| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Departments of Pharmacology and Toxicology [J. A. V., C. K. B., E. S. C., Y. M., R. W. C.] and Pathology [J. P. P., T. K. M.], Dartmouth Medical School, Hanover, New Hampshire 03755-3835
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In contrast to the deregulation seen in leukemia and lymphoma, BCL2 family members normally exhibit highly regulated patterns of expression during the differentiation of hematopoietic and lymphoid cells. Differentiation stage specificity of expression was the basis for the discovery of MCL1, a prosurvival family member that increases in expression (approximately 710-fold) in ML-1 human myeloblastic leukemia cells differentiating in response to PMA3 (8) . MCL1 is rapidly up-regulated as these cells initiate monocytic differentiation and is down-regulated as they progress along this lineage. In contrast, BCL2 is expressed at a constant level until declining on terminal differentiation (9) . Similarly, MCL1 is abundantly expressed in normal immature myeloid cells and is down-regulated during maturation (10) . MCL1 and BCL2 are also differentially regulated in the B-lymphocyte lineage, MCL1 expression being abundant in germinal centers but not the surrounding mantle zone and BCL2 expression exhibiting the reciprocal pattern (11) . Analogously, BCL2 and BCLX are expressed in an alternating pattern in early lymphoid development (12 , 13) . Overall, MCL1 and other prosurvival BCL2 family members exhibit distinctive patterns of expression during normal hematolymphoid cell differentiation, and these patterns are altered in cancer.
In addition to its role in tumor development (14 , 15) , the BCL2 family influences the sensitivity of cancer cells to chemotherapeutic agents. Thus, cell lines transfected with prosurvival family members are resistant to a wide range of chemotherapeutic agents, as well as to the withdrawal of survival factors such as those present in serum. Accordingly, in leukemia and lymphoma, higher levels of BCL2 expression are frequently associated with reduced responsiveness to chemotherapeutic agents and poor prognosis (3 , 16) . Other family members also play a role, since lower levels of BAX and higher levels of MCL1 can contribute to a diminished response (4 , 17) . Finally, relapse in acute leukemia is associated with an increase in MCL1 expression (18) . In summary, the expression of prosurvival gene products such as BCL2 and MCL1 can influence the effectiveness of cancer therapy, both in terms of initial responsiveness and in terms of long-term, disease-free survival.
The identification of therapeutic approaches for treating tumors that express prosurvival BCL2 family members represents a challenge, because the above-described resistance applies to a host of agents. Findings that bear on this issue were unexpectedly obtained during studies of BL41-3, a subline that arose spontaneously on continuous passage of BL41 Burkitt lymphoma cells in culture. This subline expresses MCL1 at very high levels. In fact, MCL1 protein levels in BL41-3 cells were found to be 5-fold higher than those seen in ML-1 cells exposed to PMA. In many previous studies of MCL1, we had never observed expression elevated to this extent, even in cell lines stably transfected with constructs containing MCL1 under the control of a strong promoter (14 , 19) . In these transfected cell lines, moderate expression of the introduced MCL1 gene product was associated with a modest enhancement of cell survival. For this reason, it was not clear whether MCL1 had intrinsically low efficacy for promoting cell survival or, alternatively, whether this effect resulted from suboptimal MCL1 expression. The serendipitous isolation of the BL41-3 subline afforded us our first opportunity to gain insight into the effects associated with markedly elevated MCL1 expression. Our original interest was in assessing whether these MCL1 levels were associated with enhanced BL41-3 cell survival. Our findings demonstrate that, indeed, BL41-3 cells are more resistant than the BL41 cell line itself to growth factor deprivation and to exposure to the chemotherapeutic agents etoposide, camptothecin, and staurosporine. Surprisingly, the BL41-3 subline was more sensitive to prolonged ara-C exposure. These observations in MCL1-expressing BL41-3 cells suggest that, despite resistance to a variety of death stimuli, chemotherapeutic approaches can be devised to target tumor cells that exhibit amplification and overexpression of a prosurvival member of the BCL2 family.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Western Blotting
Cells were washed in PBS, lysed in Laemmli buffer [62.5 mM Tris (pH 6.8), 2% SDS, 10% glycerol, 0.1% bromphenol blue, 50 mM DTT], and whole cell extract was separated by 15% SDS-PAGE. After transfer to Immobilon P (Millipore), the membrane was blocked for 1 h in PBS-T and 3% nonfat dry milk (Carnation). The membrane was then incubated for 16 h at 4°C with primary antibody, either a mouse monoclonal anti-MCL1 antibody (BD PharMingen; San Diego, CA; 1:2000; Ref. 23
), an anti-BCL2 antibody (DAKO, Carpinteria, CA; 1:2000), an anti-BCLxL antibody (Santa Cruz Biotechnology, Santa Cruz, CA; 1:1000), or an anti-BAX antibody (Santa Cruz Biotechnology; 1:750) in PBS-T/3% milk. The blot was washed three times and incubated for 45 min with either a goat antimouse or a donkey antirabbit horseradish peroxidase-conjugated secondary antibody (Kirkegaard & Perry Laboratories, Gaithersburg, MD) in PBS-T/3% milk. The blot was washed three times and developed using enhanced chemiluminescence (Amersham, Piscataway, NJ). Quantitation of MCL1 and BCL2 protein expression in BL41-3 cells as compared with ML-1 and BL41 cells was carried out by densitometric scanning of nonsaturated autoradiographs containing serial dilutions of the cell extracts representing a range of cell equivalents.
