Cancer Research Meeting Calendar  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vrana, J. A.
Right arrow Articles by Craig, R. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vrana, J. A.
Right arrow Articles by Craig, R. W.
[Cancer Research 62, 892-900, February 1, 2002]
© 2002 American Association for Cancer Research


Tumor Biology

An MCL1-overexpressing Burkitt Lymphoma Subline Exhibits Enhanced Survival on Exposure to Serum Deprivation, Topoisomerase Inhibitors, or Staurosporine but Remains Sensitive to 1-ß-D-Arabinofuranosylcytosine1

Julie A. Vrana, Christine K. Bieszczad, Emily S. Cleaveland, Yan Ma, Jonathan P. Park, Thuluvancheri K. Mohandas and Ruth W. Craig2

Departments of Pharmacology and Toxicology [J. A. V., C. K. B., E. S. C., Y. M., R. W. C.] and Pathology [J. P. P., T. K. M.], Dartmouth Medical School, Hanover, New Hampshire 03755-3835


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Members of the BCL2 gene family influence cell viability and can, therefore, affect the susceptibility of cancer cells to multiple chemotherapeutic agents. Thus, it is a challenge to devise approaches for inducing the death of tumor cells in which the expression of prosurvival family members is elevated or deregulated. BL41-3, a spontaneously derived subline of BL41 Burkitt lymphoma cells, was found to have amplified the prosurvival MCL1 gene (3-fold) and overexpressed the MCL1 protein. The level of MCL1 protein was 5-fold elevated compared with ML-1 cells expressing maximal MCL1 on exposure to phorbol-12-myristate-13- acetate. To assess whether this increase in MCL1 expression was associated with enhanced protection from cell death, cells were exposed to conditions of growth factor deprivation or to various cytotoxic agents. Whereas BL41-3 and BL41 cells exhibited similar growth rates in logarithmic phase, BL41-3 cells remained largely viable on reaching saturation phase in contrast to BL41 cells, which began to die. Similarly, the BL41-3 subline remained viable for an extended period under conditions of reduced serum. BL41-3 cells were also more resistant to the apoptosis-inducing effects of etoposide, camptothecin, and staurosporine (>3-fold more than BL41 cells). Unexpectedly, these cells exhibited enhanced sensitivity to 1-ß-D-arabinofuranosylcytosine, but only on exposure for an extended period (>10-fold more sensitive than BL41 cells with a 24-h but not a 6-h exposure). Thus, whereas cells expressing prosurvival BCL2 family members are frequently resistant to a variety of chemotherapeutic agents, the findings presented here, using a cell line exhibiting amplification and overexpression of MCL1, indicate that such cells may exhibit increased sensitivity to certain chemotherapeutic regimens.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cancer cells exhibit alterations in the expression of BCL2 family members and other genes that affect cell viability, as well as in genes that regulate cell growth. A prototypical example is provided by follicular lymphoma, where BCL2 is deregulated and overexpressed as a result of the t(14;18) translocation (1) . Similarly, other leukemias and lymphomas express prosurvival members of this family, as seen in chronic lymphocytic leukemia, diffuse large cell lymphoma, and Burkitt lymphoma (2 , 3) . Cancer cells also frequently lack expression of proapoptotic family members, such as BAD and BAX (4, 5, 6) . The increase in cell survival resulting from these changes acts in concert with enhanced cell proliferation (e.g., because of MYC activation) to promote tumor development (7) .

In contrast to the deregulation seen in leukemia and lymphoma, BCL2 family members normally exhibit highly regulated patterns of expression during the differentiation of hematopoietic and lymphoid cells. Differentiation stage specificity of expression was the basis for the discovery of MCL1, a prosurvival family member that increases in expression (approximately 7–10-fold) in ML-1 human myeloblastic leukemia cells differentiating in response to PMA3 (8) . MCL1 is rapidly up-regulated as these cells initiate monocytic differentiation and is down-regulated as they progress along this lineage. In contrast, BCL2 is expressed at a constant level until declining on terminal differentiation (9) . Similarly, MCL1 is abundantly expressed in normal immature myeloid cells and is down-regulated during maturation (10) . MCL1 and BCL2 are also differentially regulated in the B-lymphocyte lineage, MCL1 expression being abundant in germinal centers but not the surrounding mantle zone and BCL2 expression exhibiting the reciprocal pattern (11) . Analogously, BCL2 and BCLX are expressed in an alternating pattern in early lymphoid development (12 , 13) . Overall, MCL1 and other prosurvival BCL2 family members exhibit distinctive patterns of expression during normal hematolymphoid cell differentiation, and these patterns are altered in cancer.

In addition to its role in tumor development (14 , 15) , the BCL2 family influences the sensitivity of cancer cells to chemotherapeutic agents. Thus, cell lines transfected with prosurvival family members are resistant to a wide range of chemotherapeutic agents, as well as to the withdrawal of survival factors such as those present in serum. Accordingly, in leukemia and lymphoma, higher levels of BCL2 expression are frequently associated with reduced responsiveness to chemotherapeutic agents and poor prognosis (3 , 16) . Other family members also play a role, since lower levels of BAX and higher levels of MCL1 can contribute to a diminished response (4 , 17) . Finally, relapse in acute leukemia is associated with an increase in MCL1 expression (18) . In summary, the expression of prosurvival gene products such as BCL2 and MCL1 can influence the effectiveness of cancer therapy, both in terms of initial responsiveness and in terms of long-term, disease-free survival.

The identification of therapeutic approaches for treating tumors that express prosurvival BCL2 family members represents a challenge, because the above-described resistance applies to a host of agents. Findings that bear on this issue were unexpectedly obtained during studies of BL41-3, a subline that arose spontaneously on continuous passage of BL41 Burkitt lymphoma cells in culture. This subline expresses MCL1 at very high levels. In fact, MCL1 protein levels in BL41-3 cells were found to be 5-fold higher than those seen in ML-1 cells exposed to PMA. In many previous studies of MCL1, we had never observed expression elevated to this extent, even in cell lines stably transfected with constructs containing MCL1 under the control of a strong promoter (14 , 19) . In these transfected cell lines, moderate expression of the introduced MCL1 gene product was associated with a modest enhancement of cell survival. For this reason, it was not clear whether MCL1 had intrinsically low efficacy for promoting cell survival or, alternatively, whether this effect resulted from suboptimal MCL1 expression. The serendipitous isolation of the BL41-3 subline afforded us our first opportunity to gain insight into the effects associated with markedly elevated MCL1 expression. Our original interest was in assessing whether these MCL1 levels were associated with enhanced BL41-3 cell survival. Our findings demonstrate that, indeed, BL41-3 cells are more resistant than the BL41 cell line itself to growth factor deprivation and to exposure to the chemotherapeutic agents etoposide, camptothecin, and staurosporine. Surprisingly, the BL41-3 subline was more sensitive to prolonged ara-C exposure. These observations in MCL1-expressing BL41-3 cells suggest that, despite resistance to a variety of death stimuli, chemotherapeutic approaches can be devised to target tumor cells that exhibit amplification and overexpression of a prosurvival member of the BCL2 family.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines
BL41-3 cells were identified in our laboratory as an MCL1-overexpressing subline that spontaneously grew out of a stock of BL41 cells obtained from Dr. Surrenda Sharma (Brown University, Providence, RI; Ref. 20 ) when cells were maintained by dilution to a density of 3 x 105 cells/ml. When frozen ampoules of the original stock were thawed and maintained by diluting them to this density every 2–3 days, a small increase in MCL1 expression became apparent after 10–22 days. After 1–2 months of continuous passage, which represented approximately 25–60 doublings or a 107-1015-fold increase in cell number, MCL1-overexpressing cells dominated the cultures. This did not occur in cultures maintained by dilution to a density of 5 x 105 cells/ml. MCL1-overexpressing cells did not grow out from BL41 cell stocks obtained from two other sources, Dr. Graham Packham (Southampton General Hospital, Southampton, England) and Dr. Aimé Vasquez (Institut National de la Santé et de la Recherche Medicale, Clamart, France). The latter provided early passage cells originally obtained from Dr. G. M. Lenoir, the originator of the BL41 cell line (21) . BL41 cells obtained from Dr. Packham and Dr. Vasquez expressed MCL1 protein at equivalent levels, and these levels remained stable over multiple passages in culture. Thus, these provided a source of stable BL41 cell lines, and cells from Dr. Packham were used for comparison to the BL41-3 cells in the experiments described here. ML-1 cells have been used extensively in this laboratory (8 , 9 , 22) . The EBV-immortalized human lymphoblastoid cell line (LCL721.221) was obtained from American Type Culture Collection. The latter cells were found to express abundant BCL2 as expected but only trace levels of MCL1 (not shown). Cells were maintained in RPMI 1640 (BioWhittaker) containing 7.5% FBS (BioWhittaker), except in the case of LCL721.221 where the concentration of FBS was 10%.

