatellite analyses showed reproducible MSI in the majority of investigated markers.



View larger version (101K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Silver-stained gels of microsatellite analyses of patient D (see Tables 1Citation and 2Citation ). All eight of the investigated microsatellites for the normal DNA derived from the germ line (N) and for simultaneously occurring CIS (D1–4) are depicted. All of the tumors show retention of heterozygosity for D9S2136 (9p21). The p53Alu marker is not informative in this patient. All of the CIS show deletion of the identical allele in the three informative markers on chromosome arm 9p21 (D9S1748, D9S1752, D9S304). In contrast, there is heterogeneity of deletions on chromosome arm 9q. Case D1, retention of heterozygosity for all markers. Cases D2–4, deletion of different alleles both in D9S303 and D9S747, providing evidence for oligoclonality of the multifocal CIS in this patient.

 
Deletions of the chromosomal region 17p13.1 at the p53 gene locus were found in LOH and/or FISH analyses in 27 (84%) of 32 evaluable CIS. In contrast, p53 deletions were found less often in DII [8 (53%) of 15], again demonstrating a genetic progression from DII to CIS. Progression is also indicated by 76 (60%) of the 134 informative markers on chromosome 9 revealing LOH in CIS in contrast to 12 (36%) of 33 informative markers in DII. There was a very good overall correlation between LOH analyses and FISH in the detection of deletions at chromosomes 9p [21 (91%) of 23], 9q [18 (86%) of 21] and 17p13.1 [14 (74%) of 19]. FISH using only two centromeric probes revealed a very high frequency of nondiploidy in both DII [11 (85%) of 13] and CIS [27 (84%) of 32].

p53 mutations were detected in 12 of the 15 investigated patients (Table 3Citation and Fig. 3Citation ). In two patients (patients L and O), no p53 mutations could be detected. In addition, a silent mutation without any evidence of functional changes in the p53 protein was found in patient U. p53 mutations were found in 18 (72%) of 25 CIS and in 4 (67%) of 6 investigated DII. The mutational pattern of the 18 detected independent mutations revealed a high frequency of transversions [9 (50%) of 18] with a predominance of A:T->T:A transversions [5 (18%) of 28]. Ten of the 18 mutations were located at G:C nucleotides. Furthermore, a high frequency of double mutations were found (8 of 31 investigated lesions). No correlation between p53 mutation and the growth category (mere flat lesions versus flat with accompanying papillary lesions) nor between p53 mutation and invasiveness was observed.


View this table:
[in this window]
[in a new window]

  		Table 3 Mutations in the p53 gene in flat intraurothelial lesions

 


View larger version (74K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. p53 mutations in flat intraurothelial lesions in three patients.

 
The type of p53 deletion was not related to smoking, inasmuch as there were occurrence of transversions and double mutations in both smokers and nonsmokers.

In 16 patients, multifocal CIS and/or DII were investigated (Table 2)Citation . Genetic alterations were heterogeneous, with at least one of the investigated methods in 13 of 16 patients. Many of these heterogeneous genetic alterations could be explained by genetic diversification of one tumor cell clone. For instance, in patient Q, the dysplastic lesion with deletion on chromosome 9 accumulated an additional p53 deletion in the progress to CIS. However, in patient I, the pattern of deletion in FISH analyses provided evidence for the existence of different clones in multifocal DII [clone A with deletion on 9p (sample I2), clone B with deletion on 9q and deletion of p53 (samples I1 and I3)]. One of these clones accumulated additional genetic changes with deletion of both arms of chromosome 9 and of p53 and progressed to CIS. LOH analyses using microsatellite markers allow clonal assessment by comparing the pattern of deletions and the deleted allele between multifocal lesions. For nine patients with multifocal lesions, microsatellite analyses and p53 mutation data were available. Whereas four patients (patients J, P, T, and U) showed identical microsatellite alterations favoring monoclonality, three patients (C, D, and E) showed deletions of different alleles on markers on chromosome 9q (Table 2Citation ; Fig. 2Citation ), which suggests the existence of different tumor clones. Two patients with multifocal lesions revealed no LOH in microsatellite analyses. The p53 mutation pattern was identical in six cases with multifocal CIS or DII. However, in two patients (patients C and H), different mutations were detected. Interestingly, in all of the three patients with deletions of different alleles in the LOH analyses, an identical p53 mutation was found in the same lesions, which indicated an early occurrence of p53 mutations in these patients. In four of nine evaluable patients (C, D, E, and H), microsatellite or p53 mutation analyses hint at the existence of different tumor clones.