Cytofluorometric Assay of MCL1 Expression
Logarithmically growing cells (1 x 106) were fixed and permeabilized (Fix and Perm; Caltag Laboratories; Burlingame, CA) following the manufacturers instructions. Briefly, cells were fixed for 15 min in Reagent A, washed in PBS, and subsequently incubated with the anti-MCL1 antibody and FITC-conjugated antimouse IgG (Sigma Chemical Co.) for 15 min each in Reagent B. Cells were washed and diluted in cold PBS, and 10,000 cells/condition were analyzed using a Becton Dickinson FACScan flow cytometer and CyCLOPS 2000 software.
Southern Blot Analysis and Quantitative PCR
Quantitative PCR.
The PCR approach described here to monitor MCL-1 abundance in genomic DNA samples was adapted from a quantitative PCR protocol described previously (24)
. Genomic DNA from BL41 and BL41-3 cells was used as a template for PCR with primers that represent the MCL1 gene and span an intron [primer 81F (sense), 5' CGCGGTAATCGGACTCAAG 3' and primer 810R (antisense) 5' ATGGATCATCACTCGAGACA 3']. Each template was used at serial 1:2 dilutions representing
0.062 to 0.5 ng genomic DNA. For normalization, these dilutions were also used in separate reactions with primers representing glyceraldehyde-3-phosphate dehydrogenase or tubulin. As a control, a human lymphoblastoid cell line (LCL721.221) found to be equivalent to normal human genomic DNA in MCL1 copy number was assayed in parallel with BL41 and BL41-3 cells. The reaction mixture consisted of 10 mM Tris-HCl/50 mM KCl/1.5 mM MgCl2 buffer containing dATP, dTTP, dGTP, and dCTP (100 µM each) and the primers (100 nM each). Samples were protected from evaporation with paraffin and mineral oil, and Taq polymerase (Perkin-Elmer; 0.1 unit in a final reaction volume of 20 µl) was combined with the remaining ingredients when the reaction temperature reached 70°C. After an initial 3 min denaturation at 96°C, PCR was carried out in two stages: 5 cycles of 96°C for 1.5 min, 57°C for 1 min, and 72°C for 1.5 min, followed by 23 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1.2 min, and then a final extension at 72°C for 8 min. The PCR product obtained (an
1.1-kb fragment representing MCL1 human genomic DNA) was subjected to acrylamide gel electrophoresis, stained with SYBR Green I (Molecular Probes), and quantitated using a Storm Fluoroimager (Molecular Dynamics). The amount of PCR product obtained (ng) was plotted against template concentration for the serial dilutions, and the slope of the resultant curve obtained with the MCL1 primers was normalized by division by the slope of the curve obtained with the glyceraldehyde-3-phosphate dehydrogenase or tubulin primers. Relative MCL1 gene abundance was estimated by dividing the normalized MCL1 abundance values thus obtained for BL41 and BL41-3 cells by the value for the LCL721.221 control cell line.
Southern Blot Analysis.