Western Blotting
Cells were washed in PBS, lysed in Laemmli buffer [62.5 mM Tris (pH 6.8), 2% SDS, 10% glycerol, 0.1% bromphenol blue, 50 mM DTT], and whole cell extract was separated by 15% SDS-PAGE. After transfer to Immobilon P (Millipore), the membrane was blocked for 1 h in PBS-T and 3% nonfat dry milk (Carnation). The membrane was then incubated for 16 h at 4°C with primary antibody, either a mouse monoclonal anti-MCL1 antibody (BD PharMingen; San Diego, CA; 1:2000; Ref. 23 ), an anti-BCL2 antibody (DAKO, Carpinteria, CA; 1:2000), an anti-BCLxL antibody (Santa Cruz Biotechnology, Santa Cruz, CA; 1:1000), or an anti-BAX antibody (Santa Cruz Biotechnology; 1:750) in PBS-T/3% milk. The blot was washed three times and incubated for 45 min with either a goat antimouse or a donkey antirabbit horseradish peroxidase-conjugated secondary antibody (Kirkegaard & Perry Laboratories, Gaithersburg, MD) in PBS-T/3% milk. The blot was washed three times and developed using enhanced chemiluminescence (Amersham, Piscataway, NJ). Quantitation of MCL1 and BCL2 protein expression in BL41-3 cells as compared with ML-1 and BL41 cells was carried out by densitometric scanning of nonsaturated autoradiographs containing serial dilutions of the cell extracts representing a range of cell equivalents.

Cytofluorometric Assay of MCL1 Expression
Logarithmically growing cells (1 x 106) were fixed and permeabilized (Fix and Perm; Caltag Laboratories; Burlingame, CA) following the manufacturer’s instructions. Briefly, cells were fixed for 15 min in Reagent A, washed in PBS, and subsequently incubated with the anti-MCL1 antibody and FITC-conjugated antimouse IgG (Sigma Chemical Co.) for 15 min each in Reagent B. Cells were washed and diluted in cold PBS, and 10,000 cells/condition were analyzed using a Becton Dickinson FACScan flow cytometer and CyCLOPS 2000 software.

Southern Blot Analysis and Quantitative PCR
Quantitative PCR.
The PCR approach described here to monitor MCL-1 abundance in genomic DNA samples was adapted from a quantitative PCR protocol described previously (24) . Genomic DNA from BL41 and BL41-3 cells was used as a template for PCR with primers that represent the MCL1 gene and span an intron [primer 81F (sense), 5' CGCGGTAATCGGACTCAAG 3' and primer 810R (antisense) 5' ATGGATCATCACTCGAGACA 3']. Each template was used at serial 1:2 dilutions representing ~0.062 to 0.5 ng genomic DNA. For normalization, these dilutions were also used in separate reactions with primers representing glyceraldehyde-3-phosphate dehydrogenase or tubulin. As a control, a human lymphoblastoid cell line (LCL721.221) found to be equivalent to normal human genomic DNA in MCL1 copy number was assayed in parallel with BL41 and BL41-3 cells. The reaction mixture consisted of 10 mM Tris-HCl/50 mM KCl/1.5 mM MgCl2 buffer containing dATP, dTTP, dGTP, and dCTP (100 µM each) and the primers (100 nM each). Samples were protected from evaporation with paraffin and mineral oil, and Taq polymerase (Perkin-Elmer; 0.1 unit in a final reaction volume of 20 µl) was combined with the remaining ingredients when the reaction temperature reached 70°C. After an initial 3 min denaturation at 96°C, PCR was carried out in two stages: 5 cycles of 96°C for 1.5 min, 57°C for 1 min, and 72°C for 1.5 min, followed by 23 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1.2 min, and then a final extension at 72°C for 8 min. The PCR product obtained (an ~1.1-kb fragment representing MCL1 human genomic DNA) was subjected to acrylamide gel electrophoresis, stained with SYBR Green I (Molecular Probes), and quantitated using a Storm Fluoroimager (Molecular Dynamics). The amount of PCR product obtained (ng) was plotted against template concentration for the serial dilutions, and the slope of the resultant curve obtained with the MCL1 primers was normalized by division by the slope of the curve obtained with the glyceraldehyde-3-phosphate dehydrogenase or tubulin primers. Relative MCL1 gene abundance was estimated by dividing the normalized MCL1 abundance values thus obtained for BL41 and BL41-3 cells by the value for the LCL721.221 control cell line.

Southern Blot Analysis.
Genomic DNA was isolated from logarithmically growing cells by phenol-chloroform extraction and ethanol precipitation. DNA (25 µg) was digested with BamHI, fractionated on a 0.75% agarose gel, transferred to a noncharged nylon membrane (Millipore), and probed with a gel-purified PCR fragment generated by using the above-described 81F and 810R primers in PCR with human genomic DNA. The fragment was biotin labeled using a random priming kit (NEBlot; New England Biolabs, Beverly, MA). Prehybridization/hybridization was performed at 42°C for 1.5 h using a 50% formamide based hybridization solution (ULTRAhyb; Ambion, Austin, TX). Two washes were carried out at 42°C for 5 min each with 2 x SSC, 0.1% SDS, followed by two washes at 42°C for 15 min each with 0.1 x SSC, 0.1% SDS. The blot was sequentially incubated with streptavidin and biotinylated horseradish peroxidase and visualized by chemiluminescence on X-OMAT film (Kodak).