Nine normal urothelial samples were investigated using FISH. Although five of these normal urothelial areas were in close proximity to a simultaneously resected CIS or DII, no deletions on the investigated loci on chromosomal arms 9p, 9q, or 17p could be detected in these samples.


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The positive initiative of a renewed WHO classification of urothelial neoplasms (5) requires genetic validation of the entities besides the prospective clinical validation. It is considered very helpful for insight into bladder cancer carcinogenesis that unequivocal names and definitions of flat urothelial lesions are included and that this practice is extended to lesions that are considered benign as flat and papillary urothelial hyperplasia. Microdissection and consequent genetic analysis of preneoplastic and early neoplastic lesions has spread quickly in diagnostic and experimental pathology and has been used, for instance, to give new insight into carcinogenesis in breast, colon, lung, prostate, and pancreas (28, 29, 30, 31, 32) . Microdissection-based LOH studies have been able to detect frequent chromosome 9 deletions in both simple urothelial hyperplasia (17) and papillary hyperplasia (18) . The deletions found were less than, or identical to, those of synchronous or metachronous papillary tumors of the same patients, suggesting hyperplasia of the urothelium as a potential precursor lesion of papillary tumors. Although this finding has clinical implications in terms of radicality of resection of papillary tumors, the clinical implications of the proper diagnosis of the aggressive preneoplastic entity are even more far-reaching, because cystectomy has to considered early in patient care.

The more prevalent scheme of molecular carcinogenesis depicts separate pathways for CIS and papillary tumors, with a dichotomy on the level of normal urothelium (reviewed in Ref. 13 ). The separating genetic event for the papillary tumor is the chromosome 9 deletion and for CIS, the p53 deletion (10) . In contrast to this, a microdissection-supported analysis by Rosin et al., published in 1995, indicated that CIS (n = 31) showed chromosome 9 deletions with a frequency comparable to that of p53 deletions (33) . The latter data, established with a total of 29 microsatellite markers for 13 chromosome arms, could be confirmed in our studies. Exact microdissection of the small lesions (see Fig. 1, b and cCitation ) was essential to get pure populations of tumor cells, and whole genomic amplification has enabled us to use a maximum of three genetic investigations per lesion. The frequencies of chromosome 9 deletions were 86% in comparison with 84% p53 deletions, as found with FISH and/or LOH, or 72% when p53 was sequenced. Interestingly, the majority of CIS showed LOH in both 9q and 9p, which indicated an advanced state of chromosome 9 alterations. We know from papillary tumors that the progression of the extent of chromosome 9 deletions indicates clonal divergence (19) . In addition, it was also indicated recently that the deletion of specific regions on chromosome 9, including the ones investigated in this study, are related to recurrence when investigated in papillary tumors (34) . From these data, we can comment on our first hypothesis (see "Introduction"). CIS may be a separate entity from papillary tumors, but, genetically, it is not different from papillary tumors by a lack of chromosome 9 deletions.

Our genetic investigation of DII (as defined according to the earlier WHO classification; Ref. 20 ) showed data similar to that of CIS with some interesting differences. DII showed an identical relationship between chromosome 9 and p53 deletions; however, both showed lower frequencies than those found in CIS (75% for chromosome 9, and 53% for chromosome 17, p53 locus). Although this may be indicative of a precursor lesion already, additional findings support this hypothesis. The number of affected LOH loci on chromosome 9 per lesion is less in DII [12 (33%) of 33 informative markers] than in CIS [76 (57%) 134 informative markers]. As indicated above, more often only one chromosomal arm, either 9q or 9p, is affected. Here a predominance of 9p deletions (44%) over 9q deletions (19%) was seen, a finding that confirms previous data on papillary tumors and hyperplasias in our own group (17 , 19) but is contradicted by others (35 , 36) . Bender and Jones described 50% 9p and 60% 9q deletions in papillary tumors (35) , and Simoneau et al. found percentages of 23 for 9p and 44 for 9q (36) ; consequently, 9q alterations are considered the earliest event in bladder carcinogenesis (35 , 36) .

Morphologically DII are seen adjacent to CIS, probably because of the migration of neoplastic cells into the adjacent normal urothelium. Data established in this study were intentionally derived from lesions that were not topographically related, i.e., from different areas of the bladder mucosa. The lack of topographical relation is further supported by the finding in 5-ALA-induced endoscopical fluorescence diagnosis, in which DII and CIS are mostly found as distinctly round fluorescent patches (37) .