Genomic DNA was isolated from logarithmically growing cells by phenol-chloroform extraction and ethanol precipitation. DNA (25 µg) was digested with BamHI, fractionated on a 0.75% agarose gel, transferred to a noncharged nylon membrane (Millipore), and probed with a gel-purified PCR fragment generated by using the above-described 81F and 810R primers in PCR with human genomic DNA. The fragment was biotin labeled using a random priming kit (NEBlot; New England Biolabs, Beverly, MA). Prehybridization/hybridization was performed at 42°C for 1.5 h using a 50% formamide based hybridization solution (ULTRAhyb; Ambion, Austin, TX). Two washes were carried out at 42°C for 5 min each with 2 x SSC, 0.1% SDS, followed by two washes at 42°C for 15 min each with 0.1 x SSC, 0.1% SDS. The blot was sequentially incubated with streptavidin and biotinylated horseradish peroxidase and visualized by chemiluminescence on X-OMAT film (Kodak).
Chromosome Analysis and FISH
Chromosome preparations were made by standard procedures, and karyotype analysis was done using routine G-banding. The probe for the MCL1 locus, a 3-kb genomic fragment (BS3.0) described previously (25)
, was biotin-labeled by nick translation (Bionick; Life Technologies, Inc., Gaithersburg, MD). Chromosome preparations on slides were conditioned by incubation for 30 min in a 37°C bath in 2 x SSC, followed immediately by sequential dehydration in 70%, 80%, and 95% ethanol (2 min each at room temperature) and air drying. Slides were denatured in 70% formamide/2 x SSC (70°C x 5 min) followed by serial dehydration at room temperature. The probe was heat denatured (5 min at 70°C) and preannealed at 37°C for 2 h. The hybridization solution contained 0.2 µg probe, 10 µg Cot-1 DNA (Life Technologies, Inc.) and 30 µg herring sperm DNA (Life Technologies, Inc.) in 15 µl of Hybrisol VII (Oncor, Gaithersburg, MD) per slide. Hybridization and posthybridization conditions were as described previously (26)
. Chromosomes were counterstained with 4',6-diamidino-2-phenylindole and pseudo-G-banding patterns were visualized by inversion of the digitized image. The whole chromosome 1 paint probe (Coatasome 1) and the chromosome 17
satellite probe (D17Z1) were from Oncor. Hybridization and posthybridization conditions for these two probes were according to the manufacturers protocol. Simultaneous cohybridizations were performed at the more permissive stringency if different conditions were required for the probes being hybridized. FISH images were captured using a monochromatic CCD camera mounted on a Zeiss epifluorescence microscope with a LUDL filter wheel and a fixed multiband-pass beam splitter using MacProbe software (PSI, Houston, TX).
Cell Viability Assays
In experiments involving conditions of reduced serum, cells were washed twice with serum-free medium and transferred to medium containing 7.5% or 1% FBS. Viable cell number and the percentage of viable cells were determined by hemacytometer cell counts using trypan blue as described previously (14)
. Doubling time was calculated from semilog plots of viable cell number versus time, using the linear portion of the curve. For experiments involving exposure to cytotoxic agents, etoposide, staurosporine (Sigma Chemical Co. Chemicals, St. Louis, MO), camptothecin (Calbiochem, La Jolla, CA), and ZVAD-FMK (Bio-Rad, Hercules, CA) were dissolved in DMSO and stored at -80°C. Vehicle controls (final DMSO concentration of
0.05%) were consistently found to be equivalent to drug-free controls. Ara-C (Sigma Chemical Co.) was maintained as a dry powder at -20°C and reformulated in PBS before use. Apoptotic morphology was assessed in cytocentrifuge preparations stained with the Diff-Quik stain set (Dade Behring, Deerfield, IL) and viewed by light microscopy as described previously (27)
. Mitochondrial membrane potential was assessed using either DiOC6 (40 nM; Molecular Probes, Eugene, OR) as described (28)
or 5,5'6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide [JC1; DePsipher (Trevigen, Gaithersburg, MD) Mitochondrial Assay kit] according to the manufacturers instructions. Cells (2 x 105) were incubated with the mitochondrial dyes for 15 min at room temperature and assayed by cytofluorometry. CyCLOPS 2000 software was used to calculate the percentage of cells exhibiting decreased DiOC6 fluorescence relative to viable untreated control cells. In the case of JC1, the percentage of cells shifting from the aggregate red fluorescence to the monomeric green fluorescence reflects loss of mitochondrial membrane potential. The percentage of cells exhibiting loss of mitochondrial membrane potential in drug-treated cultures was calculated by subtraction of the background percentage of such cells in untreated control cultures.