Chromosome Analysis and FISH
Chromosome preparations were made by standard procedures, and karyotype analysis was done using routine G-banding. The probe for the MCL1 locus, a 3-kb genomic fragment (BS3.0) described previously (25) , was biotin-labeled by nick translation (Bionick; Life Technologies, Inc., Gaithersburg, MD). Chromosome preparations on slides were conditioned by incubation for 30 min in a 37°C bath in 2 x SSC, followed immediately by sequential dehydration in 70%, 80%, and 95% ethanol (2 min each at room temperature) and air drying. Slides were denatured in 70% formamide/2 x SSC (70°C x 5 min) followed by serial dehydration at room temperature. The probe was heat denatured (5 min at 70°C) and preannealed at 37°C for 2 h. The hybridization solution contained 0.2 µg probe, 10 µg Cot-1 DNA (Life Technologies, Inc.) and 30 µg herring sperm DNA (Life Technologies, Inc.) in 15 µl of Hybrisol VII (Oncor, Gaithersburg, MD) per slide. Hybridization and posthybridization conditions were as described previously (26) . Chromosomes were counterstained with 4',6-diamidino-2-phenylindole and pseudo-G-banding patterns were visualized by inversion of the digitized image. The whole chromosome 1 paint probe (Coatasome 1) and the chromosome 17 {alpha} satellite probe (D17Z1) were from Oncor. Hybridization and posthybridization conditions for these two probes were according to the manufacturer’s protocol. Simultaneous cohybridizations were performed at the more permissive stringency if different conditions were required for the probes being hybridized. FISH images were captured using a monochromatic CCD camera mounted on a Zeiss epifluorescence microscope with a LUDL filter wheel and a fixed multiband-pass beam splitter using MacProbe software (PSI, Houston, TX).

Cell Viability Assays
In experiments involving conditions of reduced serum, cells were washed twice with serum-free medium and transferred to medium containing 7.5% or 1% FBS. Viable cell number and the percentage of viable cells were determined by hemacytometer cell counts using trypan blue as described previously (14) . Doubling time was calculated from semilog plots of viable cell number versus time, using the linear portion of the curve. For experiments involving exposure to cytotoxic agents, etoposide, staurosporine (Sigma Chemical Co. Chemicals, St. Louis, MO), camptothecin (Calbiochem, La Jolla, CA), and ZVAD-FMK (Bio-Rad, Hercules, CA) were dissolved in DMSO and stored at -80°C. Vehicle controls (final DMSO concentration of <=0.05%) were consistently found to be equivalent to drug-free controls. Ara-C (Sigma Chemical Co.) was maintained as a dry powder at -20°C and reformulated in PBS before use. Apoptotic morphology was assessed in cytocentrifuge preparations stained with the Diff-Quik stain set (Dade Behring, Deerfield, IL) and viewed by light microscopy as described previously (27) . Mitochondrial membrane potential was assessed using either DiOC6 (40 nM; Molecular Probes, Eugene, OR) as described (28) or 5,5'6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide [JC1; DePsipher (Trevigen, Gaithersburg, MD) Mitochondrial Assay kit] according to the manufacturer’s instructions. Cells (2 x 105) were incubated with the mitochondrial dyes for 15 min at room temperature and assayed by cytofluorometry. CyCLOPS 2000 software was used to calculate the percentage of cells exhibiting decreased DiOC6 fluorescence relative to viable untreated control cells. In the case of JC1, the percentage of cells shifting from the aggregate red fluorescence to the monomeric green fluorescence reflects loss of mitochondrial membrane potential. The percentage of cells exhibiting loss of mitochondrial membrane potential in drug-treated cultures was calculated by subtraction of the background percentage of such cells in untreated control cultures.

Statistical Analysis
EC50 and EC33 values ± 90% confidence intervals were calculated by the log dose/probit response analysis using the Priprobit program.4


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The BL41-3 Subline Exhibits Amplification and Overexpression of MCL1.
We serendipitously discovered that continuous passage of a particular stock of BL41 cells under specific conditions (see "Materials and Methods") invariably resulted in the outgrowth of a subline, BL41-3, that expresses very high levels of MCL1. To more carefully characterize expression in this subline, we compared MCL1 levels in BL41-3 to those seen in ML-1 cells where expression has been monitored extensively. The MCL1 protein is expressed at low basal levels in ML-1 cells (Refs. 8 , 9 , 29 ; not detectable in the brief exposure of the autoradiograph in Fig. 1ACitation ), and expression is dramatically increased on treatment with PMA. MCL1 levels in BL41-3 cells are even higher than those seen in PMA-treated ML-1 cells (>5-fold; Fig. 1ACitation ) and do not exhibit a substantial additional increase in response to PMA (not shown). These levels in BL41-3 cells represent an ~3-fold increase over those present in the BL41 cell line (as assessed by cytofluorometry or Western blotting, Fig. 1, B and CCitation ). Both BL41 and BL41-3 express readily detectable levels of MCL1 commonly seen as a doublet by gel electrophoresis (30) . In contrast to the increase in MCL1, expression of BCLXL and BAX in BL41-3 cells is not substantially altered, whereas expression of BCL2 is decreased (~5-fold; Fig. 1CCitation ). The finding that the increase in expression of MCL1 in BL41-3 cells is accompanied by a decrease in BCL2 is consistent with the reciprocal regulation of these two family members observed previously (10) .



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Elevated expression of the MCL1 protein in BL41-3 cells. A, Western blotting was used to monitor expression of the MCL1 protein in BL41-3 and ML-1 cells, where the latter were either left untreated (CONT) or treated with PMA under conditions that result in maximal MCL1 expression (0.5 nM PMA for 5 h). MCL1 expression in BL41-3 cells was estimated to be 5.7-fold higher (± 1.2 SD; n = 4) than in PMA-treated ML-1 cells. B, cytofluorometry was used to monitor expression of the MCL1 protein in BL41 and BL41-3 cells. MCL1 expression in BL41-3 cells was estimated to be 2.5-fold higher than in BL41 cells, where control samples incubated with the FITC-conjugated second antibody alone demonstrated a 25-fold lower level of fluorescence (not shown). C, Western blotting was used to monitor expression of a variety of BCL2 family members in BL41 and BL41-3 cells. Each lane represents 250,000 cell equivalents. MCL1 expression in BL41-3 cells was estimated to be 2.8-fold higher than in BL41 cells.

 
We surmised that the increase in MCL1 expression might reflect an increase in MCL1 at the DNA level. This possibility was examined using quantitative PCR, Southern blotting, and FISH. Quantitative PCR using primers that specifically detect MCL1 human genomic DNA demonstrated a marked increase in the abundance of the MCL1 gene in BL41-3 cells (~9.3-fold as compared with a single copy control cell line; Fig. 2ACitation , lower graph) and some increase in BL41 itself (~2.8-fold). In other words, BL41-3 cells exhibited an ~3-fold increase over BL41 cells in MCL1 gene abundance, which closely paralleled the ~3-fold difference in MCL1 protein levels. Southern blotting demonstrated a similar increase in MCL1 in the genomic DNA of BL41-3 as compared with BL41 cells (Fig. 2ACitation , top photograph). These findings suggested amplification of the MCL1 gene might underlie the abundant MCL1 expression seen in BL41 cells and the still higher levels present in BL41-3.



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. MCL1 gene amplification in BL41-3 cells. A, Southern blotting (top photograph) and quantitative PCR (bottom graph) were used to assess the relative abundance of the MCL1 gene in the genomic DNA of BL41 and BL41-3 cells. In the graph showing the results of PCR, relative MCL1 gene abundance was estimated by comparison to an EBV-immortalized human lymphoblastoid control cell line (n = 9; bars, ± SE). B and C, FISH analysis was used in assessing MCL1 gene amplification in BL41 (B) and BL41-3 (C) cells. An MCL1 probe hybridized to chromosome 1q21 in both BL41 and BL41-3 cells (white arrows in the partial metaphases shown in B and C). This probe also demonstrated intense hybridization to a marker chromosome in BL41-3 cells (red arrow in C). D, chromosome painting was used to characterize the 17p+ marker chromosome present in BL41-3 cells. Dual-color hybridization of chromosome 1 paint probe (red), along with chromosome 17 centromere-specific {alpha}-satellite and MCL1 probes (both green) demonstrated MCL1 signal on the 17p+ chromosome (red arrow), as well as a chromosome 1 homologue (white arrow). The MCL1 signal on the 17p+ chromosome appears white because of the superposition of the MCL1 (green) and chromosome 1 paint (red) probes.