An additional quality control for the microdissected lesions was obtained by using the number of centromeric probes from FISH studies to estimate ploidy. It is known from image analysis measurements of Feulgen-stained samples that dysplasia and CIS show high frequency of nondiploidy (11) , which could be confirmed by FISH data in this study with numbers of 84% for CIS and 85% for dysplasia.

Thus the second hypothesis of our paper (see "Introduction") is substantiated by our findings. DII genetically occurs as a precursor of CIS. An alternative scheme, limited to noninvasive stages of bladder cancer and also limited to the two chromosomes investigated in this study, is presented in Fig. 4Citation to summarize our data on preneoplastic lesions. Dysplasia without mutation or deletion was found in four biopsies (see Table 2Citation ). Whether this indicates that only part of the DII can be classified as cis- [as emphasized in the new WHO classification (5) ] or is attributable to sampling errors of the microdissected tissue cannot be discriminated unequivocally from our data. However, the data most likely support the WHO classification, because the cases without genetic alterations could be diagnosed as nondiploid in three of four cases.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Scheme of molecular carcinogenesis of preinvasive bladder tumors and lesions.

 
Looking at deletions and also mutations in multifocal lesions allows cautious consideration about clonality of lesions, especially when multiple gene loci are detected with FISH or LOH (16 , 19 , 28 , 30 , 38) . Although clonality assessment independent of tumor progression is performed with methods as chromosomal inactivation studies (39) , these methods present a problem for human bladder cancer because analysis is limited to females. When multifocal lesions are compared, the problem of patch-size interference in the interpretation of clonality is avoided (40) . Sixteen patients with two to five multifocal lesions were investigated in our study. Whereas some of the frequent genetic heterogeneity found with the methods used can be interpreted as genetic diversification of one tumor cell clone (e.g., patient Q without p53 deletion in the dysplasia and with progression to CIS with occurrence of a p53 deletion), other data indicated oligoclonality of precancerous lesions (patient I with one clone with only 9p alterations and a second clone with 9q and p53 deletions). Similar results were reported for multifocal superficial papillary tumors in the urinary bladder (19) . Although clonality certainly seems to be prevalent in bladder cancer, evidence of additional oligoclonality increases, most likely because earlier stages of tumor development are being investigated. Oligoclonal tumors may precede the clonal expansion of one of the tumors with a growth advantage, which explains the detection of only one tumor clone in studies investigating advanced tumor stages (41) . As an alternative to this mode of tumor progression, we can show with the example of patient C that a number of CIS with identical p53 mutation show heterogeneity in deleted alleles in chromosome 9, which strongly suggests the p53 mutation as the earliest event in these lesions.

Further evidence for a relatively frequent existence of several tumor clones in patients with flat intraurothelial lesions was the detection of different p53 mutations in one patient. With deletions being unique for each patient, multiple identical mutations are considered a good indicator for clonality, and have been found to correlate well with the X-chromosomal inactivation as detected by the human androgen receptor assay (HUMARA) (41) .

The pattern of p53 mutations was similar to the mutations detected in several large series of invasive urothelial carcinomas (42) . There was an overrepresentation of transversions, frequent occurrence of mutations at G:C nucleotides, and frequent double mutations, all of which are alterations linked to smoking in bladder cancer patients (43) . In this study, the occurrence and type of mutation could not be related to smoking habits, because it occurred in both nonsmokers and smokers.

The investigations presented here showed no difference between patients with a history of mere flat lesions (n = 7) and patients with flat and papillary lesions (n = 14) in terms of the genetic alterations found in chromosomes 9 and 17. This may be attributable to the limited number of cases investigated. However, it may also indicate that there are no specific alterations for the one or the other tumor but, rather, differences in sequences of events, leading either to a prolonged proliferation of urothelium (papillary tumor) or to an earlier anaplasia with consequent invasion (DII and CIS).

From our own experience with more then 1000 patients using endoscopic fluorescence diagnosis with 5-ALA and about 500 additional published cases, we are confident, that the initial observation of an increased detection rate of flat lesions with this technique is substantiated (4) . Therefore, we have an ideal incentive for a multicenter study, validating the findings indicated in this first unicentric study for the therapeutic decisions in flat neoplasia of urothelium. The extension of investigation to other chromosome loci as well as the prospective relationship of the genetic findings in flat lesions in a larger patient cohort are our next target within this approach.