Statistical Analysis
EC50 and EC33 values ± 90% confidence intervals were calculated by the log dose/probit response analysis using the Priprobit program.4
| RESULTS |
|---|
|
|
|---|
3-fold increase over those present in the BL41 cell line (as assessed by cytofluorometry or Western blotting, Fig. 1, B and C
5-fold; Fig. 1C
|
9.3-fold as compared with a single copy control cell line; Fig. 2A
2.8-fold). In other words, BL41-3 cells exhibited an
3-fold increase over BL41 cells in MCL1 gene abundance, which closely paralleled the
3-fold difference in MCL1 protein levels. Southern blotting demonstrated a similar increase in MCL1 in the genomic DNA of BL41-3 as compared with BL41 cells (Fig. 2A
|
FISH studies using an MCL1 probe generated signals at band q21 of the two normal copies of chromosome 1 in both cell lines (Fig. 2, B and C
, white arrows), as expected (25)
. BL41-3 but not BL41 cells also exhibited a marker chromosome with a very intense signal indicative of the presence of amplified copies of MCL1 (Fig. 2C
, red arrow). Whereas BL41 cells did not exhibit this very intense signal, low-level signals on uncharacterized marker chromosomes (Fig. 1B)
could represent the modest increase in MCL1 seen in the genomic DNA of this cell line. The marker chromosome present in BL41-3 cells was confirmed to contain material from chromosome 17 as well as chromosome 1, because FISH using a chromosome 17-specific
satellite probe produced signal on this marker (labeled 17p+ in Fig. 2D
) as well as on the centromere of the normal chromosome 17. One possible model to account for these observations is that a modest increase in MCL1 copy number is present in BL41 cells and that extensive additional amplification, along with the generation of an HSR, occurred during the outgrowth of the BL41-3 subline.
The BL41-3 Subline Exhibits Reduced Dependence on Survival Factors from Serum-containing Medium.
As a first step in comparing the properties of BL41 and BL41-3 cells, we characterized their growth kinetics. Cells were subcultured in fresh serum-containing medium, and cell number and viability were monitored for 5 days. The two cell lines initially proliferated exponentially with comparable doubling times [2223 h (±2 h SE); mean of the doubling times calculated in six independent experiments]. They also exhibited similar cell cycle distribution profiles (Fig. 3A
, legend). However, the two cell lines differed dramatically on approaching saturation phase (Fig. 3A)
. BL41 cells reached a maximum density of
1.5 x 106 cells/ml (day 3) after which their cell viability decreased markedly. In contrast, BL41-3 cells reached a maximum density of >3 x 106 cells/ml (day 4) and demonstrated only a small decline in viability (to 87% on day 5 as compared with values of 62% and 28% on days 4 and 5 for BL41). Thus, one unique property of the BL41-3 subline appeared to be a capacity for remaining viable at saturation density.
|
The BL41-3 Subline Exhibits Resistance to Etoposide and Other Apoptosis-inducing Drugs but Remains Sensitive to Prolonged Exposure to Ara-C.