 
To probe for MCL1 gene amplification, we carried out G-banding of BL41 and BL41-3 cells and performed FISH using MCL1 as a probe. G-banding (not shown) demonstrated that both cell lines contained the der(8) chromosome from the t(8;14) translocation that typifies Burkitt lymphoma, along with multiple other rearranged chromosomes. Both lines also contained an apparently normal chromosome 1 pair, of note because MCL1 is located on chromosome 1q21 (25) . Of particular interest in the context of gene amplification was the fact that BL41-3 cells contained what appeared to be a 17p+ marker chromosome with a HSR. FISH analysis of BL41-3 cells using chromosome 1 paint produced signals on this marker chromosome and on a translocation (1 , 9) chromosome containing most of the long arm of chromosome 1 and most of chromosome 9, as well as on the normal chromosome 1 homologues and one other marker chromosome. Thus, material from chromosome 1 was present on several rearranged chromosomes in BL41-3 cells, in particular on a putative 17p+ marker chromosome containing an HSR. It was the presence of this distinctive karyotypic marker in BL41-3 (but not BL41) cells that led to its designation as a distinct cell subline.

FISH studies using an MCL1 probe generated signals at band q21 of the two normal copies of chromosome 1 in both cell lines (Fig. 2, B and CCitation , white arrows), as expected (25) . BL41-3 but not BL41 cells also exhibited a marker chromosome with a very intense signal indicative of the presence of amplified copies of MCL1 (Fig. 2CCitation , red arrow). Whereas BL41 cells did not exhibit this very intense signal, low-level signals on uncharacterized marker chromosomes (Fig. 1B)Citation could represent the modest increase in MCL1 seen in the genomic DNA of this cell line. The marker chromosome present in BL41-3 cells was confirmed to contain material from chromosome 17 as well as chromosome 1, because FISH using a chromosome 17-specific {alpha} satellite probe produced signal on this marker (labeled 17p+ in Fig. 2DCitation ) as well as on the centromere of the normal chromosome 17. One possible model to account for these observations is that a modest increase in MCL1 copy number is present in BL41 cells and that extensive additional amplification, along with the generation of an HSR, occurred during the outgrowth of the BL41-3 subline.

The BL41-3 Subline Exhibits Reduced Dependence on Survival Factors from Serum-containing Medium.
As a first step in comparing the properties of BL41 and BL41-3 cells, we characterized their growth kinetics. Cells were subcultured in fresh serum-containing medium, and cell number and viability were monitored for 5 days. The two cell lines initially proliferated exponentially with comparable doubling times [22–23 h (±2 h SE); mean of the doubling times calculated in six independent experiments]. They also exhibited similar cell cycle distribution profiles (Fig. 3ACitation , legend). However, the two cell lines differed dramatically on approaching saturation phase (Fig. 3A)Citation . BL41 cells reached a maximum density of ~1.5 x 106 cells/ml (day 3) after which their cell viability decreased markedly. In contrast, BL41-3 cells reached a maximum density of >3 x 106 cells/ml (day 4) and demonstrated only a small decline in viability (to 87% on day 5 as compared with values of 62% and 28% on days 4 and 5 for BL41). Thus, one unique property of the BL41-3 subline appeared to be a capacity for remaining viable at saturation density.



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Enhanced viability of BL41-3 cells on growth to saturation phase or under conditions of reduced serum. A and B, viable cell number and the percentage of viable cells (by trypan blue dye exclusion) were assayed in BL41 and BL41-3 cells incubated (2 x 105 cells/ml) in medium containing FBS at a concentration of either 7.5% (A) or 1% FBS (B). The values shown at each time point represent the mean of six (A) or three (B) experiments with two replicates per experiment, where the three experiments using 1% FBS were carried out concurrently with three of the experiments using 7.5% FBS; bars, ± SE. The percentage of viable cells is listed on the graph next to each point. In companion experiments of exponentially growing cells, the cell cycle distribution of BL41 was as follows: 37 ± 1% G0/G1-, 43 ± 2% S-, and 19 ± 2% G2-M-phase cells. The distribution of BL41-3 was: 33 ± 2% G0/G1-, 43 ± 5% S-, and 24 ± 5% G2-M-phase cells. These values represent four independent experiments; bars, ± SE.

 
Cells that survive at high density frequently also exhibit a reduction in serum dependence. To test this, we placed BL41 and BL41-3 cells in medium containing reduced serum (1% FBS), and monitored cell counts and viability as above. BL41 cells lost viability more rapidly than BL41-3 cells, such that the percentage of viable cells in BL41 cultures on day 3 was 38% as compared with twice this value in BL41-3 cultures (74%; Fig. 3BCitation ). At later time points, viability continued to decline in both cases, but the differential between the two cell lines was maintained. These observations were consistent with results from other systems demonstrating that MCL1 expression is associated with a reduced dependence on factors that promote cell survival (14 , 31) . Overall, BL41-3 cells exhibited a reduced dependence on survival/growth factors as compared with BL41 cells, both on growth to high cell density and on transfer to reduced serum conditions.

The BL41-3 Subline Exhibits Resistance to Etoposide and Other Apoptosis-inducing Drugs but Remains Sensitive to Prolonged Exposure to Ara-C.
Cell lines overexpressing prosurvival BCL2 family members, including MCL1, generally exhibit resistance to chemotherapeutic agents as well as to growth factor withdrawal (14) . Etoposide induces apoptosis in a variety of neoplastic cells and is used in the treatment of Burkitt and other types of lymphoma (32 , 33) . The protection afforded by MCL1 to the apoptosis-inducing effects of etoposide has been characterized extensively (14) . Therefore, we examined the effects of etoposide on BL41 and BL41-3 cells, initially monitoring the appearance of cells exhibiting classical apoptotic morphology, because this was the basis for the original definition of apoptosis (34) . We found that cell death in response to this agent was markedly reduced in BL41-3 as compared with BL41 cells. This could be seen in concentration/response experiments using a 6-h exposure time, where the response curve for BL41-3 was shifted to the right compared with that for BL41 cells (Fig. 4A)Citation . Probit analysis revealed that an ~9-fold higher concentration of etoposide was required to induce death in BL41-3 cell cultures equivalent to that seen in BL41 cell cultures (Table 1)Citation . Similarly, in time course experiments, increasing drug exposure was found to result in increasing cell death in both cell lines, with the differential between the two being maintained such that cell death was delayed in BL41-3 as compared with BL41 cells (Fig. 4B)Citation . Thus, whereas BL41 cells exhibited ~60% death after 6 h of exposure to 50 µM etoposide, it took 24 h of exposure before BL41-3 cells exhibited a similar amount of death. The appearance of apoptotic cells did not appear to be attributable to loss of the MCL1 protein, which was decreased only slightly at 6 h (Fig. 4C)Citation , although MCL1 expression was decreased at 24 h when a substantial number of cells had undergone apoptosis. As expected, pretreatment with the broad-based caspase inhibitor ZVAD-FMK prevented the etoposide-induced morphological changes (Fig. 4D)Citation . In agreement with the apoptotic morphology observed, cells in etoposide-treated cultures exhibited a loss of mitochondrial membrane potential as assessed using mitochondrial dyes (Fig. 4E)Citation . This loss was less pronounced in BL41-3 than BL41 cells and was attenuated in both cases by pretreatment with ZVAD-FMK. Taken together, the above results were internally consistent in that cell death was less marked in BL41-3 than BL41 cell cultures on exposure to etoposide as on serum deprivation. These results also agreed with previous studies in which protection from these conditions was observed in MCL1-transfected cells (14) .