   ACKNOWLEDGMENTS
 
We thank Helmut Kutz and Heidi Schreckhase for expert technical assistance and administration of clinical and research data banks; Andrea Schneider and Monika Kerscher for technical assistance with LOH analysis and sequencing; and Kirstin Mürle for help with illustrations of FISH studies


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Deutsche Krebshilfe, Grant 10-1096-Ha I, and the German Research Society (DFG), Grant Knü 263/7-1. Back

2 To whom requests for reprints should be addressed, at Institute of Pathology, University of Regensburg, Franz Josef Strauss Allee 11, D-93042 Regensburg, Germany. Phone: 941-944-6625; Fax: 941-944-6602; E-mail: ruth.knuechel-clarke{at}klinik.uni-regensburg.de Back

3 The abbreviations used are: CIS, carcinoma(s) in situ; BCG, Bacillus Calmette-Guérin; 5-ALA, 5-aminolevulinic acid; DII, moderate dysplasia(s); LOH, loss of heterozygosity; FISH, fluorescence in situ hybridization; I-PEP-PCR, improved method of primer-extension-preamplification PCR; MSI, microsatellite instability; FACC, Fanconi anemia complementation group C. Back

4 Unpublished observations. Back

5 Internet address: http:www.iarc.fr. Back

Received 7/ 9/01. Accepted 12/ 3/01.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lamm D. L., Blumenstein B. A., Crawford E. D., Montie J. E., Scardino P., Grossman H. B., Stanisic T. H., Smith J. A. J., Sullivan J., Sarosdy M. F. A randomized trial of intravesical doxorubicin and immunotherapy with Bacille Calmette-Guerin for transitional-cell carcinoma of the bladder. N. Engl. J. Med., 325: 1205-1209, 1991.[Abstract]
  2. Kriegmair M., Baumgartner R., Knuchel R., Stepp H., Hofstadter F., Hofstetter A. Detection of early bladder cancer by 5-aminolevulinic acid induced porphyrin fluorescence. J. Urol., 155: 105-109, 1996.[Medline]
  3. Jichlinski P., Forrer M., Mizeret J., Glanzmann T., Braichotte D., Wagnieres G., Zimmer G., Guillou L., Schmidlin F., Graber P., van den Bergh H., Leisinger H. J. Clinical evaluation of a method for detecting superficial surgical transitional cell carcinoma of the bladder by light-induced fluorescence of protoporphyrin IX following the topical application of 5-aminolevulinic acid: preliminary results. Lasers Surg. Med., 20: 402-408, 1997.[Medline]
  4. Zaak D., Kriegmair M., Stepp H., Baumgartner R., Oberneder R., Schneede P., Corvin S., Frimberger D., Knuechel R., Hofstetter A. Endoscopic detection of transitional cell carcinoma with 5-aminolevulinic acid—results of 1012 fluorescence endoscopies. Urology, 57: 690-694, 2001.[Medline]
  5. Mostofi F. K., Davis C. J. J., Sesterhenn I. A. Histological typing of urinary bladder tumours. World Health Organization-International Histological Classification, Springer Berlin 1999.
  6. Grignon D. J. Neoplasm of the urinary bladder Bostwick D. G. Eble J. N. eds. . Mosby Year Book. Urologic Surgical Pathology, : 215-306, Mosby Year Book St. Louis 1997.
  7. Cheng L., Cheville J. C., Neumann R. M., Bostwick D. G. Flat intraepithelial lesions of the urinary bladder. Cancer (Phila.), 88: 625-631, 2000.[Medline]
  8. Cheng L., Cheville J. C., Neumann R. M., Bostwick D. G. Natural history of urothelial dysplasia of the bladder. Am. J. Surg. Pathol., 23: 443-447, 1999.[Medline]
  9. Orozco R. E., Martin A. A., Murphy W. M. Carcinoma in situ of the urinary bladder. Clues to host involvement in human carcinogenesis. Cancer (Phila.), 74: 115-122, 1994.[Medline]
  10. Spruck C. H., Ohneseit P. F., Gonzalez-Zulueta M., Esrig D., Miyao N., Tsai Y. C., Lerner S. P., Schmutte C., Yang A. S., Cote R. Two molecular pathways to transitional cell carcinoma of the bladder. Cancer Res., 54: 784-788, 1994.[Abstract/Free Full Text]
  11. Hofstadter F., Delgado R., Jakse G., Judmaier W. Urothelial dysplasia and carcinoma in situ of the bladder. Cancer (Phila.), 57: 356-361, 1986.[Medline]
  12. Tyrkus M., Powell I., Fakr W. Cytogenetic studies of carcinoma in situ of the bladder: prognostic implications. J. Urol., 148: 44-46, 1992.[Medline]
  13. Czerniak B., Li L., Chaturvedi V., Ro J. Y., Johnston D. A., Hodges S., Benedict W. F. Genetic modeling of human urinary bladder carcinogenesis. Genes Chromosomes Cancer, 27: 392-402, 2000.[Medline]