Cell lines overexpressing prosurvival BCL2 family members, including MCL1, generally exhibit resistance to chemotherapeutic agents as well as to growth factor withdrawal (14)
. Etoposide induces apoptosis in a variety of neoplastic cells and is used in the treatment of Burkitt and other types of lymphoma (32
, 33)
. The protection afforded by MCL1 to the apoptosis-inducing effects of etoposide has been characterized extensively (14)
. Therefore, we examined the effects of etoposide on BL41 and BL41-3 cells, initially monitoring the appearance of cells exhibiting classical apoptotic morphology, because this was the basis for the original definition of apoptosis (34)
. We found that cell death in response to this agent was markedly reduced in BL41-3 as compared with BL41 cells. This could be seen in concentration/response experiments using a 6-h exposure time, where the response curve for BL41-3 was shifted to the right compared with that for BL41 cells (Fig. 4A)
. Probit analysis revealed that an
9-fold higher concentration of etoposide was required to induce death in BL41-3 cell cultures equivalent to that seen in BL41 cell cultures (Table 1)
. Similarly, in time course experiments, increasing drug exposure was found to result in increasing cell death in both cell lines, with the differential between the two being maintained such that cell death was delayed in BL41-3 as compared with BL41 cells (Fig. 4B)
. Thus, whereas BL41 cells exhibited
60% death after 6 h of exposure to 50 µM etoposide, it took 24 h of exposure before BL41-3 cells exhibited a similar amount of death. The appearance of apoptotic cells did not appear to be attributable to loss of the MCL1 protein, which was decreased only slightly at 6 h (Fig. 4C)
, although MCL1 expression was decreased at 24 h when a substantial number of cells had undergone apoptosis. As expected, pretreatment with the broad-based caspase inhibitor ZVAD-FMK prevented the etoposide-induced morphological changes (Fig. 4D)
. In agreement with the apoptotic morphology observed, cells in etoposide-treated cultures exhibited a loss of mitochondrial membrane potential as assessed using mitochondrial dyes (Fig. 4E)
. This loss was less pronounced in BL41-3 than BL41 cells and was attenuated in both cases by pretreatment with ZVAD-FMK. Taken together, the above results were internally consistent in that cell death was less marked in BL41-3 than BL41 cell cultures on exposure to etoposide as on serum deprivation. These results also agreed with previous studies in which protection from these conditions was observed in MCL1-transfected cells (14)
.
|
|
In a final set of experiments, we examined the effect of ara-C as another chemotherapeutic agent used in the treatment of lymphoma. In concentration/response experiments using the 6-h exposure, cell death was only moderate, reaching at maximum of
40% with BL41 cells and 20% with BL41-3 cells exposed to 100 µM ara-C (Fig. 5A)
. EC50 values could not be calculated, because the concentration response curves reached a plateau. However, comparison of lower extents of cell death (e.g., EC33; Table 1
) suggested that at least 3-fold more ara-C was required to induce cell death in BL41-3 cells equivalent to that seen in BL41 cells. Thus, the results observed with the 6-h exposure to ara-C were reminiscent of those obtained with the other agents above. We repeated the concentration/response studies using an exposure time of 24 h. To our surprise, the order of sensitivity of the two cell lines was reversed in that cell death was much more pronounced in BL41-3 than BL41 cell cultures with this longer ara-C exposure (Fig. 5B)
. For example, a 24-h exposure to 1 µM of ara-C resulted in minimal death of BL41 cells but extensive death (>50%) of BL41-3 cells. With this longer exposure, the EC50 for BL41-3 cells was decreased >10-fold compared with that for BL41 cells (Table 1)
. MCL1 protein expression was minimally affected at the early 6-h time point, although a substantial loss of MCL1 protein occurred at 24 h particularly in BL41-3 cell cultures where cell death was marked (Fig. 5C)
. The increased death of BL41-3 cells on prolonged exposure to ara-C was also seen in the increased number of these cells exhibiting loss of mitochondrial membrane potential (Fig. 5D)
. Because of the difference in cell death observed at 6 h versus 24 h we sought to determine the exposure time necessary to cause the reversal in ara-C sensitivity. In time course experiments using either 1 or 10 µM of ara-C, we found that at least 18 h of drug exposure were necessary to produce increased apoptotic cell death in BL41-3 as compared with BL41 cells (not shown). In summary, whereas the MCL1-overexpressing BL41-3 cells were more resistant than BL41 cells to serum-depletion, etoposide, camptothecin, and staurosporine, they were more sensitive to prolonged exposure to ara-C.