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Increased resistance of BL41-3 cells to the apoptosis-inducing agent etoposide. A and B, percentage of cells exhibiting apoptotic morphology was assessed in BL41 ({bullet}) and BL41-3 cells ({circ}) incubated (4 x 105 cells/ml) in the presence of either various concentrations of etoposide (VP16) for 6 h (A) or 50 µM etoposide for increasing exposure times (B). The values shown represent the mean of three to four experiments; bars, ± SE. C, Western blotting was used to demonstrate MCL1 expression in BL41 and BL41-3 cells exposed to etoposide for 6 or 24 h. Equal amounts of total cell equivalents were loaded in each lane. D, cells were either exposed or not exposed to 20 µM ZVAD-FMK for 30 min before the addition of 50 µM etoposide (VP16) for 6 or 24 h (BL41, {blacksquare}; BL41-3, {square}). The values shown represent two experiments in which 1000 cells were counted; bars, ± SE. Cells exposed to vehicle alone (DMSO) or ZVAD-FMK alone exhibited <10% apoptosis. E, DiOC6 was used to estimate the percentage of cells exhibiting loss of mitochondrial membrane potential ({Delta}{psi}m loss) on exposure to 50 µM etoposide (VP16) for 24 h, either in the absence or presence of 20 µM ZVAD-FMK (BL41, {blacksquare}; BL41-3, {square}). In untreated control cell cultures, the percentage of cells exhibiting loss of mitochondrial membrane potential was <=10%. Loss of mitochondrial membrane potential was also monitored with the cationic dye JC1, which gave similar results: BL41- 11% (untreated) to 68% (VP16) versus BL41-3- 6% (untreated) to 35% (VP16). The values shown represent two experiments; bars, ± SE.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Sensitivity of BL41 and BL41-3 cells to various agents

BL41 and BL41-3 cells were treated with a series of concentrations of the indicated agents, and the concentrations causing 50% or 33% apoptosis (EC50 and EC33) were calculated using the Priprobit program. The 90% confidence intervals are in parentheses. Data for BL41 and BL41-3 cells were analysed together to facilitate estimation of the BL41-3:BL41 ratio, except in the case of ara-C where the values did not span the concentration/response curve with the 6-hr exposure, and the slopes of the concentration/response curves for the two cell lines differed markedly with the 24-hr exposure.

 
We next tested the effects of additional agents, including the topoisomerase I inhibitor camptothecin, as a point of comparison to the results obtained with etoposide, and the protein kinase inhibitor staurosporine, as a classical apoptosis-inducing agent (35) . Concentration/response studies were carried out using a 6-h exposure as above. Both of these agents were found to cause less cell death in BL41-3 than BL41 cell cultures, such that an approximate 3–4-fold higher drug concentration was required to produce equivalent cell death in the former as compared with the latter (EC50 values in Table 1Citation ). In summary, BL41-3 cells were more resistant than BL41 cells under a variety of conditions that promote cell death.

In a final set of experiments, we examined the effect of ara-C as another chemotherapeutic agent used in the treatment of lymphoma. In concentration/response experiments using the 6-h exposure, cell death was only moderate, reaching at maximum of ~40% with BL41 cells and 20% with BL41-3 cells exposed to 100 µM ara-C (Fig. 5A)Citation . EC50 values could not be calculated, because the concentration response curves reached a plateau. However, comparison of lower extents of cell death (e.g., EC33; Table 1Citation ) suggested that at least 3-fold more ara-C was required to induce cell death in BL41-3 cells equivalent to that seen in BL41 cells. Thus, the results observed with the 6-h exposure to ara-C were reminiscent of those obtained with the other agents above. We repeated the concentration/response studies using an exposure time of 24 h. To our surprise, the order of sensitivity of the two cell lines was reversed in that cell death was much more pronounced in BL41-3 than BL41 cell cultures with this longer ara-C exposure (Fig. 5B)Citation . For example, a 24-h exposure to 1 µM of ara-C resulted in minimal death of BL41 cells but extensive death (>50%) of BL41-3 cells. With this longer exposure, the EC50 for BL41-3 cells was decreased >10-fold compared with that for BL41 cells (Table 1)Citation . MCL1 protein expression was minimally affected at the early 6-h time point, although a substantial loss of MCL1 protein occurred at 24 h particularly in BL41-3 cell cultures where cell death was marked (Fig. 5C)Citation . The increased death of BL41-3 cells on prolonged exposure to ara-C was also seen in the increased number of these cells exhibiting loss of mitochondrial membrane potential (Fig. 5D)Citation . Because of the difference in cell death observed at 6 h versus 24 h we sought to determine the exposure time necessary to cause the reversal in ara-C sensitivity. In time course experiments using either 1 or 10 µM of ara-C, we found that at least 18 h of drug exposure were necessary to produce increased apoptotic cell death in BL41-3 as compared with BL41 cells (not shown). In summary, whereas the MCL1-overexpressing BL41-3 cells were more resistant than BL41 cells to serum-depletion, etoposide, camptothecin, and staurosporine, they were more sensitive to prolonged exposure to ara-C.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Sensitivity of BL41-3 cells to prolonged exposure to ara-C. A and B, percentage of cells exhibiting apoptotic morphology was assessed in BL41 ({bullet}) and BL41-3 ({circ}) cells incubated (4 x 105 cells/ml) in the presence of various concentrations of ara-C for either 6 h (A) or 24 h (B). The values shown represent the mean of four to six experiments; bars, ± SE. C, Western blotting was used to demonstrate MCL1 expression in BL41 and BL41-3 cells exposed to ara-C for 6 or 24 h. Equal amounts of total cell equivalents were loaded in each lane. D, DiOC6 was used to estimate the percentage of cells exhibiting loss of mitochondrial membrane potential ({Delta}{psi}m loss) on exposure to 10 µM ara-C for 24 h (BL41, {blacksquare}; BL41-3, {square}). In untreated control cell cultures, the percentage of cells exhibiting loss of mitochondrial membrane potential was <=10%. The values shown represent two experiments, bars, ± SE.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The work reported here originated with the observation of high levels of MCL1 protein expression in BL41 cells and in particular in the BL41-3 subline. Among the highest MCL1 levels seen in previous studies were those induced by PMA in myeloid cell lines such as ML-1. These levels were surpassed in BL41-3 cells, increased expression being associated with amplification of the MCL1 gene on a 17p+ marker chromosome that contained an HSR and material from chromosome 1. An initial step toward amplification may have taken place in BL41 cells themselves, as these exhibited a small increase in MCL1 in genomic DNA. The additional MCL1 amplification seen in the BL41-3 cell line may have occurred as a rare event in the stock culture from a particular source, because BL41-3 cells did not grow out of stocks from other sources. This amplification may have conferred a survival advantage that allowed for the outgrowth of the subline under the conditions used in our laboratory. Indeed, as shown here, BL41-3 cells have a survival advantage compared with BL41 cells under a variety of death-inducing conditions, including growth factor depletion as well as exposure to etoposide, staurosporine, and camptothecin. Surprisingly, however, BL41-3 cells remained strikingly sensitive to prolonged exposure to ara-C.