  14. Wagner U., Sauter G., Moch H., Novotna H., Epper R., Mihatsch M. J., Waldman F. M. Patterns of p53, erbB-2, and EGF-r expression in premalignant lesions of the urinary bladder. Hum. Pathol., 26: 970-978, 1995.[Medline]
  15. Dietmaier W., Hartmann A., Wallinger S., Heinmoller E., Kerner T., Endl E., Jauch K. W., Hofstadter F., Ruschoff J. Multiple mutation analyses in single tumor cells with improved whole genome amplification. Am. J. Pathol., 154: 83-95, 1999.[Abstract/Free Full Text]
  16. Stoehr R., Hartmann A., Hiendlmeyer E., Muerle K., Wieland W., Knuechel R. Oligoclonality of early lesions of the urothelium as determined by microdissection-supported genetic analysis. Pathobiology, 68: 165-172, 2000.[Medline]
  17. Hartmann A., Moser K., Kriegmair M., Hofstetter A., Hofstaedter F., Knuechel R. Frequent genetic alterations in simple urothelial hyperplasias of the bladder in patients with papillary urothelial carcinoma. Am. J. Pathol., 154: 721-727, 1999.[Abstract/Free Full Text]
  18. Chow N. H., Cairns P., Eisenberger C. F., Schoenberg M. P., Taylor D. C., Epstein J. I., Sidransky D. Papillary urothelial hyperplasia is a clonal precursor to papillary transitional cell bladder cancer. Int. J. Cancer, 89: 514-518, 2000.[Medline]
  19. Hartmann A., Rosner U., Schlake G., Dietmaier W., Zaak D., Hofstaedter F., Knuechel R. Clonality and genetic divergence in multifocal low-grade superficial urothelial carcinoma as determined by chromosome 9 and p53 deletion analysis. Lab. Investig., 80: 709-718, 2000.[Medline]
  20. Mostofi F. K., Sobin L. H., Torloni H. . Histological typing of urinary bladder tumours, World Health Organization Geneva 1973.
  21. Schutze K., Lahr G. Identification of expressed genes by laser-mediated manipulation of single cells[see comments]. Nat. Biotechnol., 16: 737-742, 1998.[Medline]
  22. Wild P., Knuechel R., Hofstaedter F., Hartmann A. Laser microdissection of breast cancer reveals a high degree of tumor heterogeneity in microsatellite analysis. Pathobiology, 68: 180-190, 2000.[Medline]
  23. Petzoldt J. L., Leigh I. M., Duffy P. G., Sexton C., Masters J. R. Immortalisation of human urothelial cells. Urol. Res., 23: 377-380, 1995.[Medline]
  24. Zhang L., Cui X., Schmitt K., Hubert R., Navidi W., Arnheim N. Whole genome amplification from a single cell: implications for genetic analysis. Proc. Natl. Acad. Sci. USA, 89: 5847-5851, 1992.[Abstract/Free Full Text]
  25. Futreal P. A., Barrett J. C., Wiseman R. W. An Alu polymorphism intragenic to the TP53 gene. Nucleic Acids Res., 19: 69-77, 1991.[Abstract/Free Full Text]
  26. Cairns P., Polascik T. J., Eby Y., Tokino K., Califano J., Merlo A., Mao L., Herath J., Jenkins R., Westra W. Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nat. Genet., 11: 210-212, 1995.[Medline]
  27. Hartmann A., Blaszyk H., McGovern R. M., Schroeder J. J., Cunningham J., De Vries E. M., Kovach J. S., Sommer S. S. p53 gene mutations inside and outside of exons 5–8: the patterns differ in breast and other cancers. Oncogene, 10: 681-688, 1995.[Medline]
  28. Siu I. M., Robinson D. R., Schwartz S., Kung H. J., Pretlow T. G., Petersen R. B., Pretlow T. P. The identification of monoclonality in human aberrant crypt foci. Cancer Res., 59: 63-66, 1999.[Abstract/Free Full Text]
  29. Heinmoller E., Dietmaier W., Zirngibl H., Heinmoller P., Scaringe W., Jauch K. W., Hofstadter F., Ruschoff J. Molecular analysis of microdissected tumors and preneoplastic intraductal lesions in pancreatic carcinoma. Am. J. Pathol., 157: 83-92, 2000.[Abstract/Free Full Text]
  30. Wistuba I. I., Behrens C., Milchgrub S., Bryant D., Hung J., Minna J. D., Gazdar A. F. Sequential molecular abnormalities are involved in the multistage development of squamous cell lung carcinoma. Oncogene, 18: 643-650, 1999.[Medline]
  31. Moinfar F., Man Y. G., Arnould L., Bratthauer G. L., Ratschek M., Tavassoli F. A. Concurrent and independent genetic alterations in the stromal and epithelial cells of mammary carcinoma: implications for tumorigenesis. Cancer Res., 60: 2562-2566, 2000.[Abstract/Free Full Text]