|
| DISCUSSION |
|---|
|
|
|---|
Previous studies on the introduction of MCL1 as a transgene have consistently demonstrated moderate viability-enhancing effects, generally a prolongation of survival of 1 to several days (36)
. Moderate effects have similarly been observed in experiments using antisense MCL1 oligonucleotides (37)
. However, these previous results were difficult to interpret unambiguously, because the levels of MCL1 expression obtained on exogenous introduction represented only
30% of the maximal levels seen endogenously in cells stimulated with PMA. Namely, previous results did not distinguish between the possibility that MCL1 has intrinsically low activity versus the possibility that the moderate effects observed were a result of submaximal MCL1 expression. In the latter case, the high levels of MCL1 stimulated by PMA, growth factors, and other agents might be responsible for robust viability-enhancement rather than making only a modest contribution to this effect. The results observed here are consistent with the latter possibility in that the abundant MCL1 expression seen in BL41-3 cells was associated with viability-enhancement with most of the agents studied. A note of caution is that the BL41-3 subline arose spontaneously rather than through targeted genetic manipulation. These cells thus contain a variety of chromosome rearrangements in addition to the amplification of MCL1. They also exhibit a change in BCL2 expression, although the enhanced viability observed is unlikely to be attributable to this change or to effects on BCLX or BAX expression, which remained constant. We were unable to substantially reduce the very high MCL1 levels in these cells using an antisense approach and, thus, do not know whether this would reverse the observed phenotype. For these reasons, it is not clear to what extent the differences seen relate to the increase in MCL1 versus other changes. Interestingly, these points also apply to patient cancer cells exhibiting increased expression of prosurvival BCL2 family members in that such cells generally contain multiple changes, many of which are poorly characterized. Principles similar to those derived from the BL41-3 cell line may thus apply to patient cells, and it will be interesting to assess in future experiments whether patient samples exhibiting overexpression of BCL2 family members similarly have an "Achilles heel" rendering them sensitive to specific chemotherapeutic approaches.
The chemotherapeutic agents tested here represent apoptosis-inducing drugs that act on different targets. Specifically, etoposide and camptothecin produce DNA strand breaks attributable to topoisomerase inhibition, whereas staurosporine inhibits protein kinase C, and ara-C is an antimetabolite. Agents acting on a variety of targets were chosen to begin to test the hypothesis that the abundant MCL1 expression in BL41-3 cells might promote viability in response to diverse death stimuli. This hypothesis was based on findings with BCL2 and other prosurvival members of the family, which inhibit the apoptosis-inducing effects of a host of different agents and are thought to act in a major common pathway that regulates cell death. However, whereas members of the BCL2 family often have similar effects (either prosurvival or proapoptotic) on the application of a host of death stimuli, this is not always the case. For example, BAK, from its initial identification, had opposing effects in different systems, and paradoxical results have also been observed with BCL2 and BCLX (38, 39, 40) . Even the prototypical proapoptotic family member BAX can have the opposite effect (41) . The present findings are also reminiscent of previous observations with proapoptotic BIM, where knock-out results in a loss of responsiveness to certain death stimuli but not others (42) .
At present, we can only speculate as to the mechanism underlying the results observed in BL41-3 cells where the response to prolonged ara-C exposure was diametrically opposed to the pattern seen with the other agents. Cytotoxicity with ara-C is attributable to its incorporation into elongating DNA strands resulting in premature chain termination (43) ,and also to ara-C-induced aberrant chromosomal reduplication (44) . Thus, a speculative possibility is that the elevated levels of MCL1 in BL41-3 allow for a transient survival advantage during which time more ara-CTP is incorporated, and a higher degree of DNA damage/cell is achieved. These cells exhibit a protective effect until a threshold is reached where the presence of MCL1 is no longer effective. This magnification of genomic DNA damage thus results in enhanced cell death in the population of cells exposed to extended periods of ara-C. This might help explain why such an effect is not seen with a DNA damage-inducing agent such as etoposide where a equal number of topoisomerases should be affected in both cell lines. Similar acting agents, which are incorporated into DNA, such as gemcitabine or fludarabine, will need to be tested to see if this theory can be substantiated. An alternate speculative possibility is that differential cell cycle specificity plays a role, such that BL41-3 cells are more sensitive to agents acting in particular cell cycle phases. The question here is how such an effect might operate given that no difference was seen in BL41 and BL41-3 cell cycle distribution. Whatever the mechanism, the present along with previous observations suggest the intriguing possibility that BCL2 family members may have differential efficacy in different contexts and under different apoptosis-inducing conditions.