Previous studies on the introduction of MCL1 as a transgene have consistently demonstrated moderate viability-enhancing effects, generally a prolongation of survival of 1 to several days (36) . Moderate effects have similarly been observed in experiments using antisense MCL1 oligonucleotides (37) . However, these previous results were difficult to interpret unambiguously, because the levels of MCL1 expression obtained on exogenous introduction represented only ~30% of the maximal levels seen endogenously in cells stimulated with PMA. Namely, previous results did not distinguish between the possibility that MCL1 has intrinsically low activity versus the possibility that the moderate effects observed were a result of submaximal MCL1 expression. In the latter case, the high levels of MCL1 stimulated by PMA, growth factors, and other agents might be responsible for robust viability-enhancement rather than making only a modest contribution to this effect. The results observed here are consistent with the latter possibility in that the abundant MCL1 expression seen in BL41-3 cells was associated with viability-enhancement with most of the agents studied. A note of caution is that the BL41-3 subline arose spontaneously rather than through targeted genetic manipulation. These cells thus contain a variety of chromosome rearrangements in addition to the amplification of MCL1. They also exhibit a change in BCL2 expression, although the enhanced viability observed is unlikely to be attributable to this change or to effects on BCLX or BAX expression, which remained constant. We were unable to substantially reduce the very high MCL1 levels in these cells using an antisense approach and, thus, do not know whether this would reverse the observed phenotype. For these reasons, it is not clear to what extent the differences seen relate to the increase in MCL1 versus other changes. Interestingly, these points also apply to patient cancer cells exhibiting increased expression of prosurvival BCL2 family members in that such cells generally contain multiple changes, many of which are poorly characterized. Principles similar to those derived from the BL41-3 cell line may thus apply to patient cells, and it will be interesting to assess in future experiments whether patient samples exhibiting overexpression of BCL2 family members similarly have an "Achilles heel" rendering them sensitive to specific chemotherapeutic approaches.

The chemotherapeutic agents tested here represent apoptosis-inducing drugs that act on different targets. Specifically, etoposide and camptothecin produce DNA strand breaks attributable to topoisomerase inhibition, whereas staurosporine inhibits protein kinase C, and ara-C is an antimetabolite. Agents acting on a variety of targets were chosen to begin to test the hypothesis that the abundant MCL1 expression in BL41-3 cells might promote viability in response to diverse death stimuli. This hypothesis was based on findings with BCL2 and other prosurvival members of the family, which inhibit the apoptosis-inducing effects of a host of different agents and are thought to act in a major common pathway that regulates cell death. However, whereas members of the BCL2 family often have similar effects (either prosurvival or proapoptotic) on the application of a host of death stimuli, this is not always the case. For example, BAK, from its initial identification, had opposing effects in different systems, and paradoxical results have also been observed with BCL2 and BCLX (38, 39, 40) . Even the prototypical proapoptotic family member BAX can have the opposite effect (41) . The present findings are also reminiscent of previous observations with proapoptotic BIM, where knock-out results in a loss of responsiveness to certain death stimuli but not others (42) .

At present, we can only speculate as to the mechanism underlying the results observed in BL41-3 cells where the response to prolonged ara-C exposure was diametrically opposed to the pattern seen with the other agents. Cytotoxicity with ara-C is attributable to its incorporation into elongating DNA strands resulting in premature chain termination (43) ,and also to ara-C-induced aberrant chromosomal reduplication (44) . Thus, a speculative possibility is that the elevated levels of MCL1 in BL41-3 allow for a transient survival advantage during which time more ara-CTP is incorporated, and a higher degree of DNA damage/cell is achieved. These cells exhibit a protective effect until a threshold is reached where the presence of MCL1 is no longer effective. This magnification of genomic DNA damage thus results in enhanced cell death in the population of cells exposed to extended periods of ara-C. This might help explain why such an effect is not seen with a DNA damage-inducing agent such as etoposide where a equal number of topoisomerases should be affected in both cell lines. Similar acting agents, which are incorporated into DNA, such as gemcitabine or fludarabine, will need to be tested to see if this theory can be substantiated. An alternate speculative possibility is that differential cell cycle specificity plays a role, such that BL41-3 cells are more sensitive to agents acting in particular cell cycle phases. The question here is how such an effect might operate given that no difference was seen in BL41 and BL41-3 cell cycle distribution. Whatever the mechanism, the present along with previous observations suggest the intriguing possibility that BCL2 family members may have differential efficacy in different contexts and under different apoptosis-inducing conditions.

The present findings are also interesting in regard to previous observations concerning Burkitt lymphoma. Burkitt lymphoma cell lines exhibiting increased resistance to apoptosis have been described previously (45 , 46) . In MUTU-BL cells, a group I cell line like BL41, cells at late passage were found to be more resistant than those at early passage to certain apoptotic stimuli but not others (46) , providing a precedent for the present results. Alterations involving chromosome 1 and 1q21 in particular are also a frequent finding in Burkitt lymphoma cells and cell lines (47 , 48) . Such alterations have been associated with enhanced tumorigenicity (21) . In view of our recent finding of a high probability of tumor formation in MCL1 transgenic mice (23) , it would be interesting to examine MCL1 expression in Burkitt lymphoma cell lines and/or patient samples. Given the parallels, it is possible that MCL1 plays a role in resistance to cell death and tumorigenicity in this disease.

Overall, the present findings along with previous reports suggest the following intriguing possibility: expression of BCL2 family members may contribute to cancer development and the cancer phenotype through relaxation of the requirements for growth factors and through cooperation with proliferation stimulating genes. However, within the complex context of a cancer cell, these gene products may not necessarily be associated with insurmountable resistance to specific drugs among the battery of agents available for cancer treatment. In summary, the present studies hold out the promise that cancer cells resistant to a variety of cell death stimuli because of the expression of prosurvival BCL2 family members can be efficaciously killed with an appropriate selection of chemotherapeutic regimen.


    ACKNOWLEDGMENTS
 
We thank Andrea Brown for excellent technical assistance and Dr. William Wade for generous help throughout this project. We also thank Dr. Alan Eastman for critical help in reviewing the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 R. W. C., J. A. V., and E. S. C. were supported by Grant CA57359 from the National Cancer Institute. C. B. was supported by a stipend from Training Grant T32AI07363. Back

2 To whom requests for reprints should be addressed, at Department of Pharmacology and Toxicology, Dartmouth Medical School, Hanover, New Hampshire 03755-3835. Phone: (603) 650-1657; Fax: (603) 650-1129. Back

3 The abbreviations used are: PMA, phorbol-12-myristate-13-acetate; ara-C, 1-ß-D-arabinofuranosylcytosine; FBS, fetal bovine serum; PBS-T, PBS containing 0.1% Tween; FISH, fluorescence in situ hybridization; DiOC6, 3,3-dihexyloxacarbocyanine; HSR, homogeneously staining region. Back

4 Internet address: http://bru.usgmrl.ksu.edu/throne/probit/. Back

Received 9/ 7/01. Accepted 11/30/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Reed J. C., Tsujimoto Y., Epstein S. F., Cuddy M., Slabiak T., Nowell P. C., Croce C. M. Regulation of bcl-2 gene expression in lymphoid cell lines containing normal #18 or t(14;18) chromosomes. Oncogene Res., 4: 271-282, 1989.[Medline]
  2. Gascoyne R. D., Adomat S. A., Krajewski S., Krajewska M., Horsman D. E., Toicher A. W., O-Reilly S. E., Hoskins P., Coldman A. J., Reed J. C., Connors J. M. Prognostic significance of Bcl-2 protein expression and Bcl-2 gene rearrangement in diffuse aggressive Non-Hodgkin’s lymphoma. Blood, 90: 244-251, 1997.[Abstract/Free Full Text]
  3. Reed J. C. Molecular biology of chronic lymphocytic leukemia. Semin. Oncol., 25: 11-18, 1998.[Medline]
  4. Kitada S., Andersen J., Akar S., Zapata J. M., Takayama S., Krajewski S., Wang H. G., Zhang X., Bullrich F., Croce C. M., Rai K., Hines J., Reed J. C. Expression of apoptosis-regulating proteins in chronic lymphocytic leukemia: correlations with in vitro and in vivo chemoresponses. Blood, 91: 3379-3389, 1998.[Abstract/Free Full Text]
  5. Meijerink J. P., Mensink E. J., Wang K., Sedlak T. W., Sloetjes A. W., de Witte T., Waksman G., Korsmeyer S. J. Hematopoietic malignancies demonstrate loss-of-function mutations of BAX. Blood, 91: 2991-2997, 1998.[Abstract/Free Full Text]
  6. Gutierrez M. I., Cherney B., Hussain A., Mostowski H., Tosato G., Magrath I., Bhatia K. Bax is frequently compromised in Burkitt’s lymphomas with irreversible resistance to Fas-induced apoptosis. Cancer Res., 59: 696-703, 1999.[Abstract/Free Full Text]
  7. Cory S., Vaux D., Strasser A., Harris A., Adams J. Insights from Bcl-2 and Myc: malignancy involves abrogation of apoptosis as well as sustained proliferation. Cancer Res., 59S7: 1685-1692, 1999.
  8. Kozopas K., Yang T., Buchan H., Zhou P., Craig R. MCL1, a gene expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2. Proc. Natl. Acad. Sci. USA, 90: 3516-3520, 1993.[Abstract/Free Full Text]
  9. Yang T., Buchan H., Townsend K., Craig R. MCL-1, a member of the BCL-2 family, is induced rapidly in response to signals for cell differentiation or death, but not to signals for cell proliferation. J. Cell. Physiol., 166: 523-536, 1996.[Medline]
  10. Krajewski S., Bodrug S., Krajewska M., Shabaik A., Gascoyne R., Berean K., Reed J. C. Immunohistochemical analysis of Mcl-1 protein in human tissues. Differential regulation of Mcl-1 and Bcl-2 protein production suggests a unique role for Mcl-1 in control of programmed cell death in vivo. Am. J. Pathol., 146: 1309-1319, 1995.[Abstract]
  11. Krajewski S., Bodrug S., Gascoyne R., Berean K., Krajewska M., Reed J. C. Immunohistochemical analysis of Mcl-1 and Bcl-2 proteins in normal and neoplastic lymph nodes. Am. J. Pathol., 145: 515-525, 1994.[Abstract]
  12. Merino R., Ding L., Veis D. J., Korsmeyer S. J., Nunez G. Developmental regulation of the Bcl-2 protein and susceptibility to cell death in B lymphocytes. EMBO J., 13: 683-691, 1994.[Medline]
  13. Cory S. Regulation of lymphocyte survival by the Bcl-2 gene family. Annu. Rev. Immunol., 13: 5133-5543, 1995.
  14. Zhou P., Qian L., Kozopas K. M., Craig R. W. Mcl-1, a Bcl-2 family member, delays the death of hematopoietic cells under a variety of apoptosis-inducing conditions. Blood, 89: 630-643, 1997.[Abstract/Free Full Text]
  15. McDonnell T. J., Korsmeyer S. J. Progression from lymphoid hyperplasia to high-grade malignant lymphoma in mice transgenic for the t(14; 18). Nature (Lond.), 349: 254-256, 1991.[Medline]
  16. Pepper C., Hoy T., Bentley D. P. Bcl-2/Bax ratios in chronic lymphocytic leukaemia and their correlation with in vitro apoptosis and clinical resistance. Br. J. Cancer, 76: 935-938, 1997.[Medline]
  17. Kornblau S., Vu H., Ruvolo P., Estrov Z., O’Brien S., Cortes J., Kantarjian H., Andreeff M., May W. S. BAX and PKC{alpha} modulate the prognostic impact of BCL2 expression in acute myelogenous leukemia. Clin. Cancer Res., 6: 1401-1409, 2000.[Abstract/Free Full Text]
  18. Kaufmann S., Karp J., Svingen P., Krajewski S., Burke P., Gore S., Reed J. Elevated expression of the apoptotic regulator Mcl-1 at the time of leukemic relapse. Blood, 91: 991-1000, 1998.[Abstract/Free Full Text]
  19. Reynolds J. E., Yang T., Qian L., Jenkinson J. D., Zhou P., Eastman A., Craig R. W. Mcl-1, a member of the Bcl-2 family, delays apoptosis induced by c-Myc overexpression in Chinese hamster ovary cells. Cancer Res., 54: 6348-6352, 1994.[Abstract/Free Full Text]
  20. Chaouchi N., Arvanitakis L., Auffredou M., Blanchard D., Vazquez A., Sharma S. Characterization of transforming growth factor-ß1 induced apoptosis in normal human B cells and lymphoma B cell lines. Oncogene, 11: 1615-1622, 1995.[Medline]
  21. Gurtsevitch V., O’Conor G., Lenoir G. Burkitt’s lymphoma cell lines reveal different degrees of tumorigenicity in nude mice. Int. J. Cancer, 41: 87-95, 1988.[Medline]
  22. Yang T., Kozopas K., Craig R. The intracellular distribution and pattern of expression of Mcl-1 overlap with, but are not identical to, those of Bcl-2. J. Cell Biol., 128: 1173-1184, 1995.[Abstract/Free Full Text]
  23. Zhou P., Levy N. B., Xie H. L. Q., Lee C. Y., Gascoyne R. D., Craig R. W. MCL1 transgenic mice exhibit a high incidence of B-cell lymphoma manifested as a spectrum of histologic subtypes. Blood, 97: 3902-3909, 2001.[Abstract/Free Full Text]
  24. Naray-Fejes-Toth A., Canessa C., Cleaveland E. S., Aldrich G., Fejes-Toth G. sgk is an aldosterone-induced kinase in the renal cortical collecting duct. Effects on epithelial na+ channels. J. Biol. Chem., 274: 16973-16978, 1999.[Abstract/Free Full Text]
  25. Craig R., Jabs E., Zhou P., Kozopas K., Hawkins A., Rochelle J., Seldin M., Griffin C. Human and mouse chromosomal mapping of the myeloid cell leukemia-1 gene: MCL1 maps to human chromosome 1q21, a region that is frequently altered in preneoplastic and neoplastic disease. Genomics, 23: 457-463, 1994.[Medline]
  26. Park J. P. Shared synteny of human chromosome 17 loci in Canids. Cytogenet. Cell Genet., 74: 133-137, 1996.[Medline]
  27. Grant S., Turner A. J., Freemerman A. J., Wang Z., Kramer L., Jarvis W. D. Modulation of protein kinase C activity and calcium sensitive isoform expression in human myeloid leukemia cells by bryostatin 1: relationship to differentiation and ara-C-induced apoptosis. Exp. Cell Res., 228: 65-75, 1996.[Medline]
  28. Wang Z., Su Z-Z., Fisher P. B., Van Tuyle G., Wang S., Grant S. Evidence of a functional role for the cyclin-dependent kinase inhibitor p21(WAF1/CIP1/MDA6) in the reciprocal regulation of PKC activator-induced apoptosis and differentiation in human myelomonocytic leukemia cells. Exp. Cell Res., 244: 105-116, 1998.[Medline]
  29. Townsend K. J., Trusty J. L., Traupman M. A., Eastman A., Craig R. W. Expression of the antiapoptotic MCL1 gene product is regulated by a mitogen activated protein kinase-mediated pathway triggered through microtubule disruption and protein kinase C. Oncogene, 17: 1223-1234, 1998.[Medline]
  30. Domina A. M., Smith J. H., Craig R. W. Myeloid cell leukemia 1 (MCL1) is phosphorylated through two distinct pathways, one involving ERK activation and the other G2/M accumulation or protein phosphatase 1/2A inhibition. J. Biol. Chem., 275: 21688-21694, 2000.[Abstract/Free Full Text]
  31. Chao J. R., Wang J. M., Lee S. F., Peng H. W., Lin Y. H., Chou C. H., Li J. C., Huang H. M., Chou C. K., Kuo M. L., Yen J. J., Yang-Yen H. F. mcl-1 is an immediate-early gene activated by the granulocyte-macrophage colony-stimulating factor (GM-CSF) signaling pathway and is one component of the GM-CSF viability response. Mol. Cell. Biol., 18: 4883-4898, 1998.[Abstract/Free Full Text]
  32. Gasparini M., Rottoli L., Massimino M., Gianni M. C., Ballerini E., Ravagnani F., Pupa S., Fossati-Bellani F. Curability of advanced Burkitt’s lymphoma in children by intensive short-term chemotherapy. Eur. J. Cancer, 29A: 692-698, 1993.
  33. Mugitani A., Tatsumi Y., Tanaka K., Yasui Y., Inoue T. Cyclophosphamide, epirubicin, vincristine, prednisone, bleomycin, etoposide (CEOP-BE) therapy for intermediate- and high-grade non-Hodgkin’s lymphomas. Anticancer Res., 19: 3393-3397, 1999.[Medline]
  34. Wyllie A. H., Kerr J. F., Currie A. R. Cell death: the significance of apoptosis. Int. Rev. Cytol., 68: 251-306, 1980.[Medline]
  35. Jacobsen M. D., Weil M., Raff M. C. Role of Ced-3/ICE-family proteases in staurosporine-induced programmed cell death. J. Cell Biol., 133: 1041-1051, 1996.[Abstract]
  36. Zhou P., Qian L., Bieszczad C. K., Noelle R., Binder M., Levy N. B., Craig R. W. Mcl1 in transgenic mice promotes survival in a spectrum of hematopoietic cell types, allowing for immortalization in the myeloid lineage. Blood, 92: 3226-3239, 1998.[Abstract/Free Full Text]
  37. Moulding D. A., Giles R. V., Spiller D. G., White M. R., Tidd D. M., Edwards S. W. Apoptosis is rapidly triggered by antisense depletion of MCL-1 in differentiating U937 cells. Blood, 96: 1756-1763, 2000.[Abstract/Free Full Text]
  38. Kiefer M. C., Brauer M. J., Powers V. C., Wu J. J., Umansky S. R., Tomei L. D., Barr P. J. Modulation of apoptosis by the widely distributed Bcl-2 homologue Bak. Nature (Lond.), 374: 736-739, 1995.[Medline]
  39. de La Coste A., Mignon A., Fabre M., Gilbert E., Porteu A., Van Dyke T., Kahn A., Perret C. Paradoxical inhibition of c-myc-induced carcinogenesis by Bcl-2 in transgenic mice. Cancer Res., 59: 5017-5022, 1999.[Abstract/Free Full Text]
  40. El-Assaad W., El-Sabban M., Awaraji C., Abboushi N., Dbaibo G. S. Distinct sites of action of Bcl-2 and Bcl-xL in the ceramide pathway of apoptosis. Biochem. J., 336: 735-741, 1998.
  41. Middleton G., Nunez G., Davies A. M. Bax promotes neuronal survival and antagonizes the survival effects of neurotrophic factors. Development (Camb.), 122: 695-701, 1996.[Abstract]
  42. Bouillet P., Metcalf D., Huang D. C., Tarlinton D. M., Kay T. W., Kontgen F., Adams J. M., Strasser A. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science (Wash. DC), 286: 1735-1738, 1999.[Abstract/Free Full Text]
  43. Kufe D. W., Major P. P., Egan E. M., Beardsley G. P. Correlation of cytotoxicity with incorporation of ara-C into DNA. J. Biol. Chem., 255: 8991-8997, 1980.[Abstract/Free Full Text]
  44. Crowther P. J., Cooper I. A., Woodcock D. M. Biology of cell killing by 1-ß-D arabinofuranosyl-cytosine and its relevance to molecular mechanism of cytotoxicity. Cancer Res., 45: 4291-4300, 1985.[Abstract/Free Full Text]
  45. Mapara M., Weinmann P., Bommert K., Daniel P., Bargou R., Dorken B. Involvement of NAK-1, the human nur77 homologue, in surface IgM-mediated apoptosis in Burkitt lymphoma cell line BL41. Eur. J. Immunol., 25: 2506-2510, 1995.[Medline]
  46. Milner A., Johnson G., Gregory C. Prevention of programmed cell death in Burkitt lymphoma cell lines by bcl-2-dependent and -independent mechanisms. Int. J. Cancer, 52: 636-664, 1992.[Medline]
  47. Polito P., Cilia A., Gloghini A., Cozzi M., Perin T., De Paoli P., Gaidano G., Carbone A. High frequency of EBV association with non-random abnormalities of the chromosome region 1q21–25 in AIDS-related Burkitt’s lymphoma-derived cell lines. Int. J. Cancer, 61: 370-374, 1995.[Medline]
  48. Shikano T., Arioka H., Kobayashi R., Naito H., Ishikawa Y. Jumping translocations of 1q in Burkitt lymphoma and acute nonlymphocytic leukemia. Cancer Genet. Cytogenet., 71: 22-26, 1993.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. De Biasio, J. A. Vrana, P. Zhou, L. Qian, C. K. Bieszczad, K. E. Braley, A. M. Domina, S. J. Weintraub, J. M. Neveu, W. S. Lane, et al.
N-terminal Truncation of Antiapoptotic MCL1, but Not G2/M-induced Phosphorylation, Is Associated with Stabilization and Abundant Expression in Tumor Cells
J. Biol. Chem., August 17, 2007; 282(33): 23919 - 23936.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Minagawa, E. A. Kruglov, J. A. Dranoff, M. E. Robert, G. J. Gores, and M. H. Nathanson
The Anti-apoptotic Protein Mcl-1 Inhibits Mitochondrial Ca2+ Signals
J. Biol. Chem., September 30, 2005; 280(39): 33637 - 33644.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
J. N. Harada, K. E. Bower, A. P. Orth, S. Callaway, C. G. Nelson, C. Laris, J. B. Hogenesch, P. K. Vogt, and S. K. Chanda
Identification of novel mammalian growth regulatory factors by genome-scale quantitative image analysis
Genome Res., August 1, 2005; 15(8): 1136 - 1144.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Han, L. A. Goldstein, B. R. Gastman, C. J. Froelich, X.-M. Yin, and H. Rabinowich
Degradation of Mcl-1 by Granzyme B: IMPLICATIONS FOR Bim-MEDIATED MITOCHONDRIAL APOPTOTIC EVENTS
J. Biol. Chem., May 21, 2004; 279(21): 22020 - 22029.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. W. C. J. van de Donk, D. Schotte, M. M. J. Kamphuis, A. M. W. van Marion, B. van Kessel, A. C. Bloem, and H. M. Lokhorst
Protein Geranylgeranylation Is Critical for the Regulation of Survival and Proliferation of Lymphoma Tumor Cells
Clin. Cancer Res., November 15, 2003; 9(15): 5735 - 5748.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vrana, J. A.
Right arrow Articles by Craig, R. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vrana, J. A.
Right arrow Articles by Craig, R. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online