  32. Cheng L., Song S. Y., Pretlow T. G., Abdul-Karim F. W., Kung H. J., Dawson D. V., Park W. S., Moon Y. W., Tsai M. L., Linehan W. M., Emmert-Buck M. R., Liotta L. A., Zhuang Z. Evidence of independent origin of multiple tumors from patients with prostate cancer. J. Natl. Cancer Inst. (Bethesda), 90: 233-237, 1998.[Abstract/Free Full Text]
  33. Rosin M. P., Cairns P., Epstein J. I., Schoenberg M. P., Sidransky D. Partial allelotype of carcinoma in situ of the human bladder. Cancer Res., 55: 5213-5216, 1995.[Abstract/Free Full Text]
  34. Simoneau M., LaRue H., Aboulkassim T. O., Meyer F., Moore L., Fradet Y. Chromosome 9 deletions and recurrence of superficial bladder cancer: identification of four regions of prognostic interest. Oncogene, 19: 6317-6323, 2000.[Medline]
  35. Bender C. M., Jones P. A. Molecular genetics in carcinoma of the bladder Baert L. Brady L. W. Petrovich Z. eds. . Carcinoma of the Bladder: Innovations in Management, : 37-51, Springer Heidelberg 1999.
  36. Simoneau M., Aboulkassim T. O., LaRue H., Rousseau F., Fradet Y. Four tumor suppressor loci on chromosome 9q in bladder cancer: evidence for two novel candidate regions at 9q22.3 and 9q31. Oncogene, 18: 157-163, 1999.[Medline]
  37. Kriegmair M., Baumgartner R., Knuechel R., Steinbach P., Ehsan A., Lumper W., Hofstadter F., Hofstetter A. Fluorescence photodetection of neoplastic urothelial lesions following intravesical instillation of 5-aminolevulinic acid. Urology, 44: 836-841, 1994.[Medline]
  38. Simon R., Eltze E., Schafer K. L., Burger H., Semjonow A., Hertle L., Dockhorn-Dworniczak B., Terpe H. J., Bocker W. Cytogenetic analysis of multifocal bladder cancer supports a monoclonal origin and intraepithelial spread of tumor cells. Cancer Res., 61: 355-362, 2001.[Abstract/Free Full Text]
  39. Allen R. C., Zoghbi H. Y., Moseley A. B., Rosenblatt H. M., Belmont J. W. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am. J. Hum. Genet., 51: 1229-1239, 1992.[Medline]
  40. Garcia S. B., Park H. S., Novelli M., Wright N. A. Field cancerization, clonality, and epithelial stem cells: the spread of mutated clones in epithelial sheets. J. Pathol., 187: 61-81, 1999.[Medline]
  41. Sidransky D., Frost P., Von Eschenbach A., Oyasu R., Preisinger A. C., Vogelstein B. Clonal origin bladder cancer. N. Engl. J. Med., 326: 737-740, 1992.[Abstract]
  42. Spruck C. H., Rideout W. M., Olumi A. F., Ohneseit P. F., Yang A. S., Tsai Y. C., Nichols P. W., Horn T., Hermann G. G., Steven K. Distinct pattern of p53 mutations in bladder cancer: relationship to tobacco usage. Cancer Res., 53: 1162-1166, 1993.[Abstract/Free Full Text]
  43. Habuchi T., Takahashi R., Yamada H., Ogawa O., Kakehi Y., Ogura K., Hamazaki S., Toguchida J., Ishizaki K., Fujita J. Influence of cigarette smoke and schistosomiasis on p53 gene mutation in urothelial cancer. Cancer Res., 53: 3795-3799, 1993.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
L. Knoops, R. Haas, S. de Kemp, D. Majoor, A. Broeks, E. Eldering, J. P. de Boer, M. Verheij, C. van Ostrom, A. de Vries, et al.
In vivo p53 response and immune reaction underlie highly effective low-dose radiotherapy in follicular lymphoma
Blood, August 15, 2007; 110(4): 1116 - 1122.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
S. Hernandez, E. Lopez-Knowles, J. Lloreta, M. Kogevinas, A. Amoros, A. Tardon, A. Carrato, C. Serra, N. Malats, and F. X. Real
Prospective Study of FGFR3 Mutations As a Prognostic Factor in Nonmuscle Invasive Urothelial Bladder Carcinomas
J. Clin. Oncol., August 1, 2006; 24(22): 3664 - 3671.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
T. D. Jones, M. Wang, J. N. Eble, G. T. MacLennan, A. Lopez-Beltran, S. Zhang, A. Cocco, and L. Cheng
Molecular Evidence Supporting Field Effect in Urothelial Carcinogenesis
Clin. Cancer Res., September 15, 2005; 11(18): 6512 - 6519.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
S. Hernandez, E. Lopez-Knowles, J. Lloreta, M. Kogevinas, R. Jaramillo, A. Amoros, A. Tardon, R. Garcia-Closas, C. Serra, A. Carrato, et al.
FGFR3 and Tp53 Mutations in T1G3 Transitional Bladder Carcinomas: Independent Distribution and Lack of Association with Prognosis
Clin. Cancer Res., August 1, 2005; 11(15): 5444 - 5450.
[Abstract] [Full Text] [PDF]

Home page
 INT J SURG PATHOLHome page
R. Montironi and A. Lopez-Beltran
The 2004 WHO Classification of Bladder Tumors: A Summary and Commentary
International Journal of Surgical Pathology, April 1, 2005; 13(2): 143 - 153.
[Abstract] [PDF]

Home page
 Cancer Res.Home page
B. W. G. van Rhijn, T. H. van der Kwast, A. N. Vis, W. J. Kirkels, E. R. Boeve, A. C. Jobsis, and E. C. Zwarthoff
FGFR3 and P53 Characterize Alternative Genetic Pathways in the Pathogenesis of Urothelial Cell Carcinoma
Cancer Res., March 15, 2004; 64(6): 1911 - 1914.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
P. J. Wild, A. Reichle, R. Andreesen, G. Rockelein, W. Dietmaier, J. Ruschoff, H. Blaszyk, F. Hofstadter, and A. Hartmann
Microsatellite Instability Predicts Poor Short-Term Survival in Patients with Advanced Breast Cancer after High-Dose Chemotherapy and Autologous Stem-Cell Transplantation
Clin. Cancer Res., January 15, 2004; 10(2): 556 - 564.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. O. Hoque, C.-C. R. Lee, P. Cairns, M. Schoenberg, and D. Sidransky
Genome-Wide Genetic Characterization of Bladder Cancer: A Comparison of High-Density Single-Nucleotide Polymorphism Arrays and PCR-based Microsatellite Analysis
Cancer Res., May 1, 2003; 63(9): 2216 - 2222.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Pathol.Home page
R Montironi, A Lopez-Beltran, R Mazzucchelli, and D G Bostwick
Classification and grading of the non-invasive urothelial neoplasms: recent advances and controversies
J. Clin. Pathol., February 1, 2003; 56(2): 91 - 95.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. Cheng, H. Huang, J. Pak, E. Shapiro, T.-T. Sun, C. Cordon-Cardo, F. M. Waldman, and X.-R. Wu
Allelic Loss of p53 Gene Is Associated with Genesis and Maintenance, but not Invasion, of Mouse Carcinoma in Situ of the Bladder
Cancer Res., January 1, 2003; 63(1): 179 - 185.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hartmann, A.
Right arrow Articles by Knuechel, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hartmann, A.
Right arrow Articles by Knuechel, R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online