The present findings are also interesting in regard to previous observations concerning Burkitt lymphoma. Burkitt lymphoma cell lines exhibiting increased resistance to apoptosis have been described previously (45 , 46) . In MUTU-BL cells, a group I cell line like BL41, cells at late passage were found to be more resistant than those at early passage to certain apoptotic stimuli but not others (46) , providing a precedent for the present results. Alterations involving chromosome 1 and 1q21 in particular are also a frequent finding in Burkitt lymphoma cells and cell lines (47 , 48) . Such alterations have been associated with enhanced tumorigenicity (21) . In view of our recent finding of a high probability of tumor formation in MCL1 transgenic mice (23) , it would be interesting to examine MCL1 expression in Burkitt lymphoma cell lines and/or patient samples. Given the parallels, it is possible that MCL1 plays a role in resistance to cell death and tumorigenicity in this disease.
Overall, the present findings along with previous reports suggest the following intriguing possibility: expression of BCL2 family members may contribute to cancer development and the cancer phenotype through relaxation of the requirements for growth factors and through cooperation with proliferation stimulating genes. However, within the complex context of a cancer cell, these gene products may not necessarily be associated with insurmountable resistance to specific drugs among the battery of agents available for cancer treatment. In summary, the present studies hold out the promise that cancer cells resistant to a variety of cell death stimuli because of the expression of prosurvival BCL2 family members can be efficaciously killed with an appropriate selection of chemotherapeutic regimen.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 R. W. C., J. A. V., and E. S. C. were supported by Grant CA57359 from the National Cancer Institute. C. B. was supported by a stipend from Training Grant T32AI07363. ![]()
2 To whom requests for reprints should be addressed, at Department of Pharmacology and Toxicology, Dartmouth Medical School, Hanover, New Hampshire 03755-3835. Phone: (603) 650-1657; Fax: (603) 650-1129. ![]()
3 The abbreviations used are: PMA, phorbol-12-myristate-13-acetate; ara-C, 1-ß-D-arabinofuranosylcytosine; FBS, fetal bovine serum; PBS-T, PBS containing 0.1% Tween; FISH, fluorescence in situ hybridization; DiOC6, 3,3-dihexyloxacarbocyanine; HSR, homogeneously staining region. ![]()
4 Internet address: http://bru.usgmrl.ksu.edu/throne/probit/. ![]()
Received 9/ 7/01. Accepted 11/30/01.
| REFERENCES |
|---|
|
|
|---|
modulate the prognostic impact of BCL2 expression in acute myelogenous leukemia. Clin. Cancer Res., 6: 1401-1409, 2000.This article has been cited by other articles:
![]() |
A. De Biasio, J. A. Vrana, P. Zhou, L. Qian, C. K. Bieszczad, K. E. Braley, A. M. Domina, S. J. Weintraub, J. M. Neveu, W. S. Lane, et al. N-terminal Truncation of Antiapoptotic MCL1, but Not G2/M-induced Phosphorylation, Is Associated with Stabilization and Abundant Expression in Tumor Cells J. Biol. Chem., August 17, 2007; 282(33): 23919 - 23936. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Minagawa, E. A. Kruglov, J. A. Dranoff, M. E. Robert, G. J. Gores, and M. H. Nathanson The Anti-apoptotic Protein Mcl-1 Inhibits Mitochondrial Ca2+ Signals J. Biol. Chem., September 30, 2005; 280(39): 33637 - 33644. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Harada, K. E. Bower, A. P. Orth, S. Callaway, C. G. Nelson, C. Laris, J. B. Hogenesch, P. K. Vogt, and S. K. Chanda Identification of novel mammalian growth regulatory factors by genome-scale quantitative image analysis Genome Res., August 1, 2005; 15(8): 1136 - 1144. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, L. A. Goldstein, B. R. Gastman, C. J. Froelich, X.-M. Yin, and H. Rabinowich Degradation of Mcl-1 by Granzyme B: IMPLICATIONS FOR Bim-MEDIATED MITOCHONDRIAL APOPTOTIC EVENTS J. Biol. Chem., May 21, 2004; 279(21): 22020 - 22029. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. C. J. van de Donk, D. Schotte, M. M. J. Kamphuis, A. M. W. van Marion, B. van Kessel, A. C. Bloem, and H. M. Lokhorst Protein Geranylgeranylation Is Critical for the Regulation of Survival and Proliferation of Lymphoma Tumor Cells Clin. Cancer Res., November 15, 2003; 9(15): 5735 - 5748. